ID: 972554983

View in Genome Browser
Species Human (GRCh38)
Location 4:40172590-40172612
Sequence GCAAGGGAGGCAGCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972554983_972554985 -10 Left 972554983 4:40172590-40172612 CCTGGAACAGCTGCCTCCCTTGC No data
Right 972554985 4:40172603-40172625 CCTCCCTTGCAGCCCTCAGAAGG No data
972554983_972554991 19 Left 972554983 4:40172590-40172612 CCTGGAACAGCTGCCTCCCTTGC No data
Right 972554991 4:40172632-40172654 CCCTGCTGACACTTCGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972554983 Original CRISPR GCAAGGGAGGCAGCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr