ID: 972556430

View in Genome Browser
Species Human (GRCh38)
Location 4:40186135-40186157
Sequence CCTTGTTTTTGGAGTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972556424_972556430 13 Left 972556424 4:40186099-40186121 CCTTTTAAGAGGTTTGATGCAAA No data
Right 972556430 4:40186135-40186157 CCTTGTTTTTGGAGTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972556430 Original CRISPR CCTTGTTTTTGGAGTCTGTC TGG Intergenic
No off target data available for this crispr