ID: 972560935

View in Genome Browser
Species Human (GRCh38)
Location 4:40228472-40228494
Sequence TTGGACCAGCAAGTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972560935 Original CRISPR TTGGACCAGCAAGTAAAAGC AGG Intronic
902677824 1:18021094-18021116 ATGGACCAGCAACTACAAGGGGG - Intergenic
903404667 1:23086242-23086264 TTGTAATAGCAAGTAAAGGCTGG - Exonic
910007579 1:82417500-82417522 TAGGAACAGCAAGGAAAGGCTGG + Intergenic
916828717 1:168469066-168469088 TTTGAGCTGCAAGTAGAAGCTGG + Intergenic
920140689 1:203810098-203810120 TTGGAGCATCATTTAAAAGCTGG + Intronic
920696851 1:208187335-208187357 ATGGACCAGCAAGAGAAAGATGG + Intronic
1064437710 10:15325769-15325791 TTGGACCAGGAAGTGAATGACGG + Intronic
1065191011 10:23209060-23209082 TTGGAACAGCATGAAACAGCAGG + Intronic
1065662914 10:28024687-28024709 TGGGAACAGCTAGGAAAAGCTGG - Intergenic
1074029119 10:109666509-109666531 TTGGCTCAGCAAGTTAAAGAAGG - Intergenic
1076562293 10:131375138-131375160 TTGGAGCAGAGAGAAAAAGCTGG - Intergenic
1076853357 10:133103682-133103704 CTGCACCAGCAGGAAAAAGCCGG + Intronic
1080658369 11:34275675-34275697 TCAGACCAGCTAGTGAAAGCAGG - Intronic
1085701839 11:78752490-78752512 TGAGACCAGCAAGGAAAGGCAGG - Intronic
1088166823 11:106949288-106949310 ATGGGCTAGTAAGTAAAAGCTGG - Intronic
1090897415 11:130990724-130990746 TTCAACCAGCAAGGAAAAGGGGG - Intergenic
1096504805 12:52086079-52086101 TTGGACCACCACTTAAAGGCAGG + Intergenic
1096579939 12:52578467-52578489 TTGGACTAGCATGGAAAAACAGG - Intergenic
1098601604 12:72337755-72337777 TAGGAACAGCAGGTAAAGGCAGG - Intronic
1103097749 12:118145667-118145689 CGTGACCAGCAAGTAACAGCTGG + Intergenic
1103983827 12:124754277-124754299 TTGGATCAGCAAGTTAACCCAGG + Intergenic
1110589094 13:77233240-77233262 TAGGACCAGCAAATACAAGGGGG + Exonic
1113142457 13:107169569-107169591 CTGGACCAGCAAGAAAGGGCTGG + Exonic
1114587863 14:23831305-23831327 TTGGAACAGCAAGTATGAGATGG + Intergenic
1115424140 14:33235525-33235547 TTGAAGGAGAAAGTAAAAGCTGG + Intronic
1116189243 14:41642242-41642264 TTGGACCACAAAGTACAATCTGG + Intronic
1119758828 14:77137461-77137483 TTGGAAAAGAAAGTATAAGCAGG + Intronic
1122496718 14:102161906-102161928 TTGGAACAACAAGTCAAAGAAGG - Intronic
1137687025 16:50393356-50393378 TAGAACCAGCAAATAAAAGTTGG - Intergenic
1139216752 16:65133110-65133132 TAGGACCAGAAAGGAAAAGTTGG - Intergenic
1140689889 16:77471796-77471818 TGGGACTTGGAAGTAAAAGCTGG + Intergenic
1145734584 17:27218427-27218449 TTGGAGCTGGAAGTAGAAGCAGG + Intergenic
1145957129 17:28862225-28862247 TCTGACCAGCAATTAAATGCTGG - Intergenic
1146225385 17:31061836-31061858 GTGGAGCTGCAAGTAGAAGCAGG - Intergenic
1148002372 17:44397473-44397495 TAATACCAGCAAGTAGAAGCTGG - Exonic
1149493233 17:57099973-57099995 TGGGACCAGCAACTAACTGCTGG + Intronic
1153273653 18:3347807-3347829 TTGGACCCGCAGGTAATAGGTGG + Intergenic
1157020273 18:43773141-43773163 TTGGAACAGAAAGAAGAAGCTGG + Intergenic
1164259289 19:23555242-23555264 CTTGAAAAGCAAGTAAAAGCTGG + Intronic
1167137408 19:47625441-47625463 TTGGACGAGAAAGTCAAAGAGGG - Intronic
927241381 2:20922656-20922678 ATGGCCCAGCCAGGAAAAGCAGG - Intergenic
930369870 2:50488985-50489007 TTGGAGCAGCAAGTACCTGCAGG - Intronic
931247759 2:60505533-60505555 TTGGACAAGAAGGTAAAAGAGGG - Intronic
935666989 2:105521281-105521303 GGGAACCAACAAGTAAAAGCTGG + Intergenic
941651635 2:168098604-168098626 TGGGAGCAGAAAATAAAAGCAGG - Intronic
942349518 2:175038294-175038316 TGGGACCAGCAGGTAAAAGATGG - Intergenic
944275088 2:197827276-197827298 TTGGAACTGGAAGAAAAAGCGGG - Intronic
944982963 2:205143303-205143325 ATGTATCAGCAAGTAAAAACGGG + Intronic
948135225 2:235631488-235631510 TTTGACCAGCAGGTATAACCAGG - Intronic
1171517064 20:25746361-25746383 TTGGACAGGCACCTAAAAGCGGG + Intergenic
1173183313 20:40820737-40820759 TTGGACCTTCAAGGATAAGCAGG - Intergenic
1174271163 20:49369739-49369761 ATGGACCACCAAGTTAAAGCAGG + Exonic
1177008798 21:15706671-15706693 TTGGACCAGCATGTAAAATTGGG + Intergenic
1178247077 21:30963564-30963586 CAGGACTAGCAAGTAAAAGGCGG + Intergenic
1179149297 21:38796343-38796365 CTGCATCAGCAAGAAAAAGCTGG - Intergenic
1182149663 22:28019185-28019207 TTTTACCAGCAAGGAAAAGAGGG - Intronic
952468661 3:33619919-33619941 TTGGACTAGCCAGTTAAAGATGG - Intronic
952758005 3:36889340-36889362 TTGCACATGCAAGGAAAAGCTGG - Intronic
953970759 3:47345090-47345112 TTTGACCAGCAGGAAACAGCAGG + Exonic
956409297 3:68962512-68962534 AAGGATCAGCAAGTAAAACCTGG - Intergenic
956479390 3:69658873-69658895 CTGGACAAGAAAGGAAAAGCTGG + Intergenic
957215490 3:77315426-77315448 TTGGACCAAACAGTAAATGCTGG + Intronic
966767350 3:183475172-183475194 ATGGTCCAGAAAGGAAAAGCAGG - Intergenic
967937959 3:194744239-194744261 TTGGACCACTCAGTGAAAGCAGG + Intergenic
972560935 4:40228472-40228494 TTGGACCAGCAAGTAAAAGCAGG + Intronic
975667133 4:76743141-76743163 TTGGGCCAGGATGTAAAAGATGG + Intronic
987933123 5:24427996-24428018 TTGGACCAGCAGGTGAAAATAGG - Intergenic
990536370 5:56727249-56727271 TGGGTCCACCAATTAAAAGCTGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992615186 5:78540685-78540707 TTGTTCCAACAAGTCAAAGCTGG - Intronic
993373586 5:87121462-87121484 TTGGACCAGCTAGTAAAGAACGG + Intergenic
993828066 5:92718066-92718088 TTGGAGCAGCTTGTAAAAGTAGG + Intergenic
993908338 5:93649321-93649343 TTGGAGAAGCAACCAAAAGCAGG + Intronic
995763593 5:115590697-115590719 TACGACATGCAAGTAAAAGCAGG - Intronic
995785268 5:115820973-115820995 TTTGACAGGAAAGTAAAAGCTGG - Intergenic
996372285 5:122766402-122766424 TTGGACCATAAAGTAAAACTGGG - Intergenic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
997942026 5:138166689-138166711 TAGGACCAGCTTCTAAAAGCCGG + Exonic
999749939 5:154620376-154620398 GTGGACCAGCAGGTAAAGGATGG - Intergenic
999917778 5:156282295-156282317 TTGCATCAGAAAATAAAAGCAGG - Intronic
1007494001 6:42246588-42246610 ATGAACCAGCAACTAAAAGCAGG - Intronic
1014551885 6:122798485-122798507 TTGGCCAAGCTATTAAAAGCAGG - Intronic
1015343835 6:132132195-132132217 TTGGAAAAGCAAATGAAAGCAGG - Intergenic
1016395358 6:143618234-143618256 TTGGAGCAGGAAGTACAAGGTGG - Intronic
1019874745 7:3799780-3799802 TTGGAGGAGCAAGTAAACTCAGG - Intronic
1025144342 7:56491787-56491809 TTGCACGATCAAGTAGAAGCTGG - Intergenic
1031808291 7:126334249-126334271 GTGGAGCAGCGAGTAAAATCAGG - Intergenic
1033010261 7:137614430-137614452 TTGGACAGGCAAGTTAAAGATGG - Intronic
1034972403 7:155427479-155427501 TTGGATCAAGAAGTTAAAGCCGG + Intergenic
1035214950 7:157358530-157358552 TGGGTCCTGCAAGTAAAAACAGG - Exonic
1046594495 8:116245791-116245813 TTGCTTCAGCAAGTAAGAGCAGG + Intergenic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1057812822 9:98270834-98270856 TTGGAGAAGAAAGTAAAAACAGG + Intergenic
1059361342 9:113744196-113744218 CAGGACCAGCACGTGAAAGCTGG + Intergenic
1059748759 9:117228607-117228629 TAGGAACAGGAATTAAAAGCTGG + Intronic
1059850731 9:118336195-118336217 TTGGATCATTAAGAAAAAGCAGG - Intergenic
1190131907 X:47755753-47755775 TTGAACCAGCGAGAAACAGCTGG + Intergenic
1192336833 X:70228443-70228465 TTGGCCCAGCATGTCAAAGCAGG + Intergenic
1193827101 X:86240284-86240306 GTGGATCAGCAAGTAGAATCTGG + Intronic
1195123052 X:101775827-101775849 TTAGAGCAGCAAGGAAAACCAGG - Intergenic
1196398051 X:115287114-115287136 TTTTACCAGCAAGGAAAAGAAGG - Intergenic
1202273749 Y:23095279-23095301 TTGGGCCAGCATTTACAAGCAGG - Intergenic
1202292277 Y:23325398-23325420 TTGGGCCAGCATTTACAAGCAGG + Intergenic
1202426745 Y:24729024-24729046 TTGGGCCAGCATTTACAAGCAGG - Intergenic
1202444046 Y:24941070-24941092 TTGGGCCAGCATTTACAAGCAGG + Intergenic