ID: 972564207

View in Genome Browser
Species Human (GRCh38)
Location 4:40255515-40255537
Sequence TCGCTTCTGTCTGCAGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972564198_972564207 6 Left 972564198 4:40255486-40255508 CCCTCTCCCCTTTCTCTTCCTCC No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data
972564200_972564207 0 Left 972564200 4:40255492-40255514 CCCCTTTCTCTTCCTCCTCTTCA No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data
972564201_972564207 -1 Left 972564201 4:40255493-40255515 CCCTTTCTCTTCCTCCTCTTCAT No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data
972564199_972564207 5 Left 972564199 4:40255487-40255509 CCTCTCCCCTTTCTCTTCCTCCT No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data
972564202_972564207 -2 Left 972564202 4:40255494-40255516 CCTTTCTCTTCCTCCTCTTCATC No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data
972564197_972564207 9 Left 972564197 4:40255483-40255505 CCTCCCTCTCCCCTTTCTCTTCC No data
Right 972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972564207 Original CRISPR TCGCTTCTGTCTGCAGCCCG GGG Intergenic
No off target data available for this crispr