ID: 972567961

View in Genome Browser
Species Human (GRCh38)
Location 4:40285822-40285844
Sequence GGTGCTGACGGAGGACAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972567949_972567961 26 Left 972567949 4:40285773-40285795 CCTAGAGGTCAGGGGTAGGCTGT No data
Right 972567961 4:40285822-40285844 GGTGCTGACGGAGGACAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972567961 Original CRISPR GGTGCTGACGGAGGACAAGC CGG Intergenic
No off target data available for this crispr