ID: 972577305

View in Genome Browser
Species Human (GRCh38)
Location 4:40363770-40363792
Sequence CTGGACTGTCTTGGACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972577299_972577305 4 Left 972577299 4:40363743-40363765 CCAATGCAACCGGGACAAACCTG No data
Right 972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG No data
972577296_972577305 15 Left 972577296 4:40363732-40363754 CCAACGCTTTACCAATGCAACCG No data
Right 972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG No data
972577302_972577305 -5 Left 972577302 4:40363752-40363774 CCGGGACAAACCTGGCAACTGGA No data
Right 972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972577305 Original CRISPR CTGGACTGTCTTGGACAAAC TGG Intergenic
No off target data available for this crispr