ID: 972580394

View in Genome Browser
Species Human (GRCh38)
Location 4:40390503-40390525
Sequence CTGTATCCCTAGAATTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972580394_972580396 29 Left 972580394 4:40390503-40390525 CCATCAAAATTCTAGGGATACAG No data
Right 972580396 4:40390555-40390577 ACAACATCTTTGTACAACTTGGG No data
972580394_972580395 28 Left 972580394 4:40390503-40390525 CCATCAAAATTCTAGGGATACAG No data
Right 972580395 4:40390554-40390576 CACAACATCTTTGTACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972580394 Original CRISPR CTGTATCCCTAGAATTTTGA TGG (reversed) Intergenic
No off target data available for this crispr