ID: 972580549

View in Genome Browser
Species Human (GRCh38)
Location 4:40392026-40392048
Sequence GTGGCCAAGTCTTTGCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972580549_972580553 29 Left 972580549 4:40392026-40392048 CCTCTTTGCAAAGACTTGGCCAC No data
Right 972580553 4:40392078-40392100 CTGATTTCTCTTTCATGTTAGGG No data
972580549_972580552 28 Left 972580549 4:40392026-40392048 CCTCTTTGCAAAGACTTGGCCAC No data
Right 972580552 4:40392077-40392099 ACTGATTTCTCTTTCATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972580549 Original CRISPR GTGGCCAAGTCTTTGCAAAG AGG (reversed) Intergenic
No off target data available for this crispr