ID: 972581323

View in Genome Browser
Species Human (GRCh38)
Location 4:40398040-40398062
Sequence TGGGTTTTCCTTAAAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972581315_972581323 24 Left 972581315 4:40397993-40398015 CCAAAATGCTGGGATTACAGGTG 0: 3865
1: 80658
2: 217963
3: 284981
4: 250431
Right 972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG No data
972581313_972581323 28 Left 972581313 4:40397989-40398011 CCTTCCAAAATGCTGGGATTACA 0: 604
1: 24329
2: 323900
3: 265228
4: 199769
Right 972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG No data
972581318_972581323 -3 Left 972581318 4:40398020-40398042 CCATGGTGCCAGGCCTCTTTTGG No data
Right 972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972581323 Original CRISPR TGGGTTTTCCTTAAAAATGA TGG Intergenic
No off target data available for this crispr