ID: 972582681 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:40408822-40408844 |
Sequence | GCTACTAGGGCGCCTGAAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972582681_972582687 | 8 | Left | 972582681 | 4:40408822-40408844 | CCTGCTTCAGGCGCCCTAGTAGC | No data | ||
Right | 972582687 | 4:40408853-40408875 | CAGGTGCACACCACCACACCCGG | 0: 998 1: 5526 2: 20193 3: 47639 4: 91260 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972582681 | Original CRISPR | GCTACTAGGGCGCCTGAAGC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |