ID: 972582681

View in Genome Browser
Species Human (GRCh38)
Location 4:40408822-40408844
Sequence GCTACTAGGGCGCCTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972582681_972582687 8 Left 972582681 4:40408822-40408844 CCTGCTTCAGGCGCCCTAGTAGC No data
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972582681 Original CRISPR GCTACTAGGGCGCCTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr