ID: 972582687

View in Genome Browser
Species Human (GRCh38)
Location 4:40408853-40408875
Sequence CAGGTGCACACCACCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165616
Summary {0: 998, 1: 5526, 2: 20193, 3: 47639, 4: 91260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972582681_972582687 8 Left 972582681 4:40408822-40408844 CCTGCTTCAGGCGCCCTAGTAGC No data
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260
972582679_972582687 26 Left 972582679 4:40408804-40408826 CCAGGTTCAAGTGATTCTCCTGC 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260
972582685_972582687 -5 Left 972582685 4:40408835-40408857 CCCTAGTAGCTGGGATTACAGGT 0: 1428
1: 52763
2: 210176
3: 278823
4: 260281
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260
972582678_972582687 27 Left 972582678 4:40408803-40408825 CCCAGGTTCAAGTGATTCTCCTG 0: 19726
1: 81126
2: 140864
3: 165550
4: 182302
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260
972582686_972582687 -6 Left 972582686 4:40408836-40408858 CCTAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 972582687 4:40408853-40408875 CAGGTGCACACCACCACACCCGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972582687 Original CRISPR CAGGTGCACACCACCACACC CGG Intergenic
Too many off-targets to display for this crispr