ID: 972584891

View in Genome Browser
Species Human (GRCh38)
Location 4:40428769-40428791
Sequence GTGGTGAATGCTATCATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972584891_972584894 7 Left 972584891 4:40428769-40428791 CCTTTTATGATAGCATTCACCAC 0: 1
1: 0
2: 0
3: 6
4: 181
Right 972584894 4:40428799-40428821 GGACAAAGCATGCAGAGATCAGG 0: 1
1: 0
2: 2
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972584891 Original CRISPR GTGGTGAATGCTATCATAAA AGG (reversed) Intronic
901048173 1:6411491-6411513 GTGGTGAGAGCTATCACAGAGGG + Intergenic
908303537 1:62786796-62786818 GTGGTAAATGCTATTAAAAAAGG + Intronic
909334282 1:74453038-74453060 GTGATAAATGCAATGATAAATGG - Intronic
909691834 1:78417043-78417065 GTGGTAAATGCTATTCTAAGTGG - Intronic
911599121 1:99829048-99829070 TTGTTGAATTCTATCAGAAAAGG - Intergenic
921823153 1:219640733-219640755 GTGGTGAATGCTGTCAAGCATGG - Intergenic
923330071 1:232915487-232915509 GTAGTGAATAATAACATAAAAGG - Intergenic
924735862 1:246755039-246755061 TTATTTAATGCTATCATAAATGG - Intronic
924745459 1:246829374-246829396 CTGGTGAATGGTTTAATAAAGGG - Intergenic
1065543574 10:26795641-26795663 TTTTTGGATGCTATCATAAATGG - Intronic
1068395081 10:56449945-56449967 GTGGTATAGGCTCTCATAAATGG - Intergenic
1068818090 10:61341128-61341150 AGGGTGAATGTTATTATAAAGGG + Intergenic
1071064500 10:81614561-81614583 CTGGTGAATGCTCTCATCACTGG + Intergenic
1072316349 10:94206977-94206999 TTGGTAAATGCTTTAATAAAAGG + Intronic
1072933824 10:99692723-99692745 GTATTGAGTGCTATCATAAGGGG + Intronic
1077706337 11:4489762-4489784 ATGGTCAATCCTATCATATATGG + Exonic
1085665540 11:78412512-78412534 GTAGTGAATACGATTATAAAAGG + Intronic
1086793238 11:91067734-91067756 GTGGTGATTGCTATTAAAACTGG - Intergenic
1087164000 11:94980670-94980692 ATGCTTAATGCTATTATAAATGG + Intronic
1087610817 11:100432224-100432246 GTGGAGAAAGCAATCAAAAAAGG - Intergenic
1088337725 11:108726449-108726471 TTTTTTAATGCTATCATAAATGG + Intronic
1093321294 12:17718503-17718525 GTGGTGAATTCTGCCAGAAATGG + Intergenic
1097371768 12:58791283-58791305 GTTGTTAATGCTATTGTAAATGG - Intronic
1099709422 12:86203092-86203114 ATGGTCAATGTTATCTTAAAAGG + Intronic
1100487116 12:95040905-95040927 TTGTTGTATGCTATCATTAATGG - Intronic
1101945874 12:109136588-109136610 CTTTTGAATGCTATTATAAATGG + Intronic
1104316317 12:127705666-127705688 GGGGTGAATGCAGTTATAAAAGG + Intergenic
1107043228 13:35970528-35970550 GTGTTTAATGCATTCATAAAAGG + Intronic
1108094946 13:46891844-46891866 TTGGTGTGTGGTATCATAAAAGG + Intronic
1109012225 13:56966249-56966271 GTGGGCAATGCTTTCCTAAATGG - Intergenic
1110098659 13:71566357-71566379 GTGGTGGCTGGCATCATAAAAGG - Intronic
1111746647 13:92279271-92279293 GCTTTGGATGCTATCATAAATGG + Intronic
1113363984 13:109659152-109659174 GTTTTTGATGCTATCATAAATGG - Intergenic
1114331821 14:21645091-21645113 ATGGTGAATGCTATGATCAATGG + Intergenic
1115172322 14:30523586-30523608 ATGATGACTGCTATCATTAAAGG - Intergenic
1115820978 14:37212001-37212023 GTGATGAATGCTGCCAGAAATGG - Intronic
1117418396 14:55519225-55519247 GTGGTGAATGCTGCCAGGAAAGG - Intergenic
1117759094 14:59007606-59007628 GTGGTAATTGGTACCATAAATGG - Intergenic
1120136953 14:80880999-80881021 TTTTTTAATGCTATCATAAATGG - Intronic
1120259291 14:82161443-82161465 TTGGTGAATTCTATCTTAAAAGG + Intergenic
1123195632 14:106613550-106613572 GTTCAGAATGATATCATAAAAGG - Intergenic
1125476718 15:40052823-40052845 GTGGTTAATGATTTCATCAATGG - Intergenic
1125951209 15:43753421-43753443 CTGGGGAATTCTATCAGAAATGG + Intronic
1126191153 15:45880353-45880375 GTGGTGAATCCTTTACTAAAGGG + Intergenic
1127178049 15:56382575-56382597 GTGATGAATGCTGTCAGAACTGG + Intronic
1128818681 15:70632962-70632984 GTGGTGTATGCAAGCATAGATGG - Intergenic
1130807572 15:87342339-87342361 GTTGGGAATGCTATTGTAAATGG - Intergenic
1138996324 16:62457639-62457661 ATTTTTAATGCTATCATAAATGG + Intergenic
1139816915 16:69682255-69682277 GTGGTGATTTCTATAAGAAATGG + Intronic
1141704621 16:85658085-85658107 CTGGGAAATGCTTTCATAAAGGG - Intronic
1143595152 17:7909535-7909557 GATGTGAATGCTATCAGACATGG - Intronic
1144449786 17:15367070-15367092 CTTTTGGATGCTATCATAAATGG - Intergenic
1149518311 17:57298096-57298118 GTGGTGAATGCTTTCCAGAAGGG + Intronic
1150556473 17:66259245-66259267 GTGATGAATGCCCTTATAAAAGG + Intergenic
1151136541 17:71951405-71951427 GTAGTGAATGCTGTAATATATGG + Intergenic
1151138919 17:71973229-71973251 ATGATGAATGGTATTATAAAAGG + Intergenic
1155271016 18:24141115-24141137 CTGTTGAATGATATCGTAAAAGG + Intronic
1155721342 18:29016096-29016118 TTTGTGAATGCTAACAGAAAAGG + Intergenic
1164698421 19:30264152-30264174 CTGGTGAAAGCTTTCTTAAATGG + Intronic
1166363392 19:42266002-42266024 GTGCTTCATGCTATCACAAAAGG - Intergenic
926618801 2:15027727-15027749 GTGGTAAACGTTATCCTAAATGG - Intergenic
928118486 2:28564912-28564934 GTTGTGAAGTATATCATAAAAGG - Intronic
929231982 2:39569431-39569453 GAGGTGACTGCTCTCATGAATGG + Intergenic
929710740 2:44264077-44264099 GTTTTGAATGCTATCGTAAATGG - Intergenic
931145392 2:59511618-59511640 TTGGAGAATGATATAATAAAGGG + Intergenic
935750525 2:106229042-106229064 TTGCTGACAGCTATCATAAATGG + Intergenic
937566799 2:123302549-123302571 CTGTTTAATGCTATTATAAATGG - Intergenic
939879299 2:147611985-147612007 GTGGTAGATGATATCATGAAAGG - Intergenic
940831003 2:158465677-158465699 GTGATGTATGCTAGAATAAATGG + Intronic
941483670 2:166051074-166051096 GTGGTGATTGATATAATGAAAGG - Intronic
942757725 2:179361968-179361990 GTGGTGAAATCTATCATAGCAGG - Intergenic
943656594 2:190515270-190515292 ATGTTAAATTCTATCATAAAGGG + Intronic
943923279 2:193738274-193738296 GTGATGAATGCTGTCAGGAATGG - Intergenic
944365807 2:198918179-198918201 GTAGTGATTGCCATCATTAATGG + Intergenic
1169310050 20:4529489-4529511 ATTGTTAATGCTATTATAAATGG - Intergenic
1170062848 20:12277101-12277123 TTGGTGAATCCTGTCATGAATGG - Intergenic
1171136814 20:22702012-22702034 ATGGTGAATGCTGTGATAGAGGG - Intergenic
1172492955 20:35355854-35355876 GTGTAGAATGCTAGCACAAAAGG - Intronic
1172863435 20:38076168-38076190 GGGGTAAATGGTATCTTAAAGGG - Intronic
1174650274 20:52119020-52119042 GTGGTGGCAGCTATCAAAAAAGG + Intronic
1178772611 21:35519735-35519757 GTGGTAAGTGCTGTGATAAAAGG + Intronic
1178995207 21:37392978-37393000 TTGGTTAATGCCATTATAAAAGG - Intronic
1179807305 21:43847855-43847877 GTCGTCAAGACTATCATAAAAGG - Intergenic
950689214 3:14642293-14642315 GGGATTAATGCTGTCATAAAAGG + Intergenic
951362948 3:21746492-21746514 CAGGTGAATACTATCAGAAAGGG - Intronic
951515413 3:23553790-23553812 TTTTTAAATGCTATCATAAATGG - Intronic
957640029 3:82841338-82841360 CTTTTGAATGCAATCATAAATGG - Intergenic
957704461 3:83761577-83761599 GTGGTGAGTGTGATTATAAAAGG + Intergenic
959242072 3:103808867-103808889 GTGGTGAGTGCCCTCAGAAAGGG + Intergenic
961128949 3:124447443-124447465 GTGGGAAATGCTATAATAGAAGG + Intronic
961230964 3:125308288-125308310 TGGTTGGATGCTATCATAAATGG - Intronic
962160846 3:132998750-132998772 GGGATTAATGCTATTATAAAAGG + Intergenic
963196712 3:142539918-142539940 GTGGGGAATTTTATAATAAAGGG + Intronic
964179438 3:153865616-153865638 GTGGTGAATGCTGTTAGAACTGG - Intergenic
964317836 3:155462922-155462944 GTGGTGAAGTCTACCCTAAAAGG - Intronic
964376858 3:156056361-156056383 ATGGTAAATGCTGTCATCAATGG - Intronic
966435583 3:179880114-179880136 GTGGTCAATACTACCAGAAATGG + Exonic
966582302 3:181581687-181581709 GTGGTGACTGCTATGGTAGAAGG + Intergenic
971330931 4:25680890-25680912 GTGGTGAGTGTTATTTTAAAAGG + Intergenic
972009481 4:34158800-34158822 GTGGTGAATGCTGTCATACCTGG - Intergenic
972584891 4:40428769-40428791 GTGGTGAATGCTATCATAAAAGG - Intronic
973182414 4:47285770-47285792 GAGATGAATGACATCATAAAAGG + Intronic
973783731 4:54315657-54315679 GTGGTGGCTACTTTCATAAAAGG + Intergenic
974607195 4:64168646-64168668 ATGCTGAATGTTCTCATAAATGG - Intergenic
974610592 4:64210343-64210365 GGGGTTAATGCTTTTATAAAGGG + Intergenic
978034893 4:103980417-103980439 TTGGTGAGTGCTATAATAGAGGG + Intergenic
980070737 4:128240875-128240897 TTGGTGGATGCTAACATGAAGGG + Intergenic
981273659 4:142872870-142872892 CTCATGAATGCTATAATAAAAGG + Intergenic
983066434 4:163215059-163215081 CTGGAGAATGCTAACATCAAGGG + Intergenic
988003220 5:25376482-25376504 GCTGCCAATGCTATCATAAAAGG - Intergenic
989751380 5:44898313-44898335 TTGATGAATGTTATCATGAATGG - Intergenic
991367718 5:65886562-65886584 GTGGTGAGTGCTGTAATGAAAGG + Intergenic
992284989 5:75225947-75225969 GTGGTGAATGCTATCAGGTCTGG - Intronic
993156346 5:84229444-84229466 GTGCTGTATGCTCTCATGAAAGG + Intronic
994074022 5:95630952-95630974 GTGGTGAATGCATTAAAAAAGGG + Intergenic
994181725 5:96774827-96774849 GTAGTGAATGGTTTAATAAATGG + Intronic
995310941 5:110710689-110710711 ATGTTGAATTTTATCATAAAAGG - Intronic
995655998 5:114426752-114426774 GTATTGAATGGTATCATATAGGG + Intronic
1000540592 5:162534801-162534823 GTTATTAATGCTATTATAAATGG - Intergenic
1001358218 5:171053471-171053493 CTTTTGAATGCTATTATAAATGG + Intronic
1004274358 6:14222477-14222499 GAGGTGACTGCAATCAGAAAAGG - Intergenic
1004475701 6:15969286-15969308 GTGGTTAAGGCTATGATAAAAGG - Intergenic
1004524592 6:16394811-16394833 GTGGAAAATGCAGTCATAAATGG - Intronic
1004871745 6:19912254-19912276 CTAGGGAATGCTATTATAAATGG - Intergenic
1007355703 6:41314302-41314324 GAGGTGAATGCTTGAATAAAAGG + Intergenic
1008687385 6:53940941-53940963 GGGTTGAATGCCATTATAAAAGG + Intronic
1010186135 6:73145519-73145541 GTAGTGTATGCAATGATAAAGGG - Intronic
1010790644 6:80060697-80060719 GTGGGAAATGCTATCAACAATGG + Intergenic
1012585339 6:100914567-100914589 TTGGTGAATACTCTCAGAAAAGG - Intergenic
1013682190 6:112536785-112536807 GTGGTGATTGCTATAAAAAGAGG - Intergenic
1013875162 6:114816670-114816692 TTTTTGAATGCTATTATAAATGG + Intergenic
1014085563 6:117338835-117338857 GGGGTGAAGGCTACCATAGAGGG + Intronic
1015080205 6:129215019-129215041 GTGGAGCATGCTAGTATAAATGG + Intronic
1015780718 6:136862691-136862713 GTTGTAAATGCTACCATAAGAGG + Intronic
1016192278 6:141284885-141284907 TTTGTGAATGCTATTTTAAATGG + Intergenic
1016558145 6:145362972-145362994 TTTGTTACTGCTATCATAAATGG - Intergenic
1019871737 7:3770087-3770109 GTGGTGAATGTATTTATAAAAGG + Intronic
1020992218 7:15213580-15213602 GTGGAGGATGCTTTTATAAAAGG - Intronic
1021227624 7:18046905-18046927 GTGGAGAGGGGTATCATAAAAGG + Intergenic
1022774110 7:33506804-33506826 GTGGTGAATGATATATTATAAGG + Intronic
1022849868 7:34249190-34249212 GTGGTGCATGTTAAAATAAAAGG - Intergenic
1024020053 7:45360546-45360568 ATAGTAAATGCTATTATAAATGG - Intergenic
1024640660 7:51326072-51326094 GTTGTGAATGTTGTCATACAAGG - Intergenic
1025886885 7:65603860-65603882 GTGAGAAATGCTATCATATAGGG - Intergenic
1026572162 7:71540787-71540809 CTGGTGAATGCTGTCATCAGGGG - Intronic
1030408349 7:109143365-109143387 GTGATGAATGCTAGCAGAACTGG + Intergenic
1031855529 7:126918083-126918105 GTGAGAAATGCTATCATATAGGG + Intronic
1033262398 7:139855090-139855112 GAGGGCAAAGCTATCATAAATGG + Intronic
1039680018 8:39723822-39723844 GTGGTGAAAACTATGAAAAACGG - Exonic
1041823248 8:62063306-62063328 GTGATGAATGCTATCAGGACCGG - Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043772970 8:84227854-84227876 ATTGTTAATACTATCATAAATGG + Intronic
1045300035 8:100903098-100903120 GTGGTGACTTCTAACAGAAAGGG + Intergenic
1045980409 8:108180243-108180265 GTGGTGGATTCTATCATACTGGG - Intergenic
1047183284 8:122609601-122609623 GTGGTAATGGCTATAATAAAAGG + Intergenic
1050406055 9:5309689-5309711 GTTGTGAGTGCTGTGATAAAAGG - Intergenic
1050644266 9:7702360-7702382 GTGGTGAATGCTGTCAGGACTGG + Intergenic
1050984419 9:12064109-12064131 TTAGTGAATGCTAGCAGAAATGG - Intergenic
1051110967 9:13635988-13636010 GTGTTCAATGCTCTTATAAAAGG - Intergenic
1052807935 9:33029274-33029296 TTGGGCAATGCTATTATAAAAGG + Intronic
1055911606 9:81359323-81359345 TTGGTCAATCCTAACATAAAAGG + Intergenic
1055947198 9:81702276-81702298 TTGGTAAATGCTATAATTAAGGG + Intergenic
1056238268 9:84617728-84617750 GTGATGAATGCTACCACAATAGG + Intergenic
1057134433 9:92677458-92677480 GGGATTAATGCCATCATAAATGG - Intergenic
1057331819 9:94121892-94121914 TTGATTAATGCTATTATAAAAGG + Intergenic
1059403648 9:114086489-114086511 GGGCTGAATCCTATCAGAAACGG + Intronic
1059555450 9:115276165-115276187 GTGGTGAATGCTGGCATGCATGG + Intronic
1186661582 X:11672880-11672902 TTGGTAAGTGCTATAATAAAGGG - Intergenic
1189633809 X:42983472-42983494 GGGATTAATGCCATCATAAAAGG + Intergenic
1190008761 X:46764397-46764419 TTGCTGAAAGCTATCATGAATGG - Intergenic
1190065290 X:47236801-47236823 TTTTTGGATGCTATCATAAATGG - Intronic
1190842463 X:54158134-54158156 TTGGTGGCTGCTATTATAAAAGG - Intronic
1190910152 X:54764178-54764200 GTAATGACTGCAATCATAAATGG - Intronic
1191967543 X:66776648-66776670 GTGATGAATGCTGTCATGACTGG + Intergenic
1192279211 X:69666055-69666077 GTTTTCGATGCTATCATAAATGG + Intronic
1192771627 X:74198240-74198262 GTGTTTTATGTTATCATAAATGG + Intergenic
1193000624 X:76558600-76558622 GTGATGAATGCTTCCAGAAATGG + Intergenic
1193876603 X:86869429-86869451 GTGATGAATGCTGTCAGAACTGG + Intergenic
1195063935 X:101221967-101221989 TTGGTAAATGCTATCCTAGAAGG - Intronic
1197568255 X:128115541-128115563 TTGGTGAATTCTTTCATAGAAGG + Intergenic
1199317300 X:146395660-146395682 GTGGTGAATGCTGCCTTACATGG + Intergenic
1200251768 X:154557795-154557817 GTAGTAAATGCTGTCAGAAAGGG + Intronic
1200253975 X:154569479-154569501 GTAGTAAATGCTGTCAGAAAGGG + Intergenic
1200263794 X:154634929-154634951 GTAGTAAATGCTGTCAGAAAGGG - Intergenic
1200265999 X:154646621-154646643 GTAGTAAATGCTGTCAGAAAGGG - Intergenic
1201367125 Y:13219704-13219726 GTGGTTATAGCTATTATAAATGG - Intergenic
1202387990 Y:24343303-24343325 GTGGTTAGTGCCATCAAAAATGG + Intergenic
1202482797 Y:25326825-25326847 GTGGTTAGTGCCATCAAAAATGG - Intergenic