ID: 972585168

View in Genome Browser
Species Human (GRCh38)
Location 4:40431104-40431126
Sequence CAATTGAAAAAGAATTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1208
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 1129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972585168_972585172 -8 Left 972585168 4:40431104-40431126 CCTGGATAATTCTTTTTCAATTG 0: 1
1: 0
2: 1
3: 77
4: 1129
Right 972585172 4:40431119-40431141 TTCAATTGGATAAGGGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 101
972585168_972585175 12 Left 972585168 4:40431104-40431126 CCTGGATAATTCTTTTTCAATTG 0: 1
1: 0
2: 1
3: 77
4: 1129
Right 972585175 4:40431139-40431161 TGGGCCTGAGTACTTGTGATCGG 0: 1
1: 0
2: 0
3: 9
4: 171
972585168_972585173 -7 Left 972585168 4:40431104-40431126 CCTGGATAATTCTTTTTCAATTG 0: 1
1: 0
2: 1
3: 77
4: 1129
Right 972585173 4:40431120-40431142 TCAATTGGATAAGGGATCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972585168 Original CRISPR CAATTGAAAAAGAATTATCC AGG (reversed) Intronic
900224837 1:1528118-1528140 AAATTAAAAAAAAATTAGCCAGG - Intronic
900962062 1:5929926-5929948 CTTTTGAAAAAGAAATATTCAGG - Intronic
901111403 1:6799226-6799248 AAATTAAAAAAGAATTAGCCGGG - Intronic
902006364 1:13235433-13235455 AAATAGAAAAAAAATTAGCCAGG + Intergenic
902035375 1:13454274-13454296 CAATAGAGGAAGAATTATCTTGG - Intergenic
902049650 1:13552801-13552823 CAAAAAAAAAAAAATTATCCGGG + Intergenic
902592272 1:17483558-17483580 CAAAAAAAAAAGAATTAGCCTGG - Intergenic
902909710 1:19586457-19586479 AAATTCAAAAAAAATTAGCCAGG + Intergenic
903090742 1:20913965-20913987 AAATACAAAAAAAATTATCCAGG - Intronic
903105379 1:21074172-21074194 CTCATGATAAAGAATTATCCTGG - Intronic
903160879 1:21488333-21488355 CAAAAAAAAAAAAATTATCCAGG + Intergenic
903490009 1:23721152-23721174 AAATAGAAAAAAAATTAGCCAGG + Intergenic
903514875 1:23903411-23903433 CAAATAAAAAAAAATTAGCCAGG + Intronic
903900513 1:26641488-26641510 AAATACAAAAACAATTATCCAGG - Intergenic
904405040 1:30282909-30282931 CATTGGAAAAAGAATTGTCTTGG - Intergenic
904601819 1:31677244-31677266 AAATACAAAAAGAATTAACCGGG - Intronic
904664567 1:32109803-32109825 AAATACAAAAAAAATTATCCAGG - Intronic
904798451 1:33075357-33075379 AAATACAAAAAGAATTAGCCAGG - Intronic
904820069 1:33236379-33236401 AAAATGAAAAAAAATTAGCCAGG + Intergenic
904925225 1:34042451-34042473 CAACTAATATAGAATTATCCAGG - Intronic
905106745 1:35567737-35567759 CAAAAGAAAAACAATTAGCCGGG + Intergenic
905121002 1:35681809-35681831 AAATTAAAAAAAAATTAGCCTGG + Intergenic
905158805 1:36013095-36013117 AAAATTAAAAAGAATTAGCCAGG - Intronic
905209439 1:36363509-36363531 CCATTTAAAAAGAATTAGCCGGG + Intronic
905512514 1:38533307-38533329 AAATACAAAAAAAATTATCCGGG + Intergenic
905809893 1:40904520-40904542 CAAAAAAAAAAAAATTATCCAGG + Intergenic
905957387 1:42010053-42010075 CAAAAGAAAAAAAATTAGCCAGG - Intronic
905961152 1:42043669-42043691 AATTTGAAAAAGCATTATCTAGG + Intergenic
906335134 1:44923004-44923026 GATCTGAAAAAGAATTAGCCAGG - Intronic
906803780 1:48760154-48760176 CATTTACAAGAGAATTATCCAGG + Intronic
907092425 1:51739245-51739267 CAATTGAAAAAAAATTCAGCTGG + Intronic
907191734 1:52655023-52655045 AAATACAAAAAGAATTAGCCAGG + Intronic
907348702 1:53807084-53807106 AAATTCAAAAAAAATTAGCCGGG + Intronic
907359008 1:53899832-53899854 CTCTTAAAAAAAAATTATCCAGG - Intronic
907655359 1:56336760-56336782 CATTAGAAGAAGAATTATCTTGG - Intergenic
907691221 1:56668610-56668632 CAATTAAAAAATAATTATTTGGG - Intronic
908782967 1:67708572-67708594 CAATGGAAACAGAAACATCCTGG + Intronic
908830496 1:68173936-68173958 CATTTAAAAAAAAGTTATCCAGG + Intronic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909289045 1:73858968-73858990 CAAATGCAAAAAAATTAGCCAGG - Intergenic
909391062 1:75123035-75123057 CAATTGAAAAATACTGATCTAGG + Intergenic
909634175 1:77796800-77796822 CAATTGAAAAAAAATCAACCAGG - Intronic
909798810 1:79779772-79779794 AAATAGAAAAAAAATTAGCCGGG + Intergenic
909805070 1:79864428-79864450 AAATGCAAAAAAAATTATCCAGG - Intergenic
910032382 1:82743855-82743877 CAATTGAAAGACATTTATACAGG - Intergenic
910081669 1:83349261-83349283 TAATTGAAAAATAATTAGCAAGG + Intergenic
910155785 1:84217632-84217654 AAAATAAAAAAGAATTAGCCAGG + Intronic
910187086 1:84555753-84555775 CTATTGAATCAGAATTCTCCAGG + Intronic
910580923 1:88823541-88823563 CAAATAAAAAAAAATTAGCCAGG + Intronic
910903179 1:92144648-92144670 AAATTTAAAAAAAATTAGCCAGG + Intronic
911008205 1:93250218-93250240 AAAGTGAAAAAAAATTAGCCAGG + Intronic
911381442 1:97120036-97120058 CAAGTAACAAATAATTATCCAGG + Intronic
911483252 1:98472191-98472213 CATTTTAAAAAGAATAGTCCCGG + Intergenic
911496249 1:98635199-98635221 AAATTCAAAAAAAATTAGCCAGG + Intergenic
911609186 1:99942098-99942120 AAATTAAAAAAAAATTATCCAGG - Intergenic
911652908 1:100410049-100410071 AAAATAAAAAAGAATTAACCAGG + Intronic
911777557 1:101833608-101833630 AAATTCCAAAAGAATTATCCAGG - Intronic
911876893 1:103177476-103177498 AAATAGAAAAAGAATTCTTCAGG - Intergenic
912674426 1:111664211-111664233 CAAATACAAAAAAATTATCCGGG + Intronic
913042738 1:115043274-115043296 AAATATAAAAAAAATTATCCAGG + Intergenic
913461391 1:119089742-119089764 TAATTACAAAAGAATTATACTGG + Intronic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914698535 1:150108634-150108656 CAATTGAAGAAGGTATATCCAGG + Intronic
914843685 1:151268363-151268385 AAATAGAAAAAAAATTAGCCGGG + Intergenic
914972652 1:152324714-152324736 TAATGGAAAAAGAATTGTCTTGG - Intronic
915182125 1:154071255-154071277 AAATTAAAAAAAAGTTATCCAGG - Intronic
915233392 1:154462966-154462988 CTACTAAAAAAGAATTAGCCGGG - Intronic
915716480 1:157949612-157949634 AAATTAAAAAAAAATTAGCCTGG - Intergenic
915727916 1:158031920-158031942 CAAAAGAAAAACAATTAGCCTGG + Intronic
916053222 1:161050461-161050483 AAATTAAAAAAAAATTAGCCAGG - Intronic
916408181 1:164518376-164518398 AAATAGAAAAAAAATTAGCCAGG + Intergenic
917571471 1:176269988-176270010 AAATTGAAAAAATATTAGCCAGG + Intergenic
918150153 1:181791310-181791332 AAATACAAAAAAAATTATCCAGG + Intronic
918408905 1:184238124-184238146 CAATTAAAAAAAAATTAGCTGGG - Intergenic
919707314 1:200689900-200689922 AAATTTAAAAAAAATTAGCCAGG + Intergenic
920023460 1:202973939-202973961 CAATTCCAAAAGAATTCTGCTGG + Intergenic
920065408 1:203266120-203266142 AAATTAAAAAAAAATTAGCCAGG - Intronic
920170470 1:204069166-204069188 AAAATGAAAAACAATTAGCCAGG + Intergenic
920241185 1:204551914-204551936 CAATGGAAGAAGAATTGTCTTGG + Exonic
920342264 1:205282889-205282911 CAATAAAAAAACAATTAGCCGGG - Intergenic
920534303 1:206727780-206727802 CAATACAAAAAAAATTAGCCAGG - Intronic
920891121 1:209986450-209986472 TAATTTAAAAAAAATTAGCCGGG + Intronic
921564335 1:216698356-216698378 AAATACAAAAAAAATTATCCGGG + Intronic
921728031 1:218545674-218545696 AAATAGAAAAAGAATTAGCTGGG - Intergenic
922231198 1:223688240-223688262 AAATTAAAAAAAAATTAACCTGG - Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
922641343 1:227234971-227234993 CATTGGAAAAAGAATTGTCTTGG - Intronic
922708936 1:227812483-227812505 CAATCAAAACAGAATGATCCTGG + Intergenic
922713928 1:227856294-227856316 AAATTTAAAAACAATTAGCCAGG - Intergenic
922755676 1:228095580-228095602 CAATGGAAGAAGAATTGTCTTGG - Intronic
923164248 1:231344344-231344366 AAATTGAAAAAAAATTAGCCAGG + Intronic
923623756 1:235597784-235597806 AAATAGAAAAAAAATTAGCCAGG - Intronic
923909354 1:238422947-238422969 CAATTTAAATAAAATTATCTAGG - Intergenic
923982123 1:239336938-239336960 AAATTAAAAAATAATTAGCCAGG + Intergenic
924119773 1:240784483-240784505 AAATACAAAAAGAATTAGCCGGG + Intronic
924371501 1:243355764-243355786 AAATACAAAAAGAATTAGCCGGG - Intronic
924371923 1:243360304-243360326 CAAATAAAAAAAAATTAGCCAGG - Intronic
924372878 1:243372835-243372857 CAATTAAAAAAAAATTATCTGGG + Intronic
924628568 1:245715829-245715851 CAACTGGAAAAGAATAATTCAGG - Intergenic
924764735 1:247021720-247021742 AAATAGAAAAAAAATTAGCCAGG - Intergenic
1063197894 10:3760066-3760088 CATTTCAAAAAGAACTAACCTGG - Intergenic
1063250604 10:4269711-4269733 AAATTTAAAAAAAATTAGCCAGG + Intergenic
1063417434 10:5885339-5885361 AAATTCAAAAAAAATTAGCCGGG - Intronic
1063632547 10:7747736-7747758 AAATATAAAAATAATTATCCAGG + Intronic
1063708636 10:8455681-8455703 AAATTAAAAAAGAATACTCCAGG - Intergenic
1063754191 10:8987296-8987318 CAATTTATAAAGAATGTTCCTGG + Intergenic
1064136194 10:12752948-12752970 TAATTGAAAAACAATTGGCCGGG + Intronic
1064365988 10:14708236-14708258 AAATTAAAAAAAAATTAGCCAGG - Intronic
1064463339 10:15555854-15555876 AAATACAAAAAAAATTATCCGGG - Intronic
1064570499 10:16687878-16687900 AAAATGAAAAAAAATTAGCCGGG - Intronic
1064611031 10:17102765-17102787 CAAATAAAAAAAAATTAGCCAGG - Intronic
1064661210 10:17609821-17609843 AAATAGAAAAAAAATTAGCCAGG + Intronic
1064687579 10:17879512-17879534 AAATTAAAAAAAAATTAGCCAGG - Intronic
1064734126 10:18363235-18363257 CAATTTCAAAAGTATTAGCCTGG + Intronic
1064858919 10:19803778-19803800 CAAAAGTAAAAGAATTAGCCAGG - Intergenic
1064881528 10:20060185-20060207 AAAATAAAAAAGAATTAGCCAGG - Intronic
1065000206 10:21331475-21331497 AAATTAAAAAAAAATTAGCCGGG + Intergenic
1065193983 10:23243524-23243546 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1065410236 10:25418234-25418256 TAATTGAAAGAGATTTGTCCAGG + Intronic
1065518560 10:26549798-26549820 CATTTGAAAAAGAAATATTAAGG - Intronic
1065608923 10:27451303-27451325 AAATTAAAAAAGAATTAGCCTGG - Intergenic
1066469910 10:35688288-35688310 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1066667950 10:37804592-37804614 TAATTAAAAAATAATTAGCCAGG - Intronic
1066707438 10:38196861-38196883 AAATACAAAAAAAATTATCCAGG - Intergenic
1067104181 10:43354735-43354757 AAATACAAAAAGAATTAGCCAGG + Intergenic
1067376409 10:45731379-45731401 AAATAGAAAAAAAATTAGCCAGG - Intronic
1067884108 10:50072067-50072089 AAATAGAAAAAAAATTAGCCAGG - Intronic
1068324212 10:55462664-55462686 CAATTGAAAAAAAGTAATGCTGG - Intronic
1068423108 10:56821880-56821902 AAATACAAAAAGAATTAGCCAGG - Intergenic
1069124617 10:64615037-64615059 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1069305354 10:66962568-66962590 AAATAGAAAAAAAATTATCTGGG - Intronic
1069459444 10:68580619-68580641 AAATTCAAAAAAAATTAGCCGGG + Intronic
1069671470 10:70208484-70208506 AAATTAAAAAAAAATTAGCCAGG - Intronic
1069672768 10:70223373-70223395 TAATTAAAAAACAATTAGCCAGG - Intronic
1070048233 10:72861184-72861206 AAAAAGAAAAAAAATTATCCAGG - Intronic
1070536918 10:77385965-77385987 CAATGGAAAAAGAAGCATCAAGG + Intronic
1070596570 10:77836910-77836932 CATTTTAAAAAGAATTATTTGGG + Intronic
1070913313 10:80136630-80136652 AAATTAAAAAAAAATTAGCCAGG - Intronic
1071176790 10:82935782-82935804 AAAATAAAAAAAAATTATCCAGG - Intronic
1071435275 10:85643219-85643241 CAATTGCTAAAGAAGTTTCCAGG + Intronic
1071563715 10:86661114-86661136 CAAAAAAAAAAAAATTATCCTGG + Intronic
1071692150 10:87832231-87832253 AAATTAAAAAAGAATTATCAGGG + Intronic
1071889037 10:89982321-89982343 CAATTTAAAAAGATTTTTCTGGG - Intergenic
1072034048 10:91548441-91548463 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1072073988 10:91949979-91950001 AAATTAAAAAAAAATTAGCCAGG + Intronic
1072091124 10:92128260-92128282 CACTTGAAGAAGAATTGTCTTGG + Intronic
1072092746 10:92145327-92145349 CTAAAGAAAAAGAATCATCCAGG + Intronic
1072536162 10:96365049-96365071 CATTGGAAGAAGAATTATCTTGG + Exonic
1072616384 10:97051650-97051672 AAATACAAAAAGAATTAGCCGGG + Intronic
1072696153 10:97604480-97604502 AAAATAAAAAAGAATTAGCCAGG - Intronic
1072833067 10:98679848-98679870 CAATAAAAAAAAAATTAGCCGGG - Intronic
1073090743 10:100936492-100936514 AAATACAAAAAGAATTAGCCAGG - Intronic
1073281349 10:102356604-102356626 AAATACAAAAAGAATTAGCCAGG + Intronic
1073751315 10:106530435-106530457 AAATTGAAAAAGAATTAGCTAGG - Intergenic
1074365280 10:112852937-112852959 CAATTAAAAAAAAATTAGCTGGG - Intergenic
1074701758 10:116098483-116098505 TAATTTCAAAAGAATTTTCCTGG + Intronic
1075497396 10:122936083-122936105 CTCATGAAAAAGAAATATCCAGG - Intronic
1075618631 10:123909582-123909604 CAATGGAAAGAGAAATATTCTGG - Intronic
1075760840 10:124855105-124855127 CAAATGAAAAAAGATTACCCAGG - Intergenic
1076407875 10:130225361-130225383 AAATTTAAAAAAAATTAGCCGGG + Intergenic
1077645008 11:3915896-3915918 AAATACAAAAAGAATTAGCCAGG + Intronic
1077698687 11:4419310-4419332 CAAATGAGAAAGAAAAATCCAGG - Intergenic
1077728879 11:4706399-4706421 AAAATAAAAAAAAATTATCCAGG + Intronic
1078120574 11:8504639-8504661 AAAATAAAAAATAATTATCCAGG + Intronic
1078139818 11:8683836-8683858 AAATAGAAAAAGAATTAGCCGGG - Intronic
1078378883 11:10821749-10821771 AAATTGACAAAGCATTATCTAGG - Intronic
1078622421 11:12921377-12921399 AAATACAAAAAAAATTATCCGGG + Intronic
1078673227 11:13383690-13383712 AAATACAAAAAAAATTATCCAGG + Intronic
1078701879 11:13693128-13693150 CATTGGAAGAAGAATTATCTTGG + Intronic
1078824691 11:14917954-14917976 AAAATTAAAAAAAATTATCCAGG + Intronic
1079724065 11:23858012-23858034 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1079740129 11:24048246-24048268 CAACAGAAAAAGAAATACCCTGG + Intergenic
1080490639 11:32760278-32760300 TAACTGAAAAAAAATTATCTAGG + Intronic
1080561032 11:33462985-33463007 AAATAGAAAAAGAATTAGCCAGG - Intergenic
1080755501 11:35193185-35193207 CATTGGAAGAAGAATTGTCCTGG + Intronic
1080811765 11:35711593-35711615 AAATTAAAAAAAAATTAGCCAGG + Intronic
1080852851 11:36085770-36085792 CAATAAAAAAAAAATTAGCCAGG - Intronic
1080962073 11:37172365-37172387 AAATTAAAAAAAAATTAACCAGG + Intergenic
1081158015 11:39718464-39718486 CAATACAAAAAAAATTAGCCAGG + Intergenic
1081509440 11:43754413-43754435 AAATTAAAAAAAAATTAGCCGGG + Intronic
1081513009 11:43795359-43795381 CAATTGAATAAGAATTATAATGG - Intronic
1081637605 11:44730782-44730804 AAATTCAAAAAAAATTAGCCAGG - Intronic
1082217656 11:49593929-49593951 TTATTGAAAAAGAATTTTACTGG + Intergenic
1083016057 11:59455286-59455308 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1083195910 11:61087326-61087348 AAATTAAAAAAAAATTATCCAGG - Intergenic
1083323357 11:61861047-61861069 AAACTTAAAAAAAATTATCCAGG + Intronic
1083519120 11:63291001-63291023 CAATTAAAAAATAAGTAGCCAGG - Intronic
1083653143 11:64215731-64215753 CAATTTTTAAAGAATTAGCCAGG - Intronic
1083941437 11:65898339-65898361 AAATTTAAAAAAAATTAGCCAGG - Intronic
1084137926 11:67201031-67201053 AAATAGAAAAAAAATTAGCCGGG + Intronic
1084299419 11:68237019-68237041 CAATTAAGAAAGAATAGTCCGGG - Intergenic
1084325732 11:68398893-68398915 AAATTAAAAAAAAATTAGCCGGG - Intronic
1084353455 11:68620833-68620855 AAATACAAAAAGAATTAGCCAGG - Intergenic
1084865811 11:72056163-72056185 CAAATAAAAAAAAATTAGCCAGG + Intronic
1084975628 11:72796114-72796136 GAATTAAAAAAAAATTAGCCAGG - Intergenic
1085124888 11:73993381-73993403 CAATTAAAAAAAAATTAGCTGGG + Intergenic
1086093326 11:83025819-83025841 AAATTGAAAAGGAGTTTTCCAGG + Intronic
1086631920 11:89030221-89030243 TTATTGAAAAAGAATTTTACTGG - Intronic
1087032509 11:93719586-93719608 CATTTGAAAAATAATTCTCCTGG + Intronic
1087413420 11:97821939-97821961 AAATACAAAAAGAATTAGCCTGG - Intergenic
1087626116 11:100597990-100598012 CAATAGAAAAAAAATCATTCAGG + Intergenic
1087711042 11:101552738-101552760 CAATTGAAAAATAATAATGTAGG - Intronic
1087771078 11:102210911-102210933 AAATTCAAAAAGAATTAGCTGGG - Intronic
1088241211 11:107775450-107775472 AAAATAAAAAAAAATTATCCGGG + Intergenic
1088671020 11:112140695-112140717 CAATTAAAAAAAAATTAGCCAGG + Intronic
1089024325 11:115253018-115253040 CACTGGAAAAAGAATTGTCTTGG + Intronic
1089440069 11:118507800-118507822 AAATACAAAAAGAATTAGCCGGG + Intronic
1089727488 11:120495276-120495298 CAGGAGAAAAAGAATTTTCCAGG - Intergenic
1089768361 11:120784935-120784957 CAAGTCAAATTGAATTATCCCGG + Intronic
1090030834 11:123204818-123204840 AAATAAAAAAAAAATTATCCAGG - Intergenic
1090403595 11:126464368-126464390 AAATTAAAAAAAAATTAGCCAGG + Intronic
1090752970 11:129763636-129763658 CAACTGAACAAGAAGTCTCCTGG + Intergenic
1091746029 12:2993629-2993651 TAATTTAAAAAAAATTAGCCAGG - Intronic
1091858694 12:3759539-3759561 AAATTAAAAAAAAATTAGCCAGG + Intronic
1092174391 12:6393246-6393268 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1092375694 12:7953756-7953778 AAATACAAAAAAAATTATCCGGG + Intergenic
1092455993 12:8643347-8643369 AAATTAAAAAAAAATTAGCCCGG - Intronic
1092814127 12:12297984-12298006 CAATTAAAAAAAAATTAGCCAGG + Intergenic
1092880804 12:12886433-12886455 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1093143971 12:15542273-15542295 CACTGGAAGAAGAATTATCTTGG + Intronic
1093314576 12:17632535-17632557 AAATACAAAAAAAATTATCCAGG - Intergenic
1093425687 12:19026317-19026339 TAATTTAAAAAAAATTAGCCGGG - Intergenic
1093994414 12:25625919-25625941 CAATTTAAAACGAATGATTCAGG + Intronic
1094268492 12:28585533-28585555 CAATACAAAAAAAATTAGCCGGG + Intergenic
1094334892 12:29338481-29338503 TAAATGAAAAAGAATTAGCCAGG + Exonic
1094465677 12:30752077-30752099 AAATACAAAAAGAATTAGCCAGG - Intronic
1095131020 12:38542559-38542581 CAATTGAAATAAACTAATCCAGG + Intergenic
1095284832 12:40397280-40397302 AAATTGAAAAACAATTTTTCTGG + Intronic
1095495595 12:42780558-42780580 CAATAGAAAAAGCAGTGTCCAGG + Intergenic
1095514653 12:42992575-42992597 AAATATAAAAAGAATTAGCCAGG + Intergenic
1095683833 12:45009661-45009683 AAAATAAAAAAAAATTATCCAGG + Intergenic
1095700540 12:45186612-45186634 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1096137428 12:49214293-49214315 AAAAAGAAAAAGAATTAGCCAGG - Intronic
1096440233 12:51636153-51636175 AAATAGAAAAAAAATTAGCCAGG - Intronic
1096948637 12:55439974-55439996 CAGTTGATAAAGAATTCTCTTGG - Intergenic
1097410454 12:59246332-59246354 AAATAGAAAAACAATTAGCCAGG + Intergenic
1097936372 12:65256742-65256764 AAATACAAAAAGAATTAGCCGGG - Intergenic
1098005336 12:65990637-65990659 CATTAGAAGAAGAATTATCTTGG - Intergenic
1098907145 12:76173645-76173667 AAATACAAAAAAAATTATCCAGG + Intergenic
1099753791 12:86813605-86813627 CAATTAAAAATGAATTATTATGG - Intronic
1099824428 12:87756573-87756595 CAAAAAAAAAAAAATTATCCGGG + Intergenic
1099871901 12:88359969-88359991 AGATTGAAAAAAAATTAGCCAGG - Intergenic
1099977303 12:89559190-89559212 CAATTAAAAAAAAATTAGCTGGG - Intergenic
1100220717 12:92502098-92502120 AAAATGAAAAAAAATTAGCCAGG + Intergenic
1100419694 12:94420645-94420667 CACTGGAAGAAGAATTATCTTGG - Intronic
1100726189 12:97411271-97411293 AAATACAAAAAGAATTAGCCAGG + Intergenic
1100779583 12:98009545-98009567 CAATTCAAAAAACATTATTCTGG + Intergenic
1100974903 12:100112344-100112366 AATTTAAAAAAGAATTAGCCAGG + Intronic
1101373457 12:104151186-104151208 TAATTAAAAAAAAATTAACCAGG - Intergenic
1101828566 12:108239872-108239894 AAATTAAAAAAAAATTAGCCAGG - Intronic
1102033341 12:109757322-109757344 CTTTTGAAAAAGAAGTATCAGGG + Intronic
1102279942 12:111610972-111610994 TAAATGAAAAAGAATTAGCTGGG + Intergenic
1102280132 12:111612197-111612219 AAATTCAAAAAAAATTAGCCAGG + Intergenic
1102285960 12:111656892-111656914 AATTTTAAAAAAAATTATCCAGG - Intronic
1102875656 12:116446772-116446794 CATTTCAAAAATAATTAGCCGGG + Intergenic
1103313471 12:120031927-120031949 CAAATAAAAAAAAATTAGCCGGG + Intronic
1103630892 12:122259880-122259902 AAATTAAAAAAAAATTAGCCAGG + Intronic
1103696740 12:122821608-122821630 CACTTAAAAAAAAATTAGCCAGG - Intronic
1103826234 12:123741288-123741310 CAATAGAAAAAAAATTAGCCAGG + Intronic
1103837329 12:123833083-123833105 GAATAGAAAAAGAATGATTCAGG - Intronic
1103849910 12:123926069-123926091 AAAATAAAAAAGAATTAGCCAGG + Intronic
1104087214 12:125486632-125486654 CAATGGCAAAATAATTTTCCGGG - Intronic
1105381388 13:19890709-19890731 AAATTAAAAAAAAATTAGCCAGG + Intergenic
1105539272 13:21300905-21300927 AAATTGAAAAAAAATTGGCCGGG + Intergenic
1106284292 13:28305833-28305855 CAATGGAAGAATAATTATCTTGG - Intronic
1106944395 13:34810591-34810613 CAGTTTAAAGAGATTTATCCTGG - Intergenic
1107508256 13:41057315-41057337 AAATTAAAAAAAAATTAGCCAGG - Intronic
1107702083 13:43058650-43058672 CAATTGAGCATGAATTTTCCTGG - Intronic
1108193422 13:47966854-47966876 AATTTTAAAAAGAATTAGCCAGG + Intronic
1108580183 13:51821393-51821415 CAACTGAAGAAGAAATATCAGGG - Intergenic
1108675639 13:52735603-52735625 CAATGGAAGAAGAATTGTCTTGG + Intronic
1109069941 13:57751766-57751788 CAATTATAAAAAAATTATTCTGG + Intergenic
1109117370 13:58405577-58405599 AAAAAGAAAAAAAATTATCCAGG - Intergenic
1110133452 13:72036259-72036281 CAATTGGAATAGCATTGTCCAGG + Intergenic
1110248740 13:73357393-73357415 AAATTCAAAAAAAATTAGCCAGG + Intergenic
1110336373 13:74336064-74336086 CAATTTTAACAGAATTTTCCTGG + Intergenic
1110771709 13:79356206-79356228 TAATTGAAAAAATATTAGCCGGG + Intronic
1111019595 13:82430630-82430652 AAATTCAAAAAAAATTAGCCGGG + Intergenic
1111233714 13:85379949-85379971 TAATTGAAACAGCATTATACTGG + Intergenic
1111768657 13:92567962-92567984 AAATTGAAAAAGAAATATTCAGG + Intronic
1111817055 13:93167353-93167375 CAATTGAAAAAAAATCCTACTGG + Intergenic
1113182690 13:107649680-107649702 CATTTAAAAAATAATTTTCCAGG - Intronic
1113205266 13:107909203-107909225 AAATACAAAAAGAATTAGCCGGG - Intergenic
1113585763 13:111463276-111463298 AAATACAAAAAGAATTAGCCAGG + Intergenic
1113669666 13:112167044-112167066 AAATTTCAGAAGAATTATCCAGG + Intergenic
1113877548 13:113604002-113604024 CAAATAAAAAAAAATTAGCCAGG + Intronic
1114290057 14:21280544-21280566 CAATAGAAAATGAATAAACCAGG - Intergenic
1115192746 14:30763392-30763414 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1115438139 14:33400693-33400715 CCACTGAAAATGAATTGTCCAGG - Intronic
1115608671 14:35031246-35031268 AAAATAAAAAAGAATTAGCCAGG + Intergenic
1115627664 14:35210493-35210515 CCATAGAAAAAGACTTATACAGG + Intronic
1115717837 14:36125412-36125434 CATTTGAAGAAGAATTGTCTTGG - Intergenic
1116606256 14:46999806-46999828 CAATTGATGAAGAAATAGCCTGG + Intronic
1116895223 14:50309841-50309863 AAATTAAAAAATAATTAGCCAGG - Intronic
1117114516 14:52495997-52496019 AAAATGAAAAAAAATTAGCCGGG + Intronic
1117145863 14:52836315-52836337 GAATAGAAAAAAAATTATTCAGG - Intergenic
1117580367 14:57145421-57145443 CAAGTGTTAAAGAATTATCCTGG + Intergenic
1117695437 14:58357670-58357692 CAATGGAAGAAGAATTGTCTTGG - Intronic
1118305701 14:64653365-64653387 AAATTAAAAAAAAATTAGCCAGG + Intergenic
1118575358 14:67236928-67236950 AAATTCAAAAAAAATTAGCCGGG + Intergenic
1119012721 14:71012670-71012692 AAATAGAAAAAGAATTAGCCGGG + Intronic
1119016308 14:71059542-71059564 AAATTAAAAAAAAATTAGCCAGG - Intronic
1119039314 14:71258419-71258441 CAAACTAAAAAGAATTATCTGGG + Intergenic
1119311843 14:73653510-73653532 AAATTAAAAAAAAATTAGCCTGG - Intronic
1119453913 14:74737684-74737706 CATTTGAAAAAAAATTAGGCCGG + Exonic
1120378356 14:83740046-83740068 CATGGGAAAAAAAATTATCCGGG + Intergenic
1121071653 14:91028376-91028398 CAAATAATAAAAAATTATCCAGG - Intronic
1121153878 14:91665048-91665070 AAAATAAAAAAAAATTATCCAGG - Intronic
1121167049 14:91813181-91813203 CAATAGAAAAAGAACTCTCCAGG + Intronic
1121195307 14:92066766-92066788 CAAAAAAAAAAAAATTATCCAGG - Intronic
1121207812 14:92184021-92184043 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1121231159 14:92359436-92359458 TAATGAAAAAAGAATTAGCCGGG + Intronic
1121388031 14:93547831-93547853 AAATAAAAAAAAAATTATCCTGG + Intronic
1121848259 14:97194791-97194813 CAATTTAAAAAAAGGTATCCAGG - Intergenic
1121932967 14:97990162-97990184 AAATTAAAAAAAAATTAGCCGGG - Intergenic
1121991903 14:98566205-98566227 AAAATGAAAAAGCATTATCCTGG - Intergenic
1122490260 14:102110578-102110600 CAAAAAAAAAAAAATTATCCGGG - Intronic
1122671426 14:103375666-103375688 CAATTTAAAAAAAATTAGCCAGG + Intergenic
1123720716 15:23059446-23059468 AAAATGCAAAAAAATTATCCAGG + Intergenic
1123917634 15:25048615-25048637 CAATTGAAAAACAACGAGCCAGG - Intergenic
1123999977 15:25748900-25748922 CAAAAAAAAAAAAATTATCCGGG + Intronic
1124176342 15:27428040-27428062 AAATTAAAAAAAAATTAGCCAGG - Intronic
1124924613 15:34059221-34059243 CAGATGAAAAAGAAGTACCCAGG + Intronic
1125635482 15:41184813-41184835 CAATAGAAAAAAAATTAGCTGGG - Intronic
1125700494 15:41678604-41678626 AAATACAAAAAAAATTATCCGGG + Intronic
1125819793 15:42619402-42619424 AAATTAAAAAAAAATTAGCCGGG + Intronic
1125823323 15:42652833-42652855 AAATTAAAAAATAATTAGCCGGG - Intronic
1125913298 15:43461516-43461538 CAATTTAAAAATTATTATCTTGG - Intronic
1125927915 15:43578373-43578395 TAAAAGAAAAAAAATTATCCAGG + Intronic
1125941058 15:43677938-43677960 TAAAAGAAAAAAAATTATCCAGG + Intergenic
1126739355 15:51761986-51762008 AAATACAAAAAAAATTATCCGGG + Intronic
1127168170 15:56269813-56269835 AAATACAAAAAAAATTATCCAGG - Intronic
1127204964 15:56706315-56706337 AAATAGAAAAAAAATTAGCCAGG + Intronic
1127213470 15:56799681-56799703 AAAATGAAAAAAAATTAGCCAGG + Intronic
1127228530 15:56961969-56961991 AAATTAAAAAAAAATTAGCCGGG + Intronic
1127479190 15:59363134-59363156 CAATGCAAAAAAAATTAGCCAGG - Intronic
1127486449 15:59422225-59422247 CAAAATAAAAAGAATTAGCCAGG + Intronic
1128227122 15:66009751-66009773 AAATTCAAAAAAAATTAGCCAGG - Intronic
1128593214 15:68921127-68921149 CAATTGAATCAGAATTTTTCAGG - Intronic
1128999664 15:72321459-72321481 AAAAAGAAAAAAAATTATCCAGG - Intronic
1129305940 15:74662662-74662684 GAACTGAAAATGAACTATCCTGG + Intronic
1129307695 15:74679622-74679644 CAATTCAACAATAATGATCCAGG + Intronic
1129641824 15:77387641-77387663 AAAATGAAAAAGCATTACCCAGG + Intronic
1129981898 15:79880228-79880250 AAAAAGAAAAAGAATTAGCCAGG - Intronic
1129989769 15:79951597-79951619 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1130010340 15:80147957-80147979 AAAGTAAAAAAGAATTCTCCAGG + Intergenic
1130303368 15:82697171-82697193 AAATTTAAAAAAAATTAGCCGGG + Intronic
1130710664 15:86277908-86277930 CAGTTGAAATAAAATGATCCAGG - Intronic
1130962886 15:88675845-88675867 CAATTTAAAAAAAATTAGTCGGG - Intergenic
1130999931 15:88931816-88931838 AAATTTAAAAAAAATTAGCCAGG + Intergenic
1131040503 15:89261109-89261131 CAAAAGAAAAAAAATTAGCCGGG + Intronic
1131088601 15:89600184-89600206 CCAGTGCAAAAGGATTATCCAGG - Intronic
1131159564 15:90096137-90096159 AAATAGAAAAAAAATTAGCCTGG + Intronic
1131253841 15:90848402-90848424 AAATAAAAAAAGAATTAGCCAGG - Intergenic
1131283785 15:91041160-91041182 CAATTAAAAAAGAAAGCTCCCGG + Intergenic
1132179819 15:99743799-99743821 AAATTAAAAAAAATTTATCCAGG + Intergenic
1132527073 16:422408-422430 AAAAAGAAAAAAAATTATCCGGG - Intergenic
1133041281 16:3060974-3060996 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1133084674 16:3352900-3352922 AAAATAAAAAAAAATTATCCGGG - Intergenic
1133194241 16:4157554-4157576 AAACTAAAAAAAAATTATCCAGG - Intergenic
1133269892 16:4605718-4605740 AAATTTAAAAAAAATTAGCCAGG + Intergenic
1133325463 16:4939506-4939528 TAATTTAAAAAAAATTAGCCAGG - Intronic
1133442616 16:5833332-5833354 AAATATAAAAAGAATTAGCCGGG + Intergenic
1133558962 16:6932262-6932284 AAATTCAAAAAAAATTAGCCAGG - Intronic
1133683843 16:8147109-8147131 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1134002217 16:10791766-10791788 AAATTAAAAAAAAATTAGCCGGG - Intronic
1134012819 16:10867914-10867936 TAATTAAAAAAAAATTAGCCAGG - Intergenic
1134164292 16:11917452-11917474 CAATACAAAAAAAATTAGCCGGG - Intergenic
1134206310 16:12241135-12241157 CAGTAGAAAAATAATTAACCGGG + Intronic
1134450981 16:14363328-14363350 CTATAGAAATAGAATCATCCAGG - Intergenic
1134479218 16:14603079-14603101 AAATACAAAAAAAATTATCCAGG - Intronic
1135542492 16:23342598-23342620 CATTGGAAGAAGAATTATCTTGG + Intronic
1135629186 16:24022650-24022672 AAATACAAAAAGAATTAGCCGGG - Intronic
1135726816 16:24860864-24860886 AAATACAAAAAAAATTATCCGGG - Intronic
1135741312 16:24977513-24977535 GAAATGAAAATGAATGATCCGGG + Intronic
1135799549 16:25479714-25479736 AAAGTCAAAAAGAATTAGCCAGG + Intergenic
1135990989 16:27218687-27218709 AAATTAAAAAAAAATTAGCCGGG + Intronic
1136019446 16:27430652-27430674 CAAAAGAAAAAAAATTAGCCAGG + Intronic
1136075688 16:27815812-27815834 CAAAACAAAAAAAATTATCCAGG + Intronic
1136126929 16:28190378-28190400 AAATTCAAAAAAAATTAGCCAGG - Intronic
1136231695 16:28889415-28889437 CAAATGCAAAAAAATTAGCCAGG - Intronic
1136502490 16:30679575-30679597 AAATTAAAAAAAAATTAGCCGGG - Intergenic
1136683837 16:31982869-31982891 CTATTAAAAAAAAATTAGCCAGG - Intergenic
1136771374 16:32844728-32844750 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1136784465 16:32926422-32926444 CTATTAAAAAAAAATTAGCCAGG - Intergenic
1136885318 16:33927384-33927406 CTATTAAAAAAAAATTAGCCAGG + Intergenic
1136899205 16:34016718-34016740 CATTGGAAGAAGAATTCTCCTGG + Intergenic
1137243683 16:46683883-46683905 AAATAGAAAAAAAATTAGCCGGG - Intronic
1137729298 16:50678046-50678068 AAAATAAAAAAAAATTATCCAGG + Intronic
1138030657 16:53557068-53557090 CATTGGAAGAAGAATTGTCCTGG + Intergenic
1138052279 16:53791913-53791935 AAATACAAAAAAAATTATCCGGG + Intronic
1138258584 16:55595012-55595034 AAATTGAAAAAAAAATATCGGGG + Intergenic
1138295226 16:55879749-55879771 AAATTTAAAAAAAATTAGCCAGG - Intronic
1138559310 16:57791074-57791096 AAATGGAAAAAAAATTAGCCGGG + Intronic
1138728266 16:59164842-59164864 CATTTGGAAAAGAATTATATAGG - Intergenic
1138775725 16:59721720-59721742 CAATAGAAAAAGAAGTAATCTGG - Intronic
1139110750 16:63887621-63887643 CATTTGAAATGCAATTATCCTGG - Intergenic
1139679697 16:68551917-68551939 AAATTTAAAAAAAATTAACCGGG - Intronic
1139849982 16:69945434-69945456 CATTTGAAAAAGAATAAAACTGG - Intergenic
1139878968 16:70168346-70168368 CATTTGAAAAAGAATAAAACTGG - Intergenic
1139910935 16:70397199-70397221 AAAATGAAAAAAAATTAGCCAGG - Intronic
1140059042 16:71551684-71551706 AAAATAAAAAAGAATTATCAGGG + Intronic
1140094467 16:71863052-71863074 AAATACAAAAAAAATTATCCAGG - Intronic
1140166998 16:72563066-72563088 AAACTGAAAAATAATTAGCCAGG - Intergenic
1140373551 16:74427147-74427169 CATTTGAAAAAGAATAAAACTGG + Intergenic
1140766299 16:78161605-78161627 AAATTAAAAAAGAAATAGCCAGG - Intronic
1140788552 16:78367473-78367495 CACTGGACAAAGAATTATCTTGG - Intronic
1140835049 16:78786065-78786087 AAATTCAAAAACAATTAGCCAGG - Intronic
1140865216 16:79054662-79054684 AAAATGAAAAATAATTAGCCAGG + Intronic
1141561983 16:84875483-84875505 CACTGGAAAAAGAATTGTCTTGG - Intronic
1141796009 16:86274750-86274772 AAATTGAAAAAGAAATAACTTGG - Intergenic
1142017560 16:87758613-87758635 CAATGGAAGAAGAATTGTCTCGG + Intronic
1142152310 16:88518042-88518064 CTATTAAAAAAAAATTAGCCGGG + Intronic
1203073798 16_KI270728v1_random:1106838-1106860 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1203087124 16_KI270728v1_random:1190428-1190450 CTATTAAAAAAAAATTAGCCAGG - Intergenic
1142828517 17:2530105-2530127 AAATACAAAAAGAATTAGCCTGG - Intergenic
1142871244 17:2822462-2822484 AAATTAAAAAACAATTAGCCAGG + Intronic
1142986952 17:3701291-3701313 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1143012065 17:3871513-3871535 AAATAGAAAAAAAATTAGCCGGG - Intronic
1143259416 17:5586898-5586920 TAATACAAAAAAAATTATCCGGG + Intronic
1143500935 17:7338412-7338434 AAAAAGAAAAAAAATTATCCAGG - Intronic
1143559070 17:7681330-7681352 CAAAAAAAAAAGAATTAGCCAGG - Intronic
1143852023 17:9820185-9820207 AACTTGTAAAAGAAATATCCAGG - Intronic
1144429797 17:15180926-15180948 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1144697959 17:17318317-17318339 AAATACAAAAAGAATTAGCCAGG + Intronic
1144719811 17:17461422-17461444 AAATACAAAAAAAATTATCCAGG + Intergenic
1145234197 17:21197332-21197354 CATTGGAAAAAGAATTGTCTTGG - Exonic
1145285056 17:21499492-21499514 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1146097821 17:29949333-29949355 TAATATAAAAAGAACTATCCAGG - Intronic
1146206819 17:30912037-30912059 AAATACAAAAAAAATTATCCGGG - Intronic
1146245558 17:31279082-31279104 CATTTAAAAAAAAATTAGCCAGG + Intronic
1146459801 17:33037099-33037121 CAAATTAAAAAAAATTAGCCAGG + Intronic
1146771572 17:35573026-35573048 AAATTTAAAAAGAATTAGCCAGG + Intergenic
1147770116 17:42861748-42861770 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1147857992 17:43497592-43497614 CAAAAGAAAAAAAATTAGCCAGG + Intronic
1147860036 17:43514182-43514204 AAATTTAAAAAAAATTAGCCTGG + Intronic
1148815331 17:50323912-50323934 CATTGGAAGAAGAATTATCTTGG - Intergenic
1148954222 17:51340318-51340340 CAATAGAAAAACTATTGTCCAGG + Intergenic
1149474898 17:56952437-56952459 CAGTGGAAAAAAAATTATGCTGG + Intronic
1149533517 17:57414698-57414720 CATTTTAAAAAGAAAAATCCTGG - Intronic
1149648768 17:58262548-58262570 AAATACAAAAAGAATTATCCAGG - Intronic
1149718546 17:58819304-58819326 AAATACAAAAAGAATTAGCCTGG - Intronic
1150474130 17:65461369-65461391 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1150753208 17:67885423-67885445 AAAATATAAAAGAATTATCCAGG + Intronic
1150828873 17:68500672-68500694 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1150921927 17:69492977-69492999 CAATTAAAAAAAAATGATGCTGG - Intronic
1151754137 17:76061979-76062001 AAATTAAAAAAAAATTACCCGGG + Intronic
1152368917 17:79872994-79873016 CAGTTGCAAAAGAGTGATCCAGG - Intergenic
1152478841 17:80536829-80536851 TAATTAAAAAAAAATTAGCCGGG - Intergenic
1152504239 17:80737112-80737134 CAAAGGAAAAAAAATTATGCTGG - Intronic
1152664610 17:81560065-81560087 AAATTGTAGAAGAATGATCCTGG - Intronic
1152837349 17:82542320-82542342 CAATACAAAAAGAATTAGCTGGG - Intronic
1153117485 18:1677308-1677330 CACTTGAATATGAATTTTCCAGG + Intergenic
1153407279 18:4754931-4754953 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1153738855 18:8101514-8101536 CAATAGAAAATGAATAATCATGG + Intronic
1154017827 18:10635969-10635991 AAATAGAAAAAAAATTAGCCAGG - Intergenic
1154075153 18:11193072-11193094 CAATAAAAAAAAAATTAGCCGGG - Intergenic
1154187042 18:12193614-12193636 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1154273736 18:12941837-12941859 AAAATAAAAAAGAATTAGCCGGG + Intergenic
1155037866 18:22040455-22040477 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1155068588 18:22291913-22291935 CACTGGAAGAAGAATTATCTTGG - Intergenic
1155245643 18:23906063-23906085 GAATTTAAAAAGTATTATCTGGG - Intronic
1155337734 18:24782601-24782623 CAATGGGAAAAGAACTATACCGG + Intergenic
1155546067 18:26916894-26916916 CAATTGGAAAAGAATTCTGATGG - Exonic
1155858053 18:30859602-30859624 CACCTGAAAAAGAATCCTCCTGG + Intergenic
1155987374 18:32244515-32244537 CATTTGAAAATGAATGATCTAGG - Intronic
1156259117 18:35428307-35428329 TAATTTTAAAAAAATTATCCAGG + Intergenic
1156654029 18:39262012-39262034 AAATGCAAAAAAAATTATCCGGG + Intergenic
1157032885 18:43934181-43934203 CTATTGAAAAGGCATTGTCCTGG - Intergenic
1157241326 18:46012477-46012499 CAATTAAAAAAGAGTTGGCCAGG + Intronic
1157404966 18:47414952-47414974 CAATTGGAAAAGAATGATAGAGG - Intergenic
1157426602 18:47589749-47589771 CAATGGTAAAAGAATTTTACAGG + Intergenic
1157647401 18:49289548-49289570 TAATTAAAAAAGAAATAGCCGGG + Intronic
1157730032 18:49995413-49995435 AAATACAAAAAAAATTATCCAGG - Intronic
1157809838 18:50687180-50687202 AAATAGAAAAAAAATTAGCCAGG - Intronic
1157941493 18:51933675-51933697 CAATTGATATAGAATTACCTGGG + Intergenic
1158240321 18:55370243-55370265 AAATAGAAAAAAAATTAGCCAGG + Intronic
1158301630 18:56058959-56058981 AAAATAAAACAGAATTATCCTGG - Intergenic
1159852831 18:73546995-73547017 CAAATAAAAAAAAATTAGCCAGG + Intergenic
1160137535 18:76285356-76285378 AAATACAAAAAGAATTAGCCAGG - Intergenic
1160137896 18:76288715-76288737 AAATACAAAAAGAATTAGCCGGG + Intergenic
1160304882 18:77723051-77723073 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1160338484 18:78065150-78065172 AAATAGAAAAAAAATTAGCCGGG + Intergenic
1160869500 19:1270610-1270632 CAAATTTAAAAAAATTATCCAGG + Intronic
1161381780 19:3969297-3969319 AAAATGAAAAAAAATTAACCAGG - Intronic
1161494135 19:4578488-4578510 AAATTGAAAAAAAAAAATCCAGG + Intergenic
1161781267 19:6293695-6293717 AAATACAAAAAAAATTATCCAGG + Intergenic
1162070710 19:8150551-8150573 AAAATTAAAAAGAATTAGCCAGG + Intronic
1162221661 19:9182678-9182700 CAATACAAAAAAAATTAGCCAGG - Intergenic
1162266028 19:9575260-9575282 AAATTAAAAAAAAATTAGCCTGG + Intronic
1162310704 19:9905478-9905500 AAATACAAAAAAAATTATCCAGG + Intronic
1162379873 19:10325179-10325201 AAATAGAAAAAAAATTAGCCAGG - Intronic
1162542720 19:11307577-11307599 AAATTAAAAAAAAATTAGCCAGG - Intronic
1162577930 19:11510028-11510050 AAATACAAAAAGAATTATCCAGG - Intronic
1162611501 19:11758379-11758401 TAAATAAAAAAGAATAATCCTGG - Intergenic
1162616866 19:11808775-11808797 AAATTAAAAAAAAATTAGCCAGG - Intronic
1163309927 19:16507962-16507984 AAATACAAAAAAAATTATCCGGG - Intronic
1164183904 19:22844956-22844978 AAATAGAAAAAAAATTAGCCGGG + Intergenic
1164238275 19:23357662-23357684 AAATTAAAAAAGATTTATTCGGG + Intronic
1164269146 19:23655074-23655096 AAATAGAAAAAAAATTAGCCAGG + Intronic
1164606810 19:29605526-29605548 ACATTTAAAAAAAATTATCCAGG - Exonic
1164640654 19:29823026-29823048 TAATTGAAAAAGAAAAATCCTGG + Intronic
1164845659 19:31430537-31430559 AAACTAAAAAGGAATTATCCAGG - Intergenic
1165396448 19:35566783-35566805 CATTGGAAGAAGAATTGTCCTGG - Intergenic
1165469143 19:35993496-35993518 CAATAAAAGAAGAATTAGCCGGG + Intergenic
1165671581 19:37683987-37684009 AAATAGAAAAAAAATTAGCCAGG + Intronic
1165698842 19:37921759-37921781 AAATAAAAAAAAAATTATCCAGG - Intronic
1166019889 19:40017690-40017712 CACTGGAAGAAGAATTATCTTGG - Intergenic
1166066501 19:40362594-40362616 CAAATGAAAGAAAATTAGCCTGG - Intronic
1166085691 19:40473205-40473227 AAATACAAAAAGAATTAGCCGGG - Intronic
1166154862 19:40903328-40903350 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1166172425 19:41039148-41039170 TAATTTAAAAAAAATTAGCCAGG + Intergenic
1166272493 19:41723786-41723808 AAATACAAAAAAAATTATCCAGG + Intronic
1166311523 19:41965733-41965755 AAATTAAAAAAAAATTAGCCTGG - Intergenic
1166313702 19:41976963-41976985 AAATTAAAAAAAAATTAGCCAGG - Intronic
1166426663 19:42685109-42685131 AAATTAAAAAAAAATTAGCCAGG + Intronic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166825888 19:45608729-45608751 AAATACAAAAAAAATTATCCGGG - Intronic
1166826073 19:45610031-45610053 AAAAGGAAAAAGAATTAGCCAGG - Intronic
1167031636 19:46965783-46965805 GAGTTGAAAAAGATTAATCCAGG - Intronic
1167090264 19:47339282-47339304 CAAATGAAAAACAGTTATCAGGG - Intronic
1167313139 19:48748990-48749012 AAAATTAAAAAAAATTATCCGGG + Exonic
1167313190 19:48749313-48749335 TAATTAAAAAAAAAATATCCGGG + Exonic
1167559690 19:50218435-50218457 AAATACAAAAAGAATTAGCCGGG + Intronic
1167583151 19:50358275-50358297 AAATACAAAAAAAATTATCCGGG - Intronic
1167624241 19:50576745-50576767 CAAAAGAAAAAAAATTACCCAGG - Intergenic
1168398600 19:56069357-56069379 AACTTGAAAAAAAATTAGCCAGG + Intergenic
1168606438 19:57763787-57763809 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1168657905 19:58144833-58144855 AAAAAGAAAAAAAATTATCCAGG - Intronic
924987681 2:287266-287288 CAACTGAAAAGGAAGCATCCAGG - Intronic
924999230 2:391960-391982 TATGTGAAAGAGAATTATCCAGG - Intergenic
925339028 2:3121444-3121466 AAAATTAAAAAGAATTAGCCAGG + Intergenic
925543070 2:4987807-4987829 AAATACAAAAAGAATTAGCCAGG + Intergenic
925558857 2:5165813-5165835 CACTGGAAAAAGAATTGTCTTGG + Intergenic
925634308 2:5927784-5927806 CAATTATAAATGAAATATCCAGG + Intergenic
925949314 2:8896076-8896098 AAATGCAAAAAAAATTATCCAGG + Intronic
926630955 2:15135802-15135824 CACTGGAAAAAGAATTGTCTTGG + Intergenic
926766737 2:16328795-16328817 CATTGGAAGAAGAATTGTCCTGG + Intergenic
926769497 2:16356498-16356520 AATTTCAAAAAGAATTATACAGG - Intergenic
927032475 2:19136676-19136698 TAATTGAAAAAGCATTAACTAGG + Intergenic
927625861 2:24718055-24718077 AAATACAAAAAAAATTATCCAGG - Intronic
927867123 2:26596584-26596606 CAATACAAAAAAAATTAGCCGGG + Intronic
928073727 2:28243544-28243566 AAATTAAAAAAAAATTAGCCGGG + Intronic
928236911 2:29550704-29550726 CAAAGGAAAAATAATTTTCCTGG - Intronic
928513151 2:32020351-32020373 CAAATAAAAAAAAATTAGCCAGG + Intronic
928550343 2:32364398-32364420 AAATAGAAAAAAAATTAGCCAGG - Intronic
929219336 2:39447392-39447414 AAATTTAAAAAAAATTAACCAGG + Intergenic
929269056 2:39952769-39952791 GAACTGATAAAGAATTTTCCAGG + Intergenic
929525228 2:42694978-42695000 AAAATAAAAAAGAATTAGCCGGG + Intronic
929654033 2:43711730-43711752 AAATTCAAAAAAAATTATCCGGG + Intronic
930083361 2:47473152-47473174 TAATTAAAAAAAAATTAACCAGG - Intronic
930219159 2:48728147-48728169 CACTGGAAAAAGAATTGTCTTGG - Intronic
930224357 2:48777305-48777327 AAATACAAAAAAAATTATCCGGG - Intergenic
930532231 2:52603463-52603485 AAATTCAAAAAAAATTACCCAGG + Intergenic
931064721 2:58572421-58572443 TCATTAAGAAAGAATTATCCAGG - Intergenic
931213680 2:60221974-60221996 AAAGAGAAAAAGAATAATCCTGG + Intergenic
931310904 2:61079743-61079765 AAATTCAAAAAAAATTAGCCTGG + Intronic
931347641 2:61461230-61461252 AAAATGCAAAAGAATTAGCCAGG + Intronic
931508107 2:62954940-62954962 GAATTGAAAAAGTATTCTCCTGG - Intronic
932386150 2:71334758-71334780 AAATAGAAAAAAAATTAGCCGGG + Intronic
932720602 2:74136518-74136540 CAATGGAAGAAGAATTCTCTTGG - Intronic
932757678 2:74419930-74419952 AAATAGAAAAAAAATTAGCCAGG - Intronic
933919850 2:87034427-87034449 CAATTTAAAAAGAACTATTTTGG - Intergenic
933928243 2:87121163-87121185 CAATTTAAAAAGAACTATTTTGG - Intergenic
933931775 2:87159355-87159377 CAATTTAAAAAGAACTATTTTGG + Intergenic
934003144 2:87735468-87735490 CAATTTAAAAAGAACTATTTTGG + Intergenic
934489249 2:94748084-94748106 CAATGGAAGAAGAATTTTCTTGG - Intergenic
934587322 2:95513363-95513385 AAATACAAAAAAAATTATCCTGG + Intergenic
934753197 2:96807572-96807594 AAAAAGAAAAAAAATTATCCAGG + Intronic
935034185 2:99352635-99352657 AAATAGAAAAAAAATTAGCCAGG - Intronic
935156884 2:100491360-100491382 CAAAAAAAAAAAAATTATCCAGG + Intergenic
935486199 2:103657420-103657442 AAACTGAAAAAAAATTAGCCAGG - Intergenic
936361342 2:111806078-111806100 CAATTTAAAAAGAACTATTTTGG - Intronic
936395503 2:112125263-112125285 CATTTAAAGAAGAATTAGCCTGG + Intergenic
936442031 2:112562884-112562906 AAATACAAAAAAAATTATCCGGG - Intronic
936696568 2:114956712-114956734 TAATTGAAACAGAATAATACTGG + Intronic
936933611 2:117815600-117815622 TAATTGAAAAAAAATTCTGCAGG + Intronic
936961991 2:118085754-118085776 CAATAGTAAAAAAATTATCTTGG + Intergenic
937457932 2:122059052-122059074 CACTGGAAAAAGAATTGTCTTGG - Intergenic
937481704 2:122268281-122268303 CCATTTAAATAGAATTATACAGG + Intergenic
937518229 2:122680213-122680235 AAAATGAAAAAAAATTAGCCAGG + Intergenic
937743504 2:125383873-125383895 TAATTCAAAATGAATTATCTTGG + Intergenic
937940961 2:127285688-127285710 CAAATAAAAAAAAATTAGCCGGG + Intronic
937962202 2:127468902-127468924 AAATACAAAAAGAATTAGCCGGG - Intronic
938050601 2:128167053-128167075 AAATTCAACAAGGATTATCCAGG - Intronic
938311372 2:130290894-130290916 CTACTGAAAAAAAATTAGCCAGG - Intergenic
938394835 2:130937066-130937088 AAATAGAAAAAAAATTAGCCAGG - Intronic
938827040 2:135016094-135016116 CAAATTGAAAAAAATTATCCGGG + Intronic
939364273 2:141212437-141212459 CAAAAAAAAAAAAATTATCCGGG - Intronic
939452174 2:142388137-142388159 AATTTAAAAAAAAATTATCCAGG + Intergenic
939726426 2:145726768-145726790 CAATGGAAAAAGAGTAATTCAGG - Intergenic
939815301 2:146888740-146888762 CATATGAAAAAAAATTAGCCAGG - Intergenic
940044558 2:149395308-149395330 CTTTTGAAAAAGAATTATGAGGG - Intronic
940647204 2:156404221-156404243 AAATTAAAAAAAAATTACCCAGG + Intergenic
940707333 2:157122073-157122095 AAATTTCAAAATAATTATCCTGG + Intergenic
940920012 2:159295847-159295869 CATTTGTAAAAGAATCTTCCTGG + Intergenic
941265798 2:163360039-163360061 CAATTGAAAATGGATTACTCTGG + Intergenic
941406296 2:165092890-165092912 CTATTAAAAAAAAATTAGCCTGG + Intronic
941433624 2:165441171-165441193 CAAGGGAAAAAAAATTCTCCTGG - Intergenic
941926733 2:170903012-170903034 CAATTTTAAAAAAATTAGCCAGG - Intergenic
943207220 2:184916460-184916482 AAATATAAAGAGAATTATCCAGG + Intronic
943518756 2:188920540-188920562 AAATTAAAAAAAAATTATCCAGG + Intergenic
943556389 2:189410403-189410425 AAAATGAAAAAAAATTAGCCGGG + Intergenic
943561111 2:189463489-189463511 CATTGGAAAAAGAATTGTCTTGG + Intronic
944238080 2:197458590-197458612 TAATTTAAATTGAATTATCCTGG + Intronic
944349737 2:198712754-198712776 AAATTTACAAAGAATTATCCAGG + Intergenic
944515004 2:200504161-200504183 TAATTTAAAAAGAATTGGCCGGG + Intronic
944555556 2:200884577-200884599 AAATTTAAAAAAAATTAGCCTGG + Intronic
944845833 2:203666926-203666948 AAATTAAAAAAAAATTAGCCAGG + Intergenic
944976140 2:205053477-205053499 AAATACAAAAAAAATTATCCAGG + Intronic
945008911 2:205440990-205441012 CAATTGTAAAAGATTTATTCAGG + Intronic
945277069 2:207998661-207998683 GAATTAAAAAATAATTATCATGG + Intronic
945747055 2:213731315-213731337 AAATACAAAAAGAATTAGCCAGG - Intronic
946462470 2:219881331-219881353 AAATTAAAAAAAAATTAGCCAGG + Intergenic
946579854 2:221116634-221116656 CAATTGAAAAATAATTAATCTGG + Intergenic
946599789 2:221347005-221347027 TAATTGAAGAGGAATTATGCAGG - Intergenic
947022447 2:225695245-225695267 CAACTGAAAAATAATTTTTCTGG - Intergenic
947066420 2:226231040-226231062 CATTTTAAAAAGAATGATACTGG + Intergenic
947646600 2:231746466-231746488 CATTGGAAGAAGAATTATCTTGG - Intronic
947671976 2:231943149-231943171 AAATACAAAAAGAATTACCCAGG - Intergenic
948142292 2:235682501-235682523 AAATTAAAAAAAAATTAACCAGG - Intronic
948359230 2:237407068-237407090 AAATTCAAAAAAAATTAGCCAGG - Intronic
948538788 2:238669946-238669968 AATTTGAAAAAGACTTATTCAGG + Intergenic
948913196 2:241016354-241016376 AAATACAAAAAGAATTAGCCGGG - Intronic
948925933 2:241097725-241097747 CACTTGGAAAAGAATTTCCCAGG + Intronic
948959571 2:241322444-241322466 AAATTAAAAAAAAATTAGCCGGG + Intronic
1168870746 20:1126076-1126098 AAAATGAAAGAGAATTGTCCAGG - Intronic
1168941429 20:1714751-1714773 CAATGAAAAAAAAATTATCTAGG + Intergenic
1168973365 20:1946092-1946114 AAATTTAAAAAAAATTAACCAGG - Intergenic
1169165685 20:3421628-3421650 CAAATACAAAAGAATTAGCCAGG + Intergenic
1169270656 20:4196830-4196852 AAATAGAAAAATAATTAGCCAGG + Intergenic
1169627202 20:7584609-7584631 AAATTGAAAAATAATAATCATGG - Intergenic
1169794648 20:9448677-9448699 CATTGGAAAAAGAATTGTCTTGG - Intronic
1170301802 20:14892312-14892334 AAATTCAAAAAAAATTAGCCGGG + Intronic
1170580376 20:17694777-17694799 AAATTTTAAAAAAATTATCCAGG - Intronic
1170903082 20:20485117-20485139 CATTGGAAAAAGAATTATCTTGG - Intronic
1171181739 20:23096008-23096030 CACTGGAAGAAGAATTATCTTGG - Intergenic
1171462313 20:25305165-25305187 AACTTGAAAAAGAATTATCTGGG - Intronic
1171955121 20:31455931-31455953 CAATACAAAAAAAATTAGCCAGG - Intergenic
1171998529 20:31752771-31752793 AAATACAAAAAGAATTAGCCAGG - Intronic
1172336459 20:34120462-34120484 TAATTAAAAAAAAATTAGCCGGG + Intergenic
1172629841 20:36370657-36370679 AAATTAAAAAAAAATTAGCCAGG + Intronic
1172750486 20:37247417-37247439 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1173255622 20:41392610-41392632 CATTTAAAAAAAAATTAGCCAGG + Intergenic
1173425980 20:42943856-42943878 AAACTGAAAAACAATTAGCCTGG + Intronic
1173798853 20:45882006-45882028 AAATACAAAAAGAATTAGCCGGG - Intronic
1173989039 20:47286046-47286068 TAATTTAAAAAGAAATAGCCAGG + Intronic
1174206293 20:48842004-48842026 GCATTAAAAAAAAATTATCCAGG - Intergenic
1174603315 20:51742163-51742185 AAATTCAAAAATAATTAGCCAGG + Intronic
1174710309 20:52697490-52697512 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1174711031 20:52705671-52705693 AAATACAAAAAAAATTATCCAGG - Intergenic
1174830319 20:53806315-53806337 AAATTAAAAAAAAATTAGCCAGG + Intergenic
1175125338 20:56747293-56747315 AAATACAAAAAGAATTAGCCGGG - Intergenic
1175468660 20:59210218-59210240 CAATTAAAACAGAATTGCCCCGG + Intronic
1176421352 21:6518675-6518697 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1176702492 21:10072432-10072454 CAATTGAAAAAAAAATAGCCAGG - Intergenic
1176967306 21:15225763-15225785 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1177278551 21:18948573-18948595 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1177477224 21:21639472-21639494 CAAAAAAAAAAAAATTATCCGGG + Intergenic
1177602911 21:23338265-23338287 AAATGCAAAAAGAATTAGCCGGG + Intergenic
1177621476 21:23600879-23600901 AAATTAAAAAAAAATTAGCCGGG + Intergenic
1177748219 21:25247213-25247235 AAATTAAAAAATAATTAGCCAGG + Intergenic
1177777956 21:25590317-25590339 CACTGGAAGAAGAATTGTCCTGG + Intronic
1177821463 21:26035126-26035148 AAATTAAAAAAAAATTAGCCAGG + Intronic
1178004758 21:28205708-28205730 AAATTAAAAAAAAATTAGCCAGG + Intergenic
1178184889 21:30208171-30208193 CATTTGAAAAGGAATCAGCCAGG + Intergenic
1179225291 21:39447574-39447596 AAATACAAAAAGAATTAGCCGGG - Intronic
1179378485 21:40875734-40875756 AAAAAGAAAAAAAATTATCCAGG + Intergenic
1179399445 21:41070326-41070348 AAATTAAAAAAAAATTAGCCAGG + Intergenic
1179517050 21:41915595-41915617 AAATACAAAAAGAATTAGCCGGG - Intronic
1179696842 21:43126990-43127012 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1181256165 22:21564189-21564211 AAATAAAAAAAGAATTAGCCAGG - Intronic
1181342909 22:22197152-22197174 CAATGGAAGAAGAATTGTCTCGG - Intergenic
1181389271 22:22567860-22567882 AAAAAGAAAAAGAATGATCCTGG - Intergenic
1181396129 22:22623775-22623797 CAAATACAAAAAAATTATCCAGG - Intergenic
1181602333 22:23960022-23960044 AAATGGAAAAAAAATTAACCGGG - Intronic
1181664822 22:24386762-24386784 CAATACAAAAAAAATTAGCCGGG - Intronic
1181739090 22:24905626-24905648 AAATTAAAAAAAAATTAGCCAGG + Intronic
1182250890 22:28999345-28999367 CTATTGAAAAAAAATTAGCTGGG + Intronic
1182607021 22:31513736-31513758 AAATTCAAAAAAAATTAGCCAGG - Intronic
1182645620 22:31806849-31806871 AAACTAAAAAAGAATTAGCCAGG + Intronic
1182807818 22:33090401-33090423 TAATTTAAACAGAATTCTCCAGG + Intergenic
1182944008 22:34305322-34305344 AAATACAAAAAAAATTATCCGGG - Intergenic
1183319848 22:37158394-37158416 AAATTAAAAAAAAATTAGCCGGG + Intronic
1183854619 22:40622482-40622504 AAAAAAAAAAAGAATTATCCAGG + Intronic
1183995333 22:41628803-41628825 CAATGCAAAAATAATTAGCCAGG + Intronic
1184268157 22:43361318-43361340 AAAAAGAAAAAGAATTATCTTGG - Intergenic
949352745 3:3141355-3141377 CAAAGGAAAAAGAATGATCCTGG - Intronic
949625072 3:5856614-5856636 CAGTTGAAAATGAATTCTCCCGG + Intergenic
949988876 3:9560764-9560786 AAATTCAAAAAAAATTACCCAGG + Intergenic
950341986 3:12255341-12255363 CATTGGAAAAAGAATTGTCTTGG + Intergenic
950567491 3:13779201-13779223 CATTGGAAAAAGAATTGTCTTGG + Intergenic
951109677 3:18787036-18787058 CAATCAAAAAACAATTAGCCAGG + Intergenic
951151643 3:19297640-19297662 AAATTGAAAATCAATTTTCCAGG - Intronic
951242356 3:20301869-20301891 CAATTGAAATAGAAAGAGCCAGG + Intergenic
951416053 3:22422842-22422864 CAATTAAAAAAAAATAATGCAGG + Intergenic
951772621 3:26275636-26275658 TAATTCAAAAGGAATTCTCCAGG + Intergenic
952318730 3:32256225-32256247 AAAATAAAAAAAAATTATCCAGG - Intronic
952528056 3:34233636-34233658 AAATAGAAAAAAAATTAGCCAGG - Intergenic
953324779 3:42003707-42003729 AAATACAAAAAAAATTATCCAGG + Intergenic
953728928 3:45428402-45428424 AAATATAAAAAAAATTATCCGGG - Intronic
953923817 3:46970340-46970362 CAATGGAAGAAGAATTGTCTTGG - Intronic
953973606 3:47366103-47366125 TAATTAAAAAAAAATTAGCCAGG - Intergenic
954003380 3:47575123-47575145 CACTTGAAAAAGAGATACCCTGG + Intronic
954046192 3:47933061-47933083 AAATTAAAAAAAAATTAGCCAGG - Intronic
954048979 3:47957326-47957348 AAATTCAAAAAAAATTAGCCGGG - Intronic
954185266 3:48912195-48912217 CTATTAAAAAAAAATTCTCCAGG + Intergenic
954897948 3:53993186-53993208 AAATACAAAAAGAATTAGCCAGG - Intergenic
955194354 3:56791250-56791272 CAATTGAAAGAAAATTAGCCAGG + Intronic
955327120 3:58017409-58017431 AAAATGCAAAAAAATTATCCAGG - Intronic
955737607 3:62056466-62056488 CAATGGAAGAAGAATTGTCTTGG - Intronic
956133505 3:66076286-66076308 CAAATAAAAAAAAATTAGCCAGG + Intergenic
956288539 3:67636653-67636675 AAATAGAAAAAAAATTAGCCAGG - Intronic
956565185 3:70628836-70628858 AAATTTAAAAATAATAATCCAGG + Intergenic
957024383 3:75164869-75164891 CAATTCAAAAAGCATTTGCCAGG - Intergenic
957484369 3:80839056-80839078 CAAAAGCAAAATAATTATCCTGG + Intergenic
957535918 3:81503425-81503447 CAATAAAAAAAAAATTAACCCGG + Intronic
957708495 3:83821966-83821988 AAATACAAAAAGAATTAGCCAGG + Intergenic
957911067 3:86620653-86620675 CACTTTAAAAAAAAGTATCCAGG + Intergenic
958550766 3:95609030-95609052 CCTTTGAAAAATAATTATCAAGG - Intergenic
958737018 3:98021020-98021042 AAATAAAAAAAAAATTATCCAGG - Intronic
958810021 3:98850251-98850273 CAGTGGAAAAAGAATTGTCTTGG + Intronic
959241831 3:103806998-103807020 TTATTGAAAAAAAATTAGCCCGG + Intergenic
959404208 3:105940632-105940654 AAATTACAAAAGAATTAGCCGGG - Intergenic
959597363 3:108143044-108143066 AAATTTAAAAAAAATTAGCCAGG - Intergenic
960234581 3:115267027-115267049 AAATTTAAAAAAATTTATCCTGG + Intergenic
960390484 3:117072025-117072047 CAATACAAAAAAAATTAGCCAGG - Intronic
960516484 3:118607962-118607984 CAACTGAAAGAGAAGTCTCCTGG + Intergenic
960633470 3:119757484-119757506 AAATTAAAAAAAAATTAGCCAGG + Intronic
961540488 3:127596075-127596097 CAAAAAAAAAAAAATTATCCTGG - Intronic
961854093 3:129851990-129852012 AAATTCAAAAAAAATTAGCCGGG + Intronic
961901386 3:130215573-130215595 CAATTGAAAAAATATTAGCAAGG + Intergenic
962246975 3:133803822-133803844 TAATTAAAAAATAATTAGCCAGG - Intronic
962439137 3:135395827-135395849 AAAAAAAAAAAGAATTATCCAGG - Intergenic
962802340 3:138901150-138901172 CAAAAAAAAAAGAATTTTCCAGG - Intergenic
963186848 3:142428233-142428255 AAATACAAAAAGAATTAGCCGGG + Intronic
963223552 3:142837329-142837351 CAATGGGAAAAGAATTATCTAGG + Intronic
963801536 3:149680679-149680701 AAATGAAAAAAGAATTAACCAGG + Intronic
964106455 3:153045490-153045512 CATTTGAAAAAGACAAATCCAGG + Intergenic
964482670 3:157158415-157158437 CAATTGATAAAGAATTAACTGGG + Intronic
964617421 3:158682872-158682894 AAATAGAAAAAAAATTAGCCCGG + Intronic
964710675 3:159668214-159668236 CAAAAGAAAAAAAATTAGCCGGG + Intronic
965001367 3:162958337-162958359 AAATAGAAAAAAAATTAGCCAGG + Intergenic
965082329 3:164050380-164050402 AAATTCAAAAAAAATTAGCCAGG + Intergenic
965328874 3:167344414-167344436 CAAATGAAAAACACTTGTCCAGG - Intronic
965477548 3:169176045-169176067 CACTGGAAGAAGAATTATCTTGG + Intronic
965528321 3:169745402-169745424 AAATACAAAAAAAATTATCCGGG - Intergenic
965597609 3:170423672-170423694 CAATTGAATCAGAATTTTCTGGG + Intronic
965628748 3:170708715-170708737 AAATAGAAAAATAATTTTCCAGG + Intronic
966035398 3:175407021-175407043 AAATAGAAAAAAAATTAGCCAGG + Intronic
966633066 3:182100064-182100086 CAAAGGAAAAAGAATAAACCAGG - Intergenic
966812347 3:183858328-183858350 GAAATGAAAAAGAATAAGCCTGG + Intronic
966984102 3:185164174-185164196 AAATTACAAAAGAATTAGCCAGG - Intergenic
967073509 3:185982289-185982311 AAATACAAAAAGAATTAGCCGGG - Intergenic
967239396 3:187422333-187422355 AAATACAAAAAAAATTATCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967436953 3:189458253-189458275 GAATTTGATAAGAATTATCCTGG + Intergenic
967912476 3:194553722-194553744 AAAAAAAAAAAGAATTATCCTGG + Intergenic
968185238 3:196628746-196628768 AAAATGCAAAAGAATTAGCCAGG - Intergenic
968621689 4:1606197-1606219 CAAAAAAAAAAAAATTATCCAGG - Intergenic
968753799 4:2404159-2404181 AAATACAAAAAAAATTATCCAGG + Intronic
968780422 4:2576256-2576278 AAATTACAAAAGAATTAGCCAGG - Intronic
969023843 4:4158215-4158237 AAATTAAAAAAAAATTAGCCGGG + Intergenic
969033113 4:4228934-4228956 CAATTTAAAAAAAATGAGCCAGG - Intergenic
970144897 4:13025527-13025549 CAAGTTAAAAAAAATTACCCTGG + Intergenic
970317918 4:14847031-14847053 AAAGTGAAAAACAATTAGCCAGG - Intergenic
970509595 4:16768068-16768090 GAATTGAAAAATAATTACTCTGG - Intronic
970611365 4:17728116-17728138 AAATTAAAAAAAAATTATCCAGG + Intronic
970868664 4:20787794-20787816 CAATTAAAAATAAATTATGCTGG - Intronic
971204708 4:24553614-24553636 AAATTAAAAAAAAATTAGCCAGG + Intronic
971565744 4:28138602-28138624 CATTTGAAGAAGAATTTTGCTGG + Intergenic
972030911 4:34457066-34457088 AAATTAAAAAAAAATTAGCCGGG - Intergenic
972106870 4:35498944-35498966 CAATTAACAAAGAAGTATCTGGG + Intergenic
972334837 4:38098424-38098446 CCAGTGAAAAACAAATATCCAGG - Intronic
972402692 4:38719964-38719986 CATTGGAAGAAGAATTATCTTGG - Intergenic
972539293 4:40025049-40025071 AAATTCAAAAAAAATTAGCCAGG + Intergenic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
972852243 4:43064819-43064841 CAAAAGAAAAAAAATTAGCCTGG + Intergenic
972867861 4:43256620-43256642 CACGTGAAGAAGAGTTATCCAGG + Intergenic
972880619 4:43417710-43417732 CAATGGAAAAAAATGTATCCAGG - Intergenic
972925913 4:44006971-44006993 AAATAAAAAAAGAATTAGCCAGG + Intergenic
973145751 4:46823520-46823542 CAATTGAAAAGGAACTCTCAAGG + Intronic
973681535 4:53325395-53325417 CAAATCACAAAGAATTAGCCAGG + Intronic
973943313 4:55932372-55932394 AAAATAAAAAAGAATTAGCCAGG - Intergenic
974200339 4:58629906-58629928 CAATTGGAAAACAACTCTCCAGG + Intergenic
974317038 4:60295687-60295709 AATTTGAAAAAAAATTAGCCAGG - Intergenic
975155470 4:71067696-71067718 CAATTTAAGAAGAACTATCCTGG - Intergenic
975347699 4:73312457-73312479 AAATTCAAAAAAAATTAACCGGG + Intergenic
975470033 4:74755532-74755554 CAAATGGAAATGAATTATTCTGG - Intronic
975495717 4:75034194-75034216 CAATGGAACAAGAATTAACGTGG + Intronic
975658967 4:76669461-76669483 AAATTCAAAAAGAATTAGCTGGG + Intronic
975997154 4:80329137-80329159 CATTGGAAGAAGAATTATCTTGG - Intronic
976130748 4:81881608-81881630 AAATACAAAAAAAATTATCCGGG + Intronic
976294928 4:83460743-83460765 CAAATACAAAAAAATTATCCGGG + Exonic
976409868 4:84700951-84700973 AATTTGAAAAAGAATTAGCCAGG + Intronic
976604956 4:86974067-86974089 CAAAAGAAAAAGAATTACCAGGG - Intronic
976634196 4:87271227-87271249 AAATTGAAATAGAATTATACTGG - Intergenic
976818871 4:89181816-89181838 AAATAGAAAAAAAATTAGCCGGG + Intergenic
977421019 4:96799624-96799646 CACTAGAAGAAGAATTATCTTGG - Intergenic
977523335 4:98113258-98113280 CAATGGAAAGAGACTTATTCGGG + Intronic
977597872 4:98903500-98903522 AAAATAAAAAAGAATTAGCCAGG - Intronic
977613779 4:99064626-99064648 CAGTGGAAGAAGAATTATCTTGG - Intergenic
978103668 4:104874992-104875014 AAATTCAAAAAAAATTAGCCAGG + Intergenic
978119022 4:105056011-105056033 CAATTTAAAAAGTCTTATCTGGG - Intergenic
978595021 4:110368075-110368097 AAATCCAAAAAGAATTAGCCGGG - Intronic
978942349 4:114451712-114451734 TAATGGAAAAAGAAAAATCCAGG + Intergenic
979386900 4:120077371-120077393 CAATTTAAGAAGAATTATATAGG + Intergenic
979682360 4:123475802-123475824 CATTGGAAGAAGAATTATCCTGG + Intergenic
979730322 4:124016052-124016074 AAATAGAAAAAGGTTTATCCTGG + Intergenic
980040163 4:127929944-127929966 CAATTAAAAAACACTTATGCTGG + Intronic
980222353 4:129935610-129935632 AAATTAAAAAAAAATTATCTGGG - Intergenic
980256848 4:130392651-130392673 CAGTTGAAGAAGAATTGTCTTGG + Intergenic
980374666 4:131928850-131928872 CAACTGAAAAAAAAATAGCCAGG - Intergenic
980645433 4:135636670-135636692 AAATAGAAAAAGAAATATCCAGG - Intergenic
980815877 4:137945907-137945929 GAATTGAAAAAGAATTATGGAGG + Intergenic
981116004 4:140992398-140992420 AAATTAAAAAAGAGTTAACCAGG + Intronic
981480427 4:145233119-145233141 AAAATAAAAAAAAATTATCCAGG + Intergenic
981557662 4:146012847-146012869 CATTTAAAAAAAAGTTATCCTGG - Intergenic
981959492 4:150519026-150519048 CAAAGGAAAAAAAATTATCTAGG - Intronic
982941281 4:161560108-161560130 CAATGGAAGAAGAATTGTCTTGG - Intronic
983221728 4:165050307-165050329 AAAATGAAAAAAAATTAGCCTGG + Intergenic
983404107 4:167303517-167303539 AAATACAAAAAAAATTATCCAGG - Intergenic
983564990 4:169141046-169141068 CATTGGAAGAAGAATTGTCCTGG - Intronic
983724586 4:170904701-170904723 AAAGTAAAAAACAATTATCCTGG + Intergenic
983891203 4:173032288-173032310 AAATACAAAAAGAATTAGCCGGG + Intronic
983924838 4:173389373-173389395 AAATACAAAAAGAATTAGCCGGG + Intronic
984154546 4:176178607-176178629 CTGTTGAAACAGAAATATCCTGG - Intronic
984156489 4:176201341-176201363 AAATTGAAAAAAAGTTAACCAGG + Intergenic
984311447 4:178065548-178065570 AAATTAAAAAAAAATTAGCCAGG - Intergenic
984488206 4:180399454-180399476 CATTTTAAGAAGAATGATCCTGG + Intergenic
984774733 4:183471572-183471594 CAATTGAAAAGGAAATCTGCAGG + Intergenic
985117603 4:186606908-186606930 CCAATGAAAAAGAATTCTGCTGG + Intronic
985237463 4:187891829-187891851 AAATACAAAAAAAATTATCCGGG + Intergenic
986096785 5:4564018-4564040 AAACTGAAAAAAAATTATCAGGG + Intergenic
986324120 5:6658954-6658976 AAATTGAAAGAAAATTAGCCAGG + Intronic
986725184 5:10590667-10590689 CAATGGAAGAAGAATTGTCTTGG - Intronic
986910437 5:12549115-12549137 CATTTGAAAAAGAATTGTCTTGG - Intergenic
986926813 5:12764623-12764645 CAATTCAAAAACCATTTTCCTGG + Intergenic
986965441 5:13264848-13264870 AAATTAAAAAAAAATTAACCAGG + Intergenic
987148864 5:15018637-15018659 AAATACAAAAAAAATTATCCGGG - Intergenic
987254293 5:16133737-16133759 CAATGGAAGAAGAATTGTCTTGG + Intronic
987586933 5:19867246-19867268 CAATTAAAAAAGCATTATGTGGG + Intronic
987940348 5:24527006-24527028 AAAATGAATAAGAATTTTCCAGG - Intronic
988892122 5:35629311-35629333 AAATAGAAAAAAAATTAGCCAGG - Intronic
989009539 5:36854822-36854844 CATTAGAAAAAGAATTGTCTCGG + Intergenic
989040003 5:37217817-37217839 AAATAGAAAAAAAATTAGCCAGG + Intronic
989071106 5:37512740-37512762 AAAAAGAAAAAAAATTATCCAGG - Intronic
989149318 5:38283010-38283032 AAATTCAAAAACAATTAGCCTGG - Intronic
989555070 5:42784796-42784818 CATATGAAAAAGAATTAAACTGG - Intronic
990088941 5:52016123-52016145 AAATTAAAAAATAATTATGCTGG - Intronic
990261415 5:54027175-54027197 GAAAAGAAAATGAATTATCCAGG + Intronic
990290224 5:54342483-54342505 AAATAGAAAAACAATTATCCAGG - Intergenic
990477761 5:56177612-56177634 AAATTCAAAAAAAATTAGCCGGG + Intronic
990733109 5:58831034-58831056 AAAATAAAAAAGAATTAGCCAGG - Intronic
990796769 5:59551918-59551940 CTATTTAAAAAGAATTGGCCGGG + Intronic
990819573 5:59822767-59822789 CAATTGACAATGAGTTATCAGGG - Intronic
991412827 5:66361910-66361932 CATTGGAAGAAGAATTATCTTGG - Intergenic
992490382 5:77237109-77237131 CAAATGGAAAAGAATAAACCAGG - Intronic
992571045 5:78057964-78057986 CAAACAAAAAAGAATTAGCCAGG + Intronic
992814715 5:80424940-80424962 CAAATGAACAATAATTATGCTGG - Intronic
993065641 5:83094574-83094596 CAATTAAAAAATGAATATCCAGG - Intronic
993119989 5:83763353-83763375 CAATTCAATCAGAATTATCATGG - Intergenic
993327049 5:86553446-86553468 AAATTAAAAAAGAATTAGCCAGG + Intergenic
993996673 5:94731256-94731278 CAATGGAAGAAGAATTGTCTTGG - Intronic
994051562 5:95367906-95367928 TAAATGCAAAAGAATTATCTCGG + Intergenic
994111160 5:96006300-96006322 CAATGGAAGAAGAATTGTCTTGG + Intergenic
994488335 5:100408389-100408411 CAAACAAAAAACAATTATCCAGG - Intergenic
994727737 5:103456224-103456246 CAATAGCAAAAGAAAAATCCAGG + Intergenic
994971734 5:106748045-106748067 AAATTAAAAAAAAATTAGCCAGG - Intergenic
995437111 5:112149076-112149098 CAATAGAAAAAGAATTGTTCTGG + Intronic
995438581 5:112164672-112164694 AAATACAAAAAGAATTAGCCGGG + Exonic
995600659 5:113791772-113791794 CAATTGAAAAAGACTGATCTGGG + Intergenic
995769744 5:115655097-115655119 CAAAAGAAAAAAAATTAGCCAGG + Intergenic
995979620 5:118085843-118085865 TAAATGAAAAAAAATTATCAGGG - Intergenic
996076976 5:119207677-119207699 AAATACAAAAAGAATTAGCCAGG - Intronic
996089715 5:119338884-119338906 AAAGTAAAAAAGAATTAGCCTGG + Intronic
996377252 5:122824301-122824323 CAATGGAAGAAGAATTGTCTTGG - Intronic
996726711 5:126679073-126679095 CAATAGAGAAAGAAAAATCCTGG + Intergenic
996917103 5:128724944-128724966 GAATTAAAAAAATATTATCCTGG + Intronic
997214361 5:132098018-132098040 CAATGGAAGAAGAATTGTCTTGG + Intergenic
997326915 5:133029160-133029182 CAAAAAAAAAAGAATTACCCAGG + Intergenic
997940071 5:138149270-138149292 AAATTAAAAAAAAATTAGCCAGG - Intronic
998089886 5:139359295-139359317 AAAATGAAAAAAAATTAGCCGGG - Intronic
999359557 5:150971691-150971713 AAATAAAAAAAAAATTATCCAGG + Intergenic
999460567 5:151754450-151754472 AAATAGAAAAAAAATTAGCCAGG + Intronic
999706840 5:154281062-154281084 CTTTTGAAAAAGAATTATTTTGG + Intronic
999798576 5:155011134-155011156 CAATTGAACAAAAATTAGCCAGG + Intergenic
999864013 5:155680581-155680603 CAATTGCAGTAGATTTATCCAGG + Intergenic
999891582 5:155983671-155983693 CCATAGAAACAGAATTTTCCTGG + Intronic
1000000176 5:157130868-157130890 TAATTGTTAGAGAATTATCCTGG + Intronic
1000029082 5:157386376-157386398 AAATAAAAAAAAAATTATCCAGG - Intronic
1000069870 5:157730435-157730457 AAAAAGAAAAAAAATTATCCAGG - Intergenic
1001460866 5:171912747-171912769 AAATACAAAAAGAATTAGCCAGG + Intronic
1001613633 5:173024035-173024057 CAATACAAAAAAAATTAGCCAGG + Intronic
1001749974 5:174121573-174121595 AAATACAAAAAAAATTATCCGGG + Intronic
1002112621 5:176929092-176929114 TAATAGAAAAAAAATTAGCCAGG + Intronic
1002157316 5:177293413-177293435 CAACTCAAAGAGAAATATCCTGG - Intronic
1002469718 5:179428137-179428159 AAATACAAAAAAAATTATCCGGG + Intergenic
1002477901 5:179479559-179479581 AAATTAAAAAATAATTAGCCGGG + Intergenic
1002479351 5:179489519-179489541 CAATACAAAAAAAATTAGCCGGG + Intergenic
1002498471 5:179632145-179632167 AAATACAAAAAAAATTATCCGGG + Intronic
1003202634 6:3976270-3976292 AAATACAAAAAAAATTATCCAGG - Intergenic
1003693243 6:8375775-8375797 AAATTTAAAATAAATTATCCAGG - Intergenic
1003841066 6:10119780-10119802 AAATACAAAAAAAATTATCCAGG + Intronic
1004390283 6:15204070-15204092 GAATTCAAAAAAAATTAGCCGGG - Intergenic
1004400472 6:15283864-15283886 AAATTCAAAAAAAATTAGCCGGG - Intronic
1004724413 6:18297271-18297293 AAATACAAAAAAAATTATCCAGG + Intergenic
1004784000 6:18945336-18945358 AAAATAAAAAAGAATTAGCCAGG + Intergenic
1004942015 6:20568572-20568594 CAATACAAAAAAAATTAGCCGGG + Intronic
1005261641 6:24067610-24067632 GAATAGAGATAGAATTATCCAGG + Intergenic
1005276010 6:24218892-24218914 CATTTGAAAAGGAATAATTCTGG + Intronic
1005664407 6:28036686-28036708 AGAATGAAAAAGAATTTTCCTGG + Intergenic
1005739346 6:28775843-28775865 CACCTGAAAAAAAATTTTCCAGG - Intergenic
1005941650 6:30564845-30564867 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1006139262 6:31918122-31918144 CAATTAAAAAAAACTTAGCCTGG + Intronic
1006493677 6:34405800-34405822 AAATACAAAAAAAATTATCCGGG + Intronic
1006895259 6:37464304-37464326 AAATTCAAAAAAAATTAGCCAGG + Intronic
1007018302 6:38492058-38492080 CAACTGAAAAAAGATTAACCGGG + Intronic
1007144207 6:39611145-39611167 AAAATGCAAAAGAATTAGCCAGG + Intronic
1007885157 6:45219652-45219674 CAATTCCAAAACAATTATCTAGG + Intronic
1008065037 6:47038416-47038438 GAATTGATAAAGAATTATCAAGG - Intronic
1008182345 6:48347032-48347054 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1008204406 6:48636554-48636576 AAATTGGAAAATAAATATCCTGG - Intergenic
1008364816 6:50665454-50665476 AAAATAAAAAAAAATTATCCAGG + Intergenic
1008394421 6:50990461-50990483 CATTGGAAGAAGAATTATCTTGG - Intergenic
1008402547 6:51080224-51080246 CAATTGAAATAGAAATCTTCCGG - Intergenic
1009426966 6:63525187-63525209 CAATTGTAAATAAGTTATCCTGG + Intronic
1009609173 6:65916787-65916809 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1009710580 6:67313017-67313039 TAATTGAGAAAAAATTTTCCTGG - Intergenic
1009915452 6:69989612-69989634 CATTGGAAGAAGAATTATCTTGG - Intronic
1009988203 6:70807029-70807051 TAATTTATAATGAATTATCCAGG + Intronic
1010410877 6:75560062-75560084 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1010587847 6:77676364-77676386 CAAATAAAAAAAAATTAACCAGG + Intergenic
1011073650 6:83413948-83413970 AAATTGAAAATAAATTAGCCAGG + Intronic
1011222583 6:85071024-85071046 AAATACAAAAAAAATTATCCAGG - Intergenic
1011554592 6:88561492-88561514 AAATTTAAAAAAAAGTATCCTGG + Intergenic
1012019749 6:93903934-93903956 AAATTGAAAAAGAATGATGGAGG - Intergenic
1012859220 6:104539677-104539699 CAATTAAATGAGAATTATTCAGG + Intergenic
1012890936 6:104896456-104896478 GAAAAGAGAAAGAATTATCCAGG - Intergenic
1013037102 6:106396177-106396199 CAAAGGAAAAAAAATTACCCTGG - Intergenic
1013325632 6:109044152-109044174 AAATAAAAAAAAAATTATCCAGG + Intronic
1013490349 6:110640794-110640816 TAAATTAAAAAAAATTATCCAGG + Intronic
1013516408 6:110890644-110890666 AAATTAAAAAAAAATTAGCCAGG - Intronic
1013779380 6:113713211-113713233 AAAATGCAAAAGAATTAGCCAGG - Intergenic
1014487236 6:122014397-122014419 TAATTGAAAATGTATTCTCCAGG - Intergenic
1014862748 6:126489772-126489794 CAATTGAAACAGCATGATACTGG - Intergenic
1015132962 6:129835236-129835258 AAATTGAAAAAAACTTAGCCTGG + Intronic
1015226250 6:130860691-130860713 AAATAGAAAAAAAATTAGCCGGG - Intronic
1015978954 6:138819724-138819746 TAATTAAAAAAAAATTAGCCGGG + Intronic
1016011053 6:139137312-139137334 AACTTGAAAAAAAATTACCCTGG + Intronic
1016054091 6:139560545-139560567 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1016380678 6:143475490-143475512 CAAAAGAAAAAAAATTAGCCAGG + Intronic
1016415805 6:143832499-143832521 CAACAAAAAAAGAATTAGCCAGG - Intronic
1016481156 6:144483601-144483623 AAATTTAAAAATAATTAGCCAGG - Intronic
1016826210 6:148390625-148390647 AAATAGAAAAAAAATTAGCCGGG + Intronic
1017301871 6:152869894-152869916 CATTTGAAAAAAAATTAGCCAGG - Intergenic
1017348192 6:153408779-153408801 AAATACAAAAAAAATTATCCGGG - Intergenic
1017688284 6:156935746-156935768 CACATGAAATAGACTTATCCAGG - Intronic
1017801433 6:157899611-157899633 AAATAGAAAAAAAATTAGCCGGG + Intronic
1018334375 6:162770231-162770253 CAATTGAAATAGAATTATCTTGG - Intronic
1019009450 6:168831315-168831337 CACTGGAAAAAGAATTGTCTTGG - Intergenic
1019333755 7:473029-473051 AAATAAAAAAAAAATTATCCAGG - Intergenic
1019481293 7:1268039-1268061 CAATTAAAAAAAAATTAGCTGGG - Intergenic
1019503586 7:1378203-1378225 AAATACAAAAAAAATTATCCAGG + Intergenic
1019742411 7:2681414-2681436 AAATTAAAAAAAAATTAGCCGGG - Intronic
1019809685 7:3156151-3156173 TAATTTAAAAAAAATTAACCAGG + Intronic
1020187236 7:5968665-5968687 AAATACAAAAAGAATTAGCCAGG - Intronic
1020263480 7:6544920-6544942 AAATAGAAAAAAAATTAGCCAGG + Intronic
1020295680 7:6756107-6756129 AAATACAAAAAGAATTAGCCAGG + Intronic
1020506505 7:8995749-8995771 CAATTGGAAAGGAATAATCTGGG - Intergenic
1021040546 7:15856747-15856769 CTTTTAAAAAAGAATTTTCCAGG - Intergenic
1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG + Intergenic
1021355439 7:19649392-19649414 CAATTAGAAAAGAACAATCCTGG + Intergenic
1021610283 7:22451034-22451056 CAAATGCAAAAAAATTAGCCAGG + Intronic
1021696982 7:23285465-23285487 CATTCGAAAAAGAATTGTCTTGG - Intergenic
1021729362 7:23581430-23581452 AAAATTAAAAAGAATTAGCCAGG + Intergenic
1022884095 7:34623637-34623659 AACTTAAAAAAGAATTATCCTGG + Intergenic
1023040917 7:36172684-36172706 CAATGGAAGAAGAATTGTCTTGG - Intronic
1023232174 7:38045371-38045393 CATATGAAAAAGAATTAAACTGG - Intergenic
1023426962 7:40047291-40047313 CAATTACAAGAGAATTATCAGGG - Intronic
1023536380 7:41216846-41216868 CAATTGAAAAACAACCAGCCAGG - Intergenic
1023543412 7:41291148-41291170 AAATTAAAAAAAAATTAGCCGGG + Intergenic
1023618164 7:42042171-42042193 AAAATAAAAAAAAATTATCCGGG - Intronic
1023893323 7:44410501-44410523 AAATACAAAAAAAATTATCCGGG + Intronic
1024275237 7:47671858-47671880 AAATAGAAAAAAAATTAGCCAGG - Intergenic
1025616712 7:63125414-63125436 AAATACAAAAAAAATTATCCGGG - Intergenic
1026187328 7:68092118-68092140 AAAATTAAAAAAAATTATCCGGG + Intergenic
1026305339 7:69135381-69135403 AAATAGAAAAATAATTAACCAGG + Intergenic
1026319450 7:69256244-69256266 CAAATAAAAAATAATTAGCCAGG + Intergenic
1026334308 7:69380673-69380695 AAATTAAAAAAAAATTAACCAGG - Intergenic
1026831041 7:73610319-73610341 CACTTTAGAAAGAATTGTCCTGG - Intronic
1026835068 7:73633239-73633261 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1026836028 7:73639902-73639924 CAAAAGAAAAATAATTAGCCAGG + Intergenic
1027274986 7:76548009-76548031 CAAAAAAAAAATAATTATCCAGG - Intergenic
1027299157 7:76811501-76811523 TAATTGAAAAATAATTAGCAAGG + Intergenic
1027426417 7:78065770-78065792 CAGTTGAATAAAAATTATCTAGG + Intronic
1027585390 7:80051015-80051037 CAAGTAAAAAATAATTAGCCAGG + Intergenic
1028254586 7:88578222-88578244 CATTGGAAGAAGAATTGTCCTGG + Intergenic
1029011303 7:97264566-97264588 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1029018989 7:97344408-97344430 AAAATGAAAAAAAATTAGCCGGG + Intergenic
1029179909 7:98692967-98692989 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1029261771 7:99307561-99307583 AAAATAAAAAAAAATTATCCAGG + Intergenic
1029266848 7:99349209-99349231 CAATTTTAAAAAAATTAGCCAGG - Intronic
1029357233 7:100061180-100061202 AAATTGAAAAAGAATTTACCAGG - Intronic
1029379881 7:100206173-100206195 AAATTCAAAAAAAATTAGCCAGG - Intronic
1029407507 7:100384554-100384576 AAAATGAAAAAAAATTAGCCAGG - Intronic
1029441242 7:100587757-100587779 AAATTGAAAATAAATTAGCCAGG - Intronic
1029795926 7:102894565-102894587 AAATTTGAAAAGAATTAACCAGG + Intronic
1029869049 7:103668921-103668943 AAATTGAAAAAGAATTTTCATGG + Intronic
1030165293 7:106548485-106548507 AAAATAAAAAAGAATTAACCAGG - Intergenic
1030413791 7:109214284-109214306 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1030804827 7:113903157-113903179 CTAGTGAAAAAGATTAATCCAGG - Intronic
1031140133 7:117933210-117933232 GAATAGAAACAGGATTATCCAGG - Intergenic
1031473687 7:122197632-122197654 AAATAAAAAAAAAATTATCCAGG - Intergenic
1031831833 7:126637147-126637169 CATGTGAAAATGCATTATCCAGG + Intronic
1031899617 7:127393878-127393900 CAAATAAAAAAAAATTAGCCGGG + Intronic
1032242261 7:130172501-130172523 AAATACAAAAAAAATTATCCGGG - Intronic
1032259923 7:130327216-130327238 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1032373520 7:131384858-131384880 CAATAAAAAAAGAATTAAGCTGG - Intronic
1032522960 7:132560315-132560337 CAGTGGAAAAAGAACAATCCCGG - Intronic
1032583235 7:133123025-133123047 CAAAAGAAAAAAAATTAGCCTGG - Intergenic
1032811704 7:135426051-135426073 AAAATAAAAAAAAATTATCCAGG + Intronic
1033021943 7:137734315-137734337 CAATTGAGAAAGAATTCACAAGG - Intronic
1033076643 7:138256085-138256107 AAATACAAAAAAAATTATCCAGG - Intergenic
1033098728 7:138452740-138452762 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1033173490 7:139104560-139104582 AAAATGAAAAAAAATTAGCCAGG + Intronic
1033387193 7:140889227-140889249 CTATTTTAAAAAAATTATCCAGG + Intronic
1033899535 7:146117929-146117951 AAGTTGATAAAGAATTATCGTGG + Intronic
1034107629 7:148503877-148503899 CAATTGAAGAATAAATTTCCAGG - Intergenic
1034326562 7:150239910-150239932 AAATTCAAAAAAAATTAACCAGG - Intergenic
1034394962 7:150815370-150815392 AAATTACAAAAAAATTATCCGGG + Intergenic
1034518468 7:151600552-151600574 CATTTGAGAGAGAAATATCCAGG - Intronic
1034588070 7:152113895-152113917 CTTTTTAAAAAAAATTATCCAGG - Intronic
1035098695 7:156378690-156378712 CAAATGAAAACTAATTGTCCGGG + Intergenic
1035219214 7:157395811-157395833 AAATATAAAAAGAATTAGCCGGG - Intronic
1035397482 7:158544722-158544744 CACTGGAATAAGAATTATCTTGG - Intronic
1035463553 7:159061490-159061512 AAATGGAAAAATAATTAGCCGGG + Intronic
1035967665 8:4212042-4212064 CAGTTGAAAAGGAATTATTAAGG - Intronic
1036588304 8:10145486-10145508 CAGTAGAAAATGAATTATGCAGG - Intronic
1037286799 8:17310156-17310178 AAATTAAAAAAAAATTAGCCAGG - Intronic
1037561864 8:20082554-20082576 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1037771144 8:21800763-21800785 CAAATAAAAAATAATTAGCCAGG + Intronic
1038313156 8:26461507-26461529 AAATTAAAAAAAAATTAGCCAGG + Intronic
1038323006 8:26546758-26546780 AAATTCAAAAAAAATTAGCCGGG + Intronic
1038338189 8:26662170-26662192 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1038374174 8:27021848-27021870 AAATTAAAAAAAAATTAGCCCGG - Intergenic
1038466478 8:27769450-27769472 CAATGGAAAAACAAATATACAGG - Intronic
1038593849 8:28867256-28867278 CAACTGAAAAAAAATTAGCTGGG + Intronic
1038663790 8:29520047-29520069 GACTTTAACAAGAATTATCCTGG + Intergenic
1038853396 8:31303202-31303224 CAGATGAAAGAAAATTATCCTGG - Intergenic
1038913767 8:31996576-31996598 TAATTTAAAAAAAATTAGCCAGG + Intronic
1038965120 8:32563183-32563205 CATTGGAAGAAGAATTATCTTGG - Intronic
1039337317 8:36606132-36606154 CAATACAAAAAAAATTAGCCGGG - Intergenic
1039524309 8:38200162-38200184 CAATACAAAAAAAATTAGCCCGG - Intronic
1039673834 8:39636177-39636199 AAATTTTAAAAAAATTATCCAGG - Intronic
1039749834 8:40467719-40467741 CACTGGAAAAAGAATTGTCTTGG - Intergenic
1039960141 8:42240000-42240022 AAATTCAAAAAGATTTTTCCTGG - Intergenic
1039987143 8:42457229-42457251 CACTTAAAAAAAATTTATCCTGG + Intronic
1040098240 8:43470228-43470250 CAATTTTTAAAGAAGTATCCAGG + Intergenic
1040423716 8:47263476-47263498 AAATTTAAAAAAAATTAGCCCGG - Intronic
1041007013 8:53505176-53505198 CAAAGGAAAAAAAATTAGCCAGG + Intergenic
1041523446 8:58779377-58779399 CATTTCAAAAAGAAGTGTCCTGG - Intergenic
1041711236 8:60896382-60896404 TCATTGAAAAAGAATTGTTCTGG - Intergenic
1041734746 8:61097996-61098018 AAATTTAAAAAAAATTATCCAGG + Intronic
1042231242 8:66557001-66557023 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1043093958 8:75941490-75941512 CAATTGAAAAAGAATTCTAATGG + Intergenic
1043499686 8:80840387-80840409 CATTGGAAAAAGAATTGTCTTGG - Intronic
1043658526 8:82704921-82704943 CACTTGAAAAAGAATTTTTCTGG - Intergenic
1043707745 8:83374321-83374343 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1043951852 8:86318259-86318281 TAATAAAAAAAAAATTATCCAGG + Intronic
1044346337 8:91108792-91108814 CATTGGAAGAAGAATTATCTTGG - Intronic
1044523978 8:93230702-93230724 CAGTTGAAAGAGGAATATCCTGG - Intergenic
1044700837 8:94964106-94964128 CAATTTAAAAAGACTAATACAGG - Intronic
1044746862 8:95378998-95379020 AAATTAAAAAAGAATTAGTCGGG - Intergenic
1045256881 8:100532625-100532647 CAATGGAAGAAGAATTGTCTTGG + Intronic
1045266232 8:100620981-100621003 CATTTAAAAAAAAATTAGCCAGG + Intronic
1045366333 8:101479477-101479499 AAATTTAAAAAAAATTAGCCGGG - Intergenic
1045638548 8:104222098-104222120 CAATTCAAAAAGAGTTGTCAGGG - Intronic
1046094964 8:109546687-109546709 CACTGGAAAAAGAATTATCTTGG - Intronic
1046117678 8:109803799-109803821 CTAATGAAAGAGATTTATCCTGG + Intergenic
1046145745 8:110156210-110156232 CTAATGAAAAAAAATTATTCTGG - Intergenic
1046181363 8:110653443-110653465 CAATTTAAAAGGAATGATACTGG - Intergenic
1046268509 8:111861659-111861681 CTATTCAAAATGAATTTTCCTGG + Intergenic
1046620473 8:116524064-116524086 AAAATAAAAAAAAATTATCCGGG + Intergenic
1047273084 8:123381338-123381360 AAATTGCAAAAAAATTAGCCAGG + Intronic
1047288136 8:123506066-123506088 CAATAATAAAAAAATTATCCGGG + Intronic
1047536496 8:125724928-125724950 CAATGGAAAAAAAATAATCAGGG + Intergenic
1047697538 8:127417693-127417715 AAAAAGAAAAAAAATTATCCGGG - Exonic
1047935782 8:129776920-129776942 CAAAAAAAAAAAAATTATCCAGG - Intronic
1048455747 8:134576842-134576864 AAATTTGAAAAGAATTATCCAGG - Intronic
1049046157 8:140153380-140153402 CAATTTAAAAAGAATGATAGGGG - Intronic
1050193742 9:3057897-3057919 AAATTCAAAAACAATTAGCCAGG - Intergenic
1050351812 9:4747335-4747357 CAATTCAAAAAAAATTAGCTGGG + Intergenic
1050532886 9:6606146-6606168 AAATAGAAAAAAAATTAGCCAGG + Intronic
1050856533 9:10364158-10364180 AAATACAAAAAAAATTATCCGGG - Intronic
1050934061 9:11371215-11371237 CATTTGAAAAAAAATTATAATGG - Intergenic
1051435661 9:17028276-17028298 GAAATGAAAAAAAATTAGCCAGG + Intergenic
1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG + Exonic
1051668469 9:19487288-19487310 CTATAAAAAAAGAATTAGCCAGG + Intergenic
1051712652 9:19947628-19947650 AAAATAAAAAAGAATTAGCCGGG + Intergenic
1052051835 9:23858011-23858033 AAAATTAAAAACAATTATCCAGG - Intergenic
1052085547 9:24261084-24261106 CAATTGAAAACTAGTTAGCCTGG + Intergenic
1052601658 9:30639976-30639998 AAATTACAAAAAAATTATCCGGG + Intergenic
1052894527 9:33734889-33734911 CAACTGAACAAGAAGTCTCCTGG + Intergenic
1052904506 9:33821774-33821796 AAATACAAAAAGAATTAGCCAGG - Intronic
1052959801 9:34285790-34285812 AAATTAAAAAAAAATTAGCCAGG + Intronic
1052965379 9:34336700-34336722 AAATAGAAAAAAAATTAGCCAGG - Intronic
1053079958 9:35167392-35167414 CAGTGGAAGAAGAATTATCTCGG - Intronic
1053091548 9:35282590-35282612 AAATACAAAAAAAATTATCCGGG - Intronic
1053209317 9:36214130-36214152 CAATACAAAAAAAATTAGCCAGG - Intronic
1053639637 9:40058831-40058853 CAACTGAAAAAAAAATAGCCAGG - Intergenic
1053766439 9:41406286-41406308 CAACTGAAAAAAAAATAGCCAGG + Intergenic
1054320443 9:63655488-63655510 CAACTGAAAAAGAAATAGCCAGG - Intergenic
1054545112 9:66317790-66317812 CAACTGAAAAAAAAATAGCCAGG + Intergenic
1055944301 9:81678985-81679007 TAATTTAAAAAAAATTAACCAGG + Intronic
1056067201 9:82948800-82948822 CAATGCTAAAAGAGTTATCCTGG - Intergenic
1056113141 9:83415874-83415896 CAATAGAAAACAAATTATGCAGG - Intronic
1056420465 9:86421316-86421338 CAAAAAAAAAAAAATTATCCAGG - Intergenic
1056576026 9:87856816-87856838 CAAAAAAAAAAAAATTATCCTGG + Intergenic
1056724279 9:89098997-89099019 TAATTAAAAAAGAAATATGCAGG + Intronic
1057093942 9:92287434-92287456 CAATTGAAAAAGTAGTATGATGG - Intronic
1057188648 9:93073405-93073427 AAATAGAAAAATAATTAGCCAGG - Intronic
1057503038 9:95610932-95610954 AAATACAAAAAGAATTAGCCAGG - Intergenic
1057940770 9:99281690-99281712 CAATTAAAAAAAAATTAGCCAGG - Intergenic
1058680223 9:107434325-107434347 AAATACAAAAAAAATTATCCAGG - Intergenic
1058857787 9:109082440-109082462 CAATTGAAAACTAGTTATCAAGG + Intronic
1059020014 9:110566159-110566181 AAATACAAAAAGAATTAGCCAGG + Intronic
1059213831 9:112540871-112540893 AAAATAAAAAAAAATTATCCAGG - Intronic
1059308113 9:113370353-113370375 CATTTGAAGAAGAATTTTCTTGG + Exonic
1059561344 9:115337875-115337897 AAATTAAAAAAAAATTAGCCAGG - Intronic
1060005267 9:119994019-119994041 CAATAGAAAAAGAATGGTCTAGG - Intergenic
1060558569 9:124523479-124523501 CAATTAAACCAGAATTCTCCAGG + Intronic
1060618029 9:125036962-125036984 CATTTTTAAAAAAATTATCCAGG + Intronic
1060624476 9:125098213-125098235 AAAATAAAAAAAAATTATCCAGG - Intronic
1060686295 9:125616044-125616066 CAATTGAAACAGAAAAGTCCAGG + Intronic
1060733318 9:126051226-126051248 AAATTTAAAAAAAATTAGCCGGG + Intergenic
1061103850 9:128513855-128513877 AAATACAAAAAAAATTATCCTGG + Intronic
1061456209 9:130699844-130699866 AAATTAAAAAAGAATTAGCCGGG + Intronic
1062578504 9:137219577-137219599 AAATACAAAAAAAATTATCCAGG - Intergenic
1062588967 9:137264453-137264475 CAAAAGAAAAAGCAATATCCGGG - Intronic
1062644766 9:137541938-137541960 AAAATAAAAAATAATTATCCAGG - Intronic
1202787511 9_KI270719v1_random:42524-42546 CAATTGAAAAAAAAATAGCCAGG - Intergenic
1185575602 X:1169540-1169562 CATTTGAAAGACAATTATCACGG - Intergenic
1185575604 X:1169610-1169632 CATTTGAAAGACAATTATCACGG - Intergenic
1185575606 X:1169680-1169702 CATTTGAAAGACAATTATCACGG - Intergenic
1185580031 X:1204679-1204701 TAATTTAAAAAAAATTAGCCAGG - Intronic
1185827891 X:3270365-3270387 CAAAAAAAAAAAAATTATCCAGG - Intergenic
1186009648 X:5115307-5115329 CAATAGAGAAAGAAATATCTGGG - Intergenic
1186070493 X:5814438-5814460 CATTTTAAAAAGAATTGGCCAGG + Intergenic
1186212156 X:7260564-7260586 AAATAGAAAAAAAATTAGCCAGG - Intronic
1186263623 X:7808036-7808058 CAATTGAAAATCCAATATCCAGG + Intergenic
1186339322 X:8626698-8626720 AAATACAAAAAAAATTATCCAGG + Intronic
1186424105 X:9449835-9449857 CAATTTTAAAATAATTATCAGGG - Intergenic
1186544639 X:10435931-10435953 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1186609869 X:11128692-11128714 AAAATGAAAAAGAAATAGCCGGG + Intergenic
1186656335 X:11615832-11615854 CAATGGGAAAAGTATTATCTAGG - Intronic
1186698456 X:12063590-12063612 AAAAAGAAAAATAATTATCCAGG + Intergenic
1186771296 X:12820409-12820431 CCCGTGACAAAGAATTATCCTGG + Intronic
1188038266 X:25342525-25342547 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1188320844 X:28735448-28735470 AAATTTAAAAATAATTTTCCAGG + Intronic
1188373965 X:29404867-29404889 CCTTTGAAAAAGAATTTTGCTGG + Intronic
1188585483 X:31769538-31769560 CACTGGAAGAAGAATTGTCCTGG + Intronic
1189016785 X:37293237-37293259 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1189277903 X:39800085-39800107 ACATTGAAAAAGATTTATTCAGG - Intergenic
1189406911 X:40733462-40733484 AAATTTTAAAAGAATCATCCTGG + Intronic
1189766962 X:44381733-44381755 CAATTAAAAAAAAATTAGGCTGG - Intergenic
1189887482 X:45563103-45563125 AAATACAAAAAGAATTAGCCAGG + Intergenic
1190221452 X:48514908-48514930 CAATTGTAAAAAAATTAGCCAGG + Intronic
1190313642 X:49135238-49135260 AAATTAAAAAATAATTAGCCGGG + Intergenic
1190393304 X:49954400-49954422 CACTGGAAGAAGAATTATCTTGG - Intronic
1190818589 X:53951609-53951631 AAATAGAAAAAAAATTAGCCGGG - Intronic
1190822366 X:53985688-53985710 AAAGGGACAAAGAATTATCCAGG - Intronic
1191637017 X:63390036-63390058 AAATTCAAAAAAAATTAGCCAGG - Intergenic
1191660510 X:63644924-63644946 CAATTAAAAAACAATTAGCCAGG - Intronic
1191770346 X:64749582-64749604 TAATTGAAAAAAAAGTTTCCTGG - Intergenic
1192093059 X:68181665-68181687 AAATTTAAAAAAAATTAGCCGGG + Intronic
1192571866 X:72212782-72212804 AAATAGAAAAAAAATTAGCCGGG + Intronic
1193184847 X:78500344-78500366 CCATTGTAAAAAAATAATCCAGG - Intergenic
1193333715 X:80263244-80263266 AAATACAAAAAGAATTAGCCAGG + Intergenic
1194650078 X:96504044-96504066 AAATAGAAAAAAAATTAGCCGGG - Intergenic
1194997160 X:100603680-100603702 AAATACAAAAAGAATTAGCCGGG + Intergenic
1195484604 X:105389692-105389714 CATTTAAAAAAGAACTATCCTGG - Intronic
1195510993 X:105714861-105714883 CCATTCAAAAAGAAGTATACTGG + Intronic
1195731480 X:107972812-107972834 AAATAGAAAAAAAATTAGCCAGG + Intergenic
1196681407 X:118473472-118473494 AAATTGAAAAAAAATTAGCTGGG - Intergenic
1196779100 X:119366440-119366462 CATTTGAAAAAGTATTGGCCAGG - Intergenic
1196816824 X:119671604-119671626 TAATTAAAAAAAAATTAGCCAGG + Intronic
1196818721 X:119686078-119686100 CAATTGAAAGAGAGTTTTCTAGG + Intronic
1196848284 X:119914075-119914097 AAATACAAAAAGAATTAGCCGGG + Intronic
1196898985 X:120364875-120364897 AAATTAAAAAAAAATTAACCAGG - Intronic
1197237469 X:124083972-124083994 CATTTGAAAAAGAATAATAAAGG + Intronic
1197352465 X:125394826-125394848 GAATTGAAAAAGAATCCTCAAGG - Intergenic
1197550897 X:127891529-127891551 CAAAAGAAAAAAAATTAGCCAGG - Intergenic
1197714196 X:129694579-129694601 CAATTTAAAAACAATTAGCCAGG - Intergenic
1197801853 X:130358522-130358544 AAATTTAAAAAGAAGTATTCAGG - Intronic
1198322552 X:135532914-135532936 TAATTAAAAAAAAATTAGCCTGG + Intronic
1198826365 X:140702362-140702384 AAATACAAAAAGAATTAGCCAGG + Intergenic
1198921528 X:141733999-141734021 CAATTGAAAAAGACTAATCAAGG - Intergenic
1199006175 X:142699021-142699043 CATTTGAAGAAAAAATATCCAGG - Intergenic
1199400501 X:147393438-147393460 CAATAGAAAAAGAAGTCTTCAGG + Intergenic
1199704326 X:150411038-150411060 CAGTGGAAGAAGAATTGTCCTGG - Intronic
1200319403 X:155170983-155171005 AAATTAAAAAAAAATTAGCCAGG - Intergenic
1200334588 X:155336042-155336064 CAATTAAAAAAGAATATTGCTGG - Intergenic
1200361343 X:155610681-155610703 CAATTAAAAAAGAATATTGCTGG + Intronic
1201182988 Y:11367784-11367806 TAATTAAAAAAAAATTAGCCGGG + Intergenic
1201587166 Y:15573753-15573775 AAATAGAAAAAAAATTAGCCTGG + Intergenic
1201757726 Y:17505074-17505096 AAATTCAAGAACAATTATCCTGG + Intergenic
1201843828 Y:18400908-18400930 AAATTCAAGAACAATTATCCTGG - Intergenic