ID: 972586208

View in Genome Browser
Species Human (GRCh38)
Location 4:40438830-40438852
Sequence GGCCGCCGGGTCCTCCGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2532
Summary {0: 1, 1: 0, 2: 9, 3: 1464, 4: 1058}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972586208_972586211 -7 Left 972586208 4:40438830-40438852 CCTTGGCGGAGGACCCGGCGGCC 0: 1
1: 0
2: 9
3: 1464
4: 1058
Right 972586211 4:40438846-40438868 GGCGGCCGAGTCACTGCTCATGG 0: 1
1: 0
2: 0
3: 0
4: 68
972586208_972586213 -1 Left 972586208 4:40438830-40438852 CCTTGGCGGAGGACCCGGCGGCC 0: 1
1: 0
2: 9
3: 1464
4: 1058
Right 972586213 4:40438852-40438874 CGAGTCACTGCTCATGGCTGCGG 0: 1
1: 0
2: 2
3: 21
4: 265
972586208_972586214 2 Left 972586208 4:40438830-40438852 CCTTGGCGGAGGACCCGGCGGCC 0: 1
1: 0
2: 9
3: 1464
4: 1058
Right 972586214 4:40438855-40438877 GTCACTGCTCATGGCTGCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 176
972586208_972586215 14 Left 972586208 4:40438830-40438852 CCTTGGCGGAGGACCCGGCGGCC 0: 1
1: 0
2: 9
3: 1464
4: 1058
Right 972586215 4:40438867-40438889 GGCTGCGGTGGAATCCTCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 124
972586208_972586217 29 Left 972586208 4:40438830-40438852 CCTTGGCGGAGGACCCGGCGGCC 0: 1
1: 0
2: 9
3: 1464
4: 1058
Right 972586217 4:40438882-40438904 CTCTGCGGTCATAATGTCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972586208 Original CRISPR GGCCGCCGGGTCCTCCGCCA AGG (reversed) Exonic
Too many off-targets to display for this crispr