ID: 972588740

View in Genome Browser
Species Human (GRCh38)
Location 4:40463886-40463908
Sequence ACATTGCCATATATGATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972588738_972588740 -10 Left 972588738 4:40463873-40463895 CCCTGTGAAACGCACATTGCCAT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 972588740 4:40463886-40463908 ACATTGCCATATATGATGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 61
972588737_972588740 20 Left 972588737 4:40463843-40463865 CCTAAATTGGTAATACAGTTTTT 0: 1
1: 1
2: 0
3: 31
4: 374
Right 972588740 4:40463886-40463908 ACATTGCCATATATGATGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972588740 Original CRISPR ACATTGCCATATATGATGCG TGG Intronic
1068863937 10:61875055-61875077 ACATGGCCATATCTGATGCTGGG - Intergenic
1071017817 10:81019254-81019276 ACATTGCCAAATATCCTCCGTGG - Intergenic
1074362209 10:112832666-112832688 ACATTTCCATATTGGATGCAGGG - Intergenic
1074613741 10:115045266-115045288 CAATTGCCATATATGATTGGGGG - Intergenic
1075018170 10:118926453-118926475 ACATTGCCAAATATCCTGGGGGG + Intergenic
1087287697 11:96282966-96282988 ATTTTTCCATATATGATGCCAGG + Intronic
1089909965 11:122088205-122088227 AAATAGCCACATATGATGAGTGG + Intergenic
1090625672 11:128606364-128606386 TCATTGTCATATTTGATGTGTGG + Intergenic
1095570839 12:43683700-43683722 ACATTGCCATATCCGATATGTGG + Intergenic
1102630156 12:114271100-114271122 TCACTGCCATATATGTAGCGAGG - Intergenic
1108942595 13:55976655-55976677 ACAGTGCCATATAGGAAGAGGGG + Intergenic
1115675491 14:35668642-35668664 ACATTACCAGATATGGTGCCTGG + Intronic
1120017050 14:79485947-79485969 ACATAGCCATATTTGAAGCCTGG - Intronic
1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG + Intronic
1129758640 15:78113892-78113914 ACACTGCCACATATGAGGTGGGG - Intronic
1142125918 16:88410448-88410470 ACAGTGACATCTATGATGCACGG + Intergenic
1145180711 17:20749071-20749093 AGTTTCCCATATATGATGTGGGG + Intergenic
1145217555 17:21063418-21063440 AGATTGCCATATATCATGTTGGG + Intergenic
1163260493 19:16186790-16186812 ACATTGCCACATGTGCTTCGGGG - Intronic
937886557 2:126903177-126903199 ACATTGCCATATAGCAAGGGTGG + Intergenic
939407977 2:141784504-141784526 ACATTTCCATATAAGAAGTGGGG + Intronic
942805964 2:179931126-179931148 AAATTGCCACATGTTATGCGAGG - Intergenic
945809644 2:214533094-214533116 ACATCACCATATCTGATTCGTGG + Intronic
948022375 2:234745554-234745576 ACATAGCAATATATGGTGCCAGG + Intergenic
948087249 2:235261783-235261805 ATACTGCCATATATAATGTGGGG - Intergenic
1169575001 20:6950004-6950026 ACTTTTACATATATGATGCAGGG + Intergenic
1174901955 20:54509509-54509531 ATATTTTCATATATGATGGGAGG + Intronic
1176328838 21:5528478-5528500 ACGTTTCCATATATGATACTAGG - Intergenic
1176398919 21:6292473-6292495 ACGTTTCCATATATGATACTAGG + Intergenic
1176438238 21:6696631-6696653 ACGTTTCCATATATGATACTAGG - Intergenic
1176462500 21:7023701-7023723 ACGTTTCCATATATGATACTAGG - Intergenic
1176486061 21:7405479-7405501 ACGTTTCCATATATGATACTAGG - Intergenic
1178125679 21:29513129-29513151 ATATTGCCATATATCATTCCTGG + Intronic
1180913442 22:19469376-19469398 ACACTGCCATAGGTGATGTGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
953514472 3:43576748-43576770 ACAATGGCATAGATGATGCTGGG + Exonic
953790878 3:45946974-45946996 ACATTGCCATAGATAATTTGGGG - Exonic
962851773 3:139313506-139313528 ATATTGCAATATATGTTGAGAGG - Intronic
963922077 3:150915609-150915631 AAAATGCCATATATCATGCATGG - Intronic
967077321 3:186015171-186015193 ACATTGACATAAATGATGGAAGG - Intergenic
971238058 4:24861683-24861705 TCATTGCCAAATATGATCCATGG - Intronic
972588740 4:40463886-40463908 ACATTGCCATATATGATGCGTGG + Intronic
975716414 4:77209693-77209715 ACATTACCAAATGTGCTGCGGGG + Intronic
984142634 4:176022259-176022281 ACAGTGCAATCTATGATGGGAGG - Intergenic
984339342 4:178435308-178435330 ACATTTCCATATGTAATGCTAGG - Intergenic
987642519 5:20630375-20630397 ACATTGCCAAATATTATTCTGGG - Intergenic
987868513 5:23578619-23578641 ACATTGACTTATATCATGTGAGG - Intergenic
1000301096 5:159956767-159956789 ACATTGTCATATATTCTGGGCGG - Intronic
1000481171 5:161776452-161776474 ACATTGCCATATATTATGTATGG + Intergenic
1008170905 6:48204275-48204297 TCAATGCCATATAAGAAGCGTGG + Intergenic
1012728186 6:102843701-102843723 ATATTGGCAAATATGATGGGAGG - Intergenic
1019152713 6:170019485-170019507 ACGTTGCCATAAATGTTGTGAGG - Intergenic
1021964999 7:25908808-25908830 ACATTGCCAAATGTCTTGCGGGG - Intergenic
1030847619 7:114440732-114440754 ACTTTGCCATATATCATCCATGG + Intronic
1037260662 8:17003293-17003315 ATATTGTCATAAATGATGAGTGG + Intergenic
1038127054 8:24686082-24686104 CCATTACCGTATATGATGAGAGG - Intergenic
1040711178 8:50190963-50190985 TCATTGCCATAAATTATGCCGGG + Intronic
1046188414 8:110754668-110754690 AGATTGGCATATATGATAGGAGG + Intergenic
1046372816 8:113332789-113332811 ATATTAACATATATGATGCAAGG + Intronic
1046451966 8:114405144-114405166 GCATTGCCAAATATGCTGCTTGG - Intergenic
1055812448 9:80165102-80165124 ACATTTGCATATATGATATGTGG + Intergenic
1057500269 9:95591710-95591732 TCATTTTCATATATGATGCCAGG - Intergenic
1058306528 9:103449148-103449170 AAATTGCCACATATGATTAGTGG - Intergenic
1188709602 X:33379092-33379114 ACATTGCCAGATATGTTTCATGG - Intergenic