ID: 972591131

View in Genome Browser
Species Human (GRCh38)
Location 4:40488147-40488169
Sequence CTAATTTTGTAGTAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 0, 2: 7, 3: 117, 4: 832}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972591131_972591136 17 Left 972591131 4:40488147-40488169 CCCAGCCTCTACTACAAAATTAG 0: 1
1: 0
2: 7
3: 117
4: 832
Right 972591136 4:40488187-40488209 ACCTGTAATCGCCACTACTCAGG 0: 1
1: 46
2: 1433
3: 39397
4: 169189
972591131_972591139 26 Left 972591131 4:40488147-40488169 CCCAGCCTCTACTACAAAATTAG 0: 1
1: 0
2: 7
3: 117
4: 832
Right 972591139 4:40488196-40488218 CGCCACTACTCAGGAGGCTGAGG 0: 2
1: 166
2: 4380
3: 111625
4: 217241
972591131_972591138 20 Left 972591131 4:40488147-40488169 CCCAGCCTCTACTACAAAATTAG 0: 1
1: 0
2: 7
3: 117
4: 832
Right 972591138 4:40488190-40488212 TGTAATCGCCACTACTCAGGAGG 0: 1
1: 82
2: 2419
3: 65818
4: 156302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972591131 Original CRISPR CTAATTTTGTAGTAGAGGCT GGG (reversed) Intronic
900153844 1:1195812-1195834 CTAATTTTTTGGTAGAGACAAGG + Intronic
900935546 1:5764187-5764209 CCACTTCTGTAGAAGAGGCTTGG + Intergenic
900979507 1:6038470-6038492 TTAATTTTTTTGTAGAGACTGGG + Intronic
901090768 1:6639502-6639524 CTATTTTTTTAGTAGAGACAGGG + Intronic
901103884 1:6740398-6740420 CTAATTTTTTTGTAGAGACAAGG + Intergenic
901500117 1:9647239-9647261 CTAATTTTTTTGTAGAGACAGGG - Intergenic
901885303 1:12218501-12218523 CTAATTTTTTGGTAGAGACGAGG - Intergenic
902062985 1:13660845-13660867 TTAATTTTTTAGTAGAGACGGGG - Intergenic
902261027 1:15225004-15225026 TAAATTTTGTAGTAGAGACAGGG - Intergenic
902815582 1:18914642-18914664 GTATTTTTTTAGTAGAGACTGGG - Intronic
902909658 1:19586105-19586127 TTTATTTTTTTGTAGAGGCTGGG - Intergenic
903086021 1:20859763-20859785 CAAATTTTTTAGTAGAGACGGGG + Intronic
903139561 1:21331099-21331121 CTAATTTTTTTGTAGAGACAGGG - Intronic
903407275 1:23108432-23108454 CTAATTTTTTTGTAGAGACTGGG - Intronic
903532021 1:24038128-24038150 GTATTTTTTTAGTAGAGACTGGG - Intergenic
903586343 1:24418455-24418477 CTAATTTTTTTGTAGAGACAGGG - Intronic
903699502 1:25236101-25236123 CTAATTTTTTAGTAGAGACGAGG - Intergenic
903905519 1:26683259-26683281 CTAATTTTTTAGTAGAGATGGGG + Intergenic
904135408 1:28308330-28308352 CTATTTTTGTAGTAGAAACGGGG - Intergenic
904190423 1:28738617-28738639 CTATTTTTTTAGTAGAGACGGGG + Intronic
904192242 1:28754646-28754668 CTAATTTTTTAGTAGAGATGGGG - Intronic
904214263 1:28906943-28906965 CTAATTTTTTTGTAGAGACGGGG + Intronic
904218420 1:28943478-28943500 TTAATTTTTTAGTAGAGACAGGG - Intronic
904656300 1:32050685-32050707 TTTATTTTTTAGTAGAGGCAAGG + Intronic
905363443 1:37435798-37435820 CTAATTTTCTTGTAGAGACGGGG + Intergenic
905576470 1:39048604-39048626 CTAATTTTTTTGTAGAGACAGGG + Intergenic
905577021 1:39052983-39053005 GTATTTTTTTAGTAGAGGCGGGG - Intergenic
905640626 1:39587255-39587277 GTATTTTTGTAGTAGAGACGGGG - Intergenic
906119376 1:43378372-43378394 CTAATTTTTTAGTAGAGACAGGG + Intergenic
906162663 1:43662073-43662095 GTAATTTTTTTGTAGAGACTGGG + Intronic
906661672 1:47587344-47587366 CCAATTTTTTAGTAGAGACAGGG - Intergenic
907003288 1:50884339-50884361 CTTTTTTTTTAGTAGAGGCAGGG - Intronic
907087096 1:51685568-51685590 CTAATTTTTTTGTAGAGACGAGG + Intronic
907176043 1:52523431-52523453 CTATATTTTTAGTAGAGACTGGG - Intronic
907267205 1:53269868-53269890 CTAACATTGTAGTAGACACTGGG - Intronic
907339232 1:53722666-53722688 CTAATTTTTTTGTAGAGACAGGG - Intronic
907446031 1:54508347-54508369 CTAATTTTTTAGTTGAGACAGGG + Intergenic
907820017 1:57958148-57958170 CTAAATTTTTAGTAGAGACGGGG + Intronic
908147167 1:61258891-61258913 CTAATTTTTTTGTAGAGACGGGG + Intronic
908540492 1:65117525-65117547 CTAATTTTTTAGTAGAGACAGGG + Intergenic
908557687 1:65273422-65273444 GTAATTTTTTAGTAGAGACGGGG - Intronic
908709337 1:66997337-66997359 CTAATTTTTTTGTAGAGACGGGG - Intergenic
909007177 1:70290728-70290750 TTATTTTTTTAGTAGAGGCAGGG + Intronic
910264791 1:85327171-85327193 CTAATTTTTTTGTAGAGACAGGG - Intronic
910757109 1:90705903-90705925 CTAATTTTGTATTATAGGAGTGG + Intergenic
910968995 1:92835478-92835500 CTACTTTTTTAGTAGAGACAGGG - Intronic
911209038 1:95120293-95120315 CTAATTTTGTAAGAAAGTCTAGG + Intronic
911225873 1:95305138-95305160 CTAATTTTTTAGTAGAGACATGG - Intergenic
911719975 1:101180359-101180381 TTAATTTTTTTGTAGAGGCAGGG - Intergenic
912340347 1:108908507-108908529 CTAATTTTTTAGTAGAGACACGG - Intronic
912626758 1:111211649-111211671 GTATTTTTGTAGTAGAGACGGGG + Intronic
912823144 1:112883224-112883246 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
913249042 1:116896674-116896696 TTAATTTTCTTGTAGAGGCAAGG - Intergenic
914314500 1:146497079-146497101 GTATTTTTTTAGTAGAGGCATGG - Intergenic
914499852 1:148236309-148236331 GTATTTTTTTAGTAGAGGCATGG + Intergenic
914797809 1:150936161-150936183 CTATTTTTTTAGTAGAGACAGGG + Intronic
915219698 1:154364788-154364810 CTAGTTTTTTAGTAGAGACAGGG - Intergenic
915240223 1:154515887-154515909 GTATTTTTTTAGTAGAGGCGGGG + Intronic
915381829 1:155448667-155448689 GTATTTTTTTAGTAGAGACTGGG + Intronic
915829614 1:159114542-159114564 CTAATTTTTTTGTAGAGGCAGGG - Intronic
916204968 1:162307627-162307649 CTGTATTTTTAGTAGAGGCTGGG - Intronic
916237253 1:162602762-162602784 CTAATTTTTTAGTAGAGACGGGG + Intergenic
916908353 1:169315436-169315458 GTAATTTTTTAGTAGAGACAAGG + Intronic
917440444 1:175064190-175064212 TTATTTTTTTAGTAGAGGCAGGG - Intergenic
917893066 1:179458153-179458175 CTAATTTTTTTGTAGAGATTGGG + Intronic
919121703 1:193349067-193349089 AGAATTTTGTAGTAAAGGCCTGG + Intergenic
919276237 1:195420331-195420353 TTAATTTTTTAGTAGAGACAGGG - Intergenic
920196847 1:204233619-204233641 TTAATTTTTTTGTAGAGGCAGGG + Intronic
920239786 1:204537918-204537940 CTAATTTTGTAGTAGACTGGAGG + Intronic
921012222 1:211153251-211153273 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
921272713 1:213487228-213487250 CTAATTTTTTTGTAGAGACAGGG - Intergenic
921837887 1:219796322-219796344 CTGATTTTTTAGTAGAGACAGGG - Intronic
921999082 1:221455866-221455888 CTAAGTTTTTAGTAGAGACGGGG + Intergenic
922281925 1:224133681-224133703 CTAATTTTTTAGTAGAGACGGGG + Intronic
922321159 1:224488638-224488660 CAAAATTTGTTGTAGAGACTAGG + Intronic
922403912 1:225291580-225291602 CTAATTTTTTTGTAGAGGCGGGG + Intronic
922480268 1:225935706-225935728 GTATTTTTTTAGTAGAGACTGGG - Intergenic
922914646 1:229246871-229246893 CTATTTTTTTAGGAGAGGCAGGG - Intergenic
922947060 1:229525664-229525686 CTAATTTTTTAGTAGAGACAGGG - Intronic
923355783 1:233154252-233154274 GTAATTTTTTAGTAGAGACAGGG + Intronic
923472474 1:234304333-234304355 ATATTTTTTTAGTAGAGGCAGGG + Intronic
923674693 1:236069645-236069667 GTATTTTTTTAGTAGAGGCGGGG - Intergenic
923980786 1:239320546-239320568 GTACTTTTTTAGTAGAGGCAGGG - Intergenic
924163796 1:241261445-241261467 TTTATTTTTTAGTAGAGACTGGG - Intronic
924417763 1:243876430-243876452 CTAATTTTTTTGTAGAGACAGGG + Intergenic
924575354 1:245276167-245276189 CTAATTTTTTAATAGAGTCGAGG - Intronic
924592049 1:245413486-245413508 CTATTTTTTTAGTAGAGACAGGG - Intronic
1063079379 10:2751053-2751075 CTTATTCTGTAGTGCAGGCTGGG + Intergenic
1064236956 10:13585129-13585151 CTATTTTTGTAGTAGAGACAGGG + Intergenic
1064274517 10:13893685-13893707 CTAATTTTTTAGTAGAGGCGGGG + Intronic
1064360802 10:14662548-14662570 TTAATTTTTTTGTAGAGACTGGG + Intronic
1064578827 10:16773032-16773054 CTAATTTTTTTGTAGAGGTGGGG - Intronic
1064646764 10:17467568-17467590 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1065137840 10:22690181-22690203 CCTATTTTGGAGTAGAGGTTGGG + Intronic
1065579718 10:27158332-27158354 TTAATTTTGTTGTAGAGACAAGG - Intronic
1065957046 10:30703044-30703066 CTAATTTTTTAATAGAGACCAGG - Intergenic
1065966750 10:30776810-30776832 TTAATTTTTTGGTAGAGGCAAGG - Intergenic
1066126790 10:32349553-32349575 TTAATTTTATAAAAGAGGCTTGG - Intronic
1066181093 10:32961412-32961434 CTTATTTTTTAGTTGGGGCTGGG - Intronic
1066362632 10:34745924-34745946 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1066387096 10:34950120-34950142 TTTATTTTTTAGTAGAGGCAAGG + Intergenic
1066415162 10:35214761-35214783 CTATTTTGGTAGCAGAAGCTTGG - Intergenic
1066511722 10:36106635-36106657 GTATTTTTTTAGTAGAGGCGGGG - Intergenic
1066758421 10:38732619-38732641 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1066963236 10:42240075-42240097 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1067110921 10:43399258-43399280 TTAATTTTTTAGTAGAGGCAAGG + Intronic
1067737771 10:48871647-48871669 TTAATTTTTTTGTAGAGACTGGG + Intronic
1068080193 10:52310055-52310077 CTAATCTGAGAGTAGAGGCTGGG - Intergenic
1069048729 10:63769778-63769800 TTAATTTTGTAATAGAAGGTGGG - Intergenic
1069099030 10:64295318-64295340 CTAACTAGGTAGTAGATGCTGGG - Intergenic
1069323614 10:67204229-67204251 CTAATGTTGGAGGAGGGGCTTGG + Intronic
1069498883 10:68931604-68931626 CTACTTTTTTAGTAGAGACGGGG + Intronic
1070694211 10:78549879-78549901 CTAATTTTGGAGTGGTGGCTAGG - Intergenic
1070839530 10:79474058-79474080 TTTATTTTTTAGTAGAGGCAGGG - Intergenic
1070915877 10:80154401-80154423 CAAATTTTTTAGTAGAGACAGGG + Exonic
1070946829 10:80399210-80399232 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1071802240 10:89076715-89076737 CTCATTTTGCTGTAGAGGTTTGG + Intergenic
1071809271 10:89160911-89160933 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1072097810 10:92199516-92199538 CTAATTTTTTAGTATAGACGGGG - Intronic
1072479484 10:95796904-95796926 CTAATTTTTTTGTAGAGACAGGG - Intronic
1072670879 10:97427995-97428017 CTCATCTTTTAGGAGAGGCTGGG + Intronic
1072998720 10:100269231-100269253 TTAAATTTGTAGTAGAGACGAGG - Intergenic
1073308086 10:102518963-102518985 CTATTTTTTTAGTAGAGACGGGG - Intronic
1073569855 10:104570936-104570958 CTAATTTCTTATTAGAAGCTAGG - Intergenic
1073796584 10:106995136-106995158 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1074051976 10:109888372-109888394 CTGATTTTATAGTAGAGGTCAGG - Intronic
1074542395 10:114375799-114375821 CAAAATTTTTAGTAGAGGCAAGG - Intronic
1074606111 10:114969257-114969279 TGTATTTTTTAGTAGAGGCTGGG - Intronic
1074661826 10:115667835-115667857 CTATTTTTTTAGTAGAGGTGTGG + Intronic
1075037956 10:119085150-119085172 CTATTTTTTTAGTAGAGACAAGG - Intergenic
1075450370 10:122547342-122547364 CTAATTTTTTTGTAGAGACAAGG + Intergenic
1075931055 10:126296305-126296327 CTAATTTTTTAGTAGAGACAGGG + Intronic
1077097945 11:807311-807333 CTAATTTTTTAGTAGAGACAGGG - Intronic
1078185172 11:9046180-9046202 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1078964491 11:16322215-16322237 CCAATGTTGGAGGAGAGGCTTGG + Intronic
1078999698 11:16740917-16740939 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1079057776 11:17221730-17221752 TTTATTTTTTAGTAGAGGCAAGG + Intronic
1079058747 11:17229322-17229344 GTATTTTTTTAGTAGAGACTGGG - Intronic
1079120215 11:17677927-17677949 GTAATTTTGTAATATAGGCTGGG + Intergenic
1079230720 11:18646539-18646561 GTAGTTTTGTAGAAGGGGCTGGG - Intergenic
1080632230 11:34088482-34088504 TTAATTTTTTTGTAGAGGCGAGG - Intronic
1080654522 11:34248261-34248283 TTAATTTTTTTGTAGAGGGTGGG + Intronic
1081838406 11:46176738-46176760 CTAGTTCTGAAGGAGAGGCTGGG - Intergenic
1082003226 11:47405745-47405767 CAATTTTTGTAGTAGAGACAGGG - Intergenic
1082262348 11:50086347-50086369 CTCATTTTGTTGCACAGGCTGGG - Intergenic
1082562407 11:54634019-54634041 CAAAAGTTGTAGTGGAGGCTAGG - Intergenic
1083798108 11:65030059-65030081 TTAAATTTTTTGTAGAGGCTGGG + Intronic
1083819967 11:65164251-65164273 CTATTTTTTTAGTAGAGACAGGG - Intergenic
1084058887 11:66656447-66656469 CTATTTTTTTAGTAGAGACGGGG + Intronic
1085381766 11:76126113-76126135 CTAATTTTTTAGTAGAGACGGGG + Intronic
1086222268 11:84462487-84462509 GTATTTTAGTAGTAGAGGCTGGG - Intronic
1086354384 11:85979315-85979337 TTAAATTTTTAGTAGAGACTGGG - Intronic
1086409775 11:86532885-86532907 CTAATTTTTTAGTAGAGACGGGG - Intronic
1087118980 11:94553109-94553131 GTATTTTTTTAGTAGAGACTGGG - Intronic
1087928635 11:103949843-103949865 CTGATTTGTTAGTAGAGTCTTGG + Intronic
1088127807 11:106449559-106449581 CTAATTTTTTAGTAGAGACGGGG + Intergenic
1088443069 11:109893244-109893266 GTAATTTTGTAGTAGAAGAACGG + Intergenic
1088856058 11:113754763-113754785 TTATTTTTTTAGTAGAGGCCAGG + Intronic
1088865073 11:113839714-113839736 CTAATTTTTTAGTAGAGACAGGG - Intronic
1088910717 11:114189589-114189611 CTATTTTTTTAGTAGAGACGGGG - Intronic
1089579605 11:119473225-119473247 TTAATTTTTTTGTAGAGGCAGGG - Intergenic
1089734519 11:120540446-120540468 CTAATTTTGTAGTACAGACAGGG - Intronic
1089934153 11:122346135-122346157 CTAATTTAGAAATAGAAGCTTGG - Intergenic
1090492466 11:127176906-127176928 CTAATTTTTTTGTAGAGTCAGGG + Intergenic
1090715747 11:129429357-129429379 CTAATTTTTTTTTAGAGGCAGGG - Intronic
1091731068 12:2880809-2880831 TTAAATTTGTAGTAGAGACGAGG + Intronic
1091882942 12:3994270-3994292 CTAATTTTTTAGTAGAGACAGGG + Intergenic
1091909544 12:4217953-4217975 CTAATTTTTTTGTAGAGATTAGG + Intergenic
1091995978 12:4994439-4994461 CGAATTTTTTAGTAGAGACGGGG + Intergenic
1092130028 12:6104511-6104533 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1092343280 12:7694390-7694412 TTAATTTTTTAGTAGAGACAGGG - Intronic
1092379980 12:7987811-7987833 TTTATTTTTTAGTAGAGGCAGGG + Intergenic
1092461799 12:8693691-8693713 CTAAATTTGCAGTACAGGCCCGG - Intronic
1093228606 12:16515462-16515484 CTGATTTTTTAGTAGAGACGGGG - Intronic
1093397602 12:18702693-18702715 CTTATTTTGAAGTAGATCCTAGG - Intronic
1093469003 12:19481273-19481295 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1093668120 12:21838858-21838880 CTAATTTTTTGGTAGAGACAGGG - Intronic
1094200258 12:27787837-27787859 TTGATGTTGTAGTAGAGCCTGGG + Intronic
1094428304 12:30338759-30338781 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1094583916 12:31759322-31759344 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1094665608 12:32517718-32517740 CTAATTTTTTTGTAGAGACAGGG - Intronic
1095175805 12:39090830-39090852 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1095480163 12:42626346-42626368 GTAACTTTGTAGTAGAGACGGGG + Intergenic
1095779372 12:46042197-46042219 CTAATTTTAAAGCATAGGCTTGG + Intergenic
1095833039 12:46608003-46608025 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1096150962 12:49312305-49312327 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1096735894 12:53654216-53654238 ATAATTTTATAGTGGAGGCATGG - Intronic
1097003872 12:55901146-55901168 CTAATTTTTTAGTAGAGATGGGG - Intergenic
1097537205 12:60887682-60887704 CAGTTTTTGTAGTAGTGGCTTGG + Intergenic
1097573456 12:61360197-61360219 CTAATTTTTTAGTAGAGATAGGG - Intergenic
1097665914 12:62476982-62477004 CTAATTTTTTAGTAGAGATGGGG - Intronic
1097741738 12:63251390-63251412 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1097765775 12:63525144-63525166 CTAATTTTTTAGTAGAGACAGGG - Intergenic
1097839538 12:64308144-64308166 GTAGTTTTTTAGTAGAGACTGGG - Intronic
1097872691 12:64614298-64614320 TAAATTTTGTAGTAGAGACGGGG + Intronic
1097939336 12:65286841-65286863 TTTAATTTTTAGTAGAGGCTAGG - Intronic
1098363309 12:69676512-69676534 TTAATATTGTAGTAGAATCTTGG - Intronic
1098939282 12:76516344-76516366 TTAATTGTGGAGAAGAGGCTAGG - Intronic
1099307359 12:80973999-80974021 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1100020403 12:90062499-90062521 CTAATTTATTAGTAGAGACAGGG - Intergenic
1100316183 12:93446825-93446847 TTAATTTTTTTGTAGAGACTGGG + Intergenic
1100507251 12:95234464-95234486 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1100515231 12:95321016-95321038 CTGATTTTTTAGTAGAGGCAGGG + Intergenic
1100684339 12:96970331-96970353 CTCATTTTGTATTTCAGGCTTGG + Intergenic
1100977861 12:100141305-100141327 GTATTTTTTTAGTAGAGACTGGG - Intronic
1101346197 12:103888612-103888634 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1101676145 12:106918333-106918355 CTTTTTTTTTAGTGGAGGCTGGG + Intergenic
1101848050 12:108379353-108379375 CTAATTTTTTGGTAGAGACGGGG - Intergenic
1102072818 12:110035743-110035765 AAAATTTTTTGGTAGAGGCTAGG - Intronic
1102305081 12:111798709-111798731 AAAATTTTTTAGTACAGGCTGGG + Intronic
1102592553 12:113967796-113967818 GTAATTTTTTGGTAGAGGCGAGG + Intergenic
1102795013 12:115681681-115681703 GTAATTTTGTTGTAGAGACAGGG - Intergenic
1102883681 12:116505995-116506017 TTAATTTTTTAGTAGAGACGGGG - Intergenic
1102971477 12:117171189-117171211 CTAATTTTTTTGTAGAGACGGGG - Intronic
1103072173 12:117953915-117953937 TTAAATTTTTTGTAGAGGCTGGG - Intronic
1103231242 12:119332605-119332627 ATGATTTTGTAGAACAGGCTTGG - Intergenic
1103374286 12:120443237-120443259 CTAATTTTTTTGTAGAGACAGGG + Intronic
1103389046 12:120556976-120556998 CTAATTTTTTAGTAGAGACGGGG - Intronic
1103498003 12:121377868-121377890 TTAATTTTTTTGTAGAGGCAGGG + Intronic
1103625152 12:122213084-122213106 CTAATTTTTTTGTAGAGACAGGG + Intronic
1104651195 12:130535324-130535346 TTAATTTTTTAGTTGAGACTGGG - Intronic
1105448427 13:20476848-20476870 GTAATTTTTTAGTAGAGTCGAGG - Intronic
1105493145 13:20906658-20906680 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1105630235 13:22156609-22156631 CTGATTTAGTAGTTGAGGTTGGG + Intergenic
1105664405 13:22536298-22536320 TTAATTTTTTAGTAGAGACAAGG + Intergenic
1105791331 13:23802400-23802422 CTAATTTTTTAGTGGAGACAGGG - Intronic
1106082808 13:26514608-26514630 TAAAATTTTTAGTAGAGGCTGGG - Intergenic
1106941721 13:34787457-34787479 CTAATTTTTTAGTAGAGACAGGG - Intergenic
1107066828 13:36222719-36222741 CTAATTTTATATTAGATGCCAGG - Intronic
1107402052 13:40078610-40078632 GTAATTTTTTAGAAGAGACTAGG - Intergenic
1107473983 13:40717176-40717198 CTGTATTTTTAGTAGAGGCTGGG - Intergenic
1108047936 13:46400828-46400850 CTAATTTTTTAGTACAGACGGGG - Intronic
1108100789 13:46952398-46952420 TTAATTTTTTAGAAGAGGCCAGG - Intergenic
1108242423 13:48479557-48479579 GTATTTTTGTGGTACAGGCTTGG + Intronic
1108354722 13:49619901-49619923 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1108385923 13:49899306-49899328 CTAACTTTTTAGTAGAGACGGGG + Intergenic
1108672394 13:52704891-52704913 CTAATTTTTTAGTAGAGATGGGG - Intronic
1108910837 13:55549859-55549881 CTAAAGTTGTAGGAGAGGCCTGG + Intergenic
1109463322 13:62692775-62692797 TTAAAAATGTAGTAGAGGCTGGG + Intergenic
1109475210 13:62872448-62872470 CTAACTTAGTAGTATAGTCTTGG + Intergenic
1109985971 13:69984934-69984956 CTATTTTTTTAGTAGAGACCAGG - Intronic
1110240032 13:73256728-73256750 CTAATTTTTTAGTAGAGACAGGG + Intergenic
1110307787 13:74010113-74010135 CTGATTTTTTGGTAGAGACTGGG + Intronic
1110328759 13:74247641-74247663 ATTATTTTTTTGTAGAGGCTGGG + Intergenic
1110432345 13:75439725-75439747 GTATTTTTGTAGTAGAGACGGGG - Intronic
1110444270 13:75560046-75560068 TTCATTGTGTAGTAGAGGCCAGG + Intronic
1110576187 13:77058012-77058034 GTATTTTTGTAGTAGAGACGGGG + Intronic
1110800790 13:79692266-79692288 CCAATTTTGTAGTGGTGGATAGG + Intergenic
1111730680 13:92072745-92072767 TTTATTTTGTAGTAGAGGTGGGG + Intronic
1111939292 13:94592626-94592648 TGTATTTTGTAGTAGAGGCAGGG + Intronic
1112055405 13:95685653-95685675 CTAATGTTGGAGTTGGGGCTTGG + Intronic
1112211565 13:97382822-97382844 CTAATTTTTTTGTAGAGACAGGG + Intronic
1112514844 13:100044496-100044518 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
1112585220 13:100712928-100712950 GTATTTTTTTAGTAGAGGCATGG + Intergenic
1114481905 14:23041299-23041321 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1114539590 14:23444995-23445017 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1114902184 14:27076591-27076613 CTAGTTTTCTGGTAGAGGCATGG - Intergenic
1115097450 14:29654344-29654366 CTATGTTTTTAGTAGAGGCAGGG + Intronic
1115692485 14:35859114-35859136 CCTTTTTTGTAGTAGAGACTGGG + Intronic
1115834836 14:37390025-37390047 ATATTTTTGTAGTAGAGACAGGG - Intronic
1116457588 14:45136555-45136577 CTAATTTTGAAGTAAGAGCTGGG + Intronic
1116835420 14:49765743-49765765 CTATTTTTTTAGTAGAGACGGGG + Intergenic
1117537202 14:56713502-56713524 GTAATTTTTTAGTAGAGACAGGG + Intronic
1117777334 14:59196427-59196449 TTAATTTTGTAGTACATTCTGGG - Intronic
1117821183 14:59650996-59651018 CTAGTTTTTTAGTAGAGACAGGG - Intronic
1118004513 14:61553521-61553543 GTAATTTTTTAGTAGAGACGGGG - Intronic
1118293530 14:64547861-64547883 CTTATTTTTTAGTAGAGACGGGG - Intergenic
1118406710 14:65431483-65431505 GTATTTTTTTTGTAGAGGCTGGG + Intronic
1118563554 14:67114516-67114538 TTAATTTTTTAGTAGAGGCAGGG - Intronic
1118791684 14:69099076-69099098 TTAAATTTTTAGTAGAGACTGGG - Intronic
1119251451 14:73158496-73158518 TTGTATTTGTAGTAGAGGCTAGG + Intronic
1119288278 14:73474038-73474060 GTATTTTTGTAGTAGAGACGGGG - Intergenic
1119351264 14:73967632-73967654 CTAATTTTTTTGTAGAGACGGGG - Intronic
1119540219 14:75433027-75433049 CTAATTTTTTAGTAGAGACGGGG - Intronic
1119967381 14:78931972-78931994 CTAATTTTGTAGTAGAGACAGGG - Intronic
1120434853 14:84468171-84468193 TTTTTTTTTTAGTAGAGGCTGGG + Intergenic
1120724152 14:87919168-87919190 CTAATTTTGTAGTCAAAGTTGGG - Intronic
1120826252 14:88958365-88958387 CGTATTTTTTAGTAGAGACTGGG + Intergenic
1120943928 14:89976269-89976291 CTAATTTTTTTGTAGAGACAGGG + Intronic
1121093473 14:91199423-91199445 CTAATTTTTTAGTAGAGATGAGG + Intronic
1121207815 14:92184037-92184059 TTAATTTTTTAGTAGAGACGGGG + Intergenic
1121474951 14:94190433-94190455 CTAATTTTTTAGTAAAGACAGGG - Intronic
1121481289 14:94277124-94277146 GTAATTTTTTAGTAGAGACAGGG - Intronic
1121923060 14:97901195-97901217 CTATATTTTTAGTAGAGACTGGG - Intergenic
1122106917 14:99464968-99464990 CTAATTTTTTTGTAGAGGTGAGG - Intronic
1122536558 14:102468016-102468038 ATATTTTTTTAGTAGAGGCAGGG + Intronic
1122560517 14:102610726-102610748 CTAATTTTTTAGTAGAGACGAGG + Intronic
1122989084 14:105228376-105228398 CTAATTTTTTAGTAGAGATGGGG - Intronic
1202828275 14_GL000009v2_random:284-306 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
1124013128 15:25854883-25854905 GTATTTTTCTAGTAGAGACTGGG - Intronic
1125543293 15:40484856-40484878 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
1125629863 15:41138457-41138479 CTAATTTTTTTGTAGAGACGGGG + Intergenic
1125780576 15:42262587-42262609 CTAATTTTTTTGTAGAGACAGGG + Intronic
1126059540 15:44766882-44766904 GTAATTTTTTAGTAGAGACAGGG - Intronic
1126107839 15:45158534-45158556 CTAATTTTTTTGTAGAGACGGGG - Intronic
1126630331 15:50728518-50728540 CTATTTTTTTAGTAGAGACGGGG + Intronic
1127124769 15:55801257-55801279 CTAATTTTTTAGTAGAGACGGGG + Intergenic
1127444961 15:59051601-59051623 CTAATTTTTTAGTAGAGATGGGG - Intronic
1127796890 15:62446170-62446192 CTAATTTTTTGGTAGAGACAGGG + Intronic
1128196904 15:65766074-65766096 GTAATTTTTTAGTAGAGACAGGG - Intronic
1128235505 15:66064699-66064721 CTTTTTTTTTAGTAGAGACTGGG + Intronic
1128493759 15:68178102-68178124 CTAATTTTTTGGTAGAGACAGGG - Intronic
1128655344 15:69457076-69457098 CAAAATTTCTTGTAGAGGCTGGG - Intergenic
1128957481 15:71963622-71963644 CTATTTTTTTAGTAGAGACAGGG + Intronic
1129252604 15:74317183-74317205 GTATTTTTTTAGTAGAGACTGGG - Intronic
1129260871 15:74366490-74366512 TTATTTTTGTAGTAGAGACAGGG + Intronic
1129263179 15:74380452-74380474 CTATTTTTTTAGTAGAGACAGGG + Intergenic
1129423193 15:75446520-75446542 CTCATTTTGTCGTCAAGGCTGGG + Intronic
1129496826 15:75990855-75990877 CAAATTTTGTTGTAGAGACAGGG + Intronic
1129593660 15:76941197-76941219 CTAATTTTTTAGTAGAGATGGGG + Intronic
1129808293 15:78482911-78482933 CTAATTTTTTAGTAGAGACGAGG + Intronic
1129818205 15:78574805-78574827 CTAATTTTTTTGTAGAGACAGGG - Intronic
1130031810 15:80321666-80321688 TTAATTTTTTAGTAGAGATTGGG + Intergenic
1130892232 15:88142819-88142841 CTAATTTGGAAATAGAGTCTTGG + Intronic
1130993511 15:88891050-88891072 GTAATTTTTTAGTAGAGACGGGG + Intronic
1131235499 15:90693231-90693253 TTAATTTTTTAGTAGAGACGCGG + Intergenic
1131331811 15:91507099-91507121 CTTATTTTGTTTTGGAGGCTAGG + Intergenic
1134074189 16:11279107-11279129 CTAATTTTTTTGTAGAGACGAGG - Intronic
1134162822 16:11905660-11905682 TTAATTTTTTAGTAGAGACGGGG - Intronic
1134543792 16:15092002-15092024 TTATTTTTTTAGTAGAGGCAGGG - Intronic
1135148633 16:19985776-19985798 CTAATTTTGTAGTAGAGACAGGG + Intergenic
1135600774 16:23781727-23781749 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1135747081 16:25026454-25026476 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1135874004 16:26180450-26180472 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1136161853 16:28425209-28425231 CTAATTTTTTAGTAGAGGTAGGG + Intergenic
1136201113 16:28689779-28689801 CTAATTTTTTAGTAGAGGTAGGG - Intronic
1136217456 16:28803965-28803987 CTAATTTTTTAGTAGAGGTAGGG - Intergenic
1136332389 16:29588855-29588877 CTAATTTTTTATTAGAGACCGGG - Intergenic
1136545871 16:30954388-30954410 CTAATTTTTTTGTAGAGACGGGG + Exonic
1136719377 16:32308178-32308200 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1136837749 16:33514458-33514480 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1136842729 16:33552617-33552639 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1137260801 16:46828100-46828122 CTAATTTTTTAGTAGAGACAGGG + Intronic
1137283116 16:46994840-46994862 GTAATTTTTTAGTAGAGACGGGG + Intergenic
1137302957 16:47171178-47171200 CTAATTTTTTTGTAGAGACAAGG + Intronic
1137622516 16:49885478-49885500 CCAAGTTTCTAGTAGTGGCTTGG - Intergenic
1137728516 16:50673126-50673148 TTAATTTTTTAGTAGAGACAGGG - Exonic
1138845769 16:60563937-60563959 CTAATTTTTGTGTAGAGGCGGGG - Intergenic
1138964112 16:62063210-62063232 CTAAATTCCTAATAGAGGCTGGG - Intergenic
1139394102 16:66626295-66626317 CTAATTTTTTAGTAGAGACGGGG - Intronic
1139746003 16:69075012-69075034 CTAATTTTTTAGTAGAGACGGGG + Intronic
1139795984 16:69483293-69483315 TTAATTTTTTAGTAGAGACGGGG - Intergenic
1139819445 16:69709087-69709109 TTAAGTTTTTAGTAGAGACTGGG + Intronic
1139904455 16:70354029-70354051 TTAAATTTTTAGTAGAGACTAGG + Intronic
1140396561 16:74632214-74632236 CTATTTTTGTAGTAGAGACGGGG - Intronic
1140422971 16:74835925-74835947 ATAATTTTTTAGTAGAGACAGGG + Intergenic
1140502428 16:75445467-75445489 TTTATTTTGTAGTAGAGACAAGG + Intronic
1140657956 16:77159523-77159545 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1140739404 16:77927701-77927723 CTAATTTTTTAGTAGAGACGGGG - Intronic
1140971930 16:80021743-80021765 TTGAATTTTTAGTAGAGGCTAGG - Intergenic
1141044079 16:80700031-80700053 CTGATTTTTTAGTAGAGACGGGG + Intronic
1203007054 16_KI270728v1_random:209591-209613 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1203152894 16_KI270728v1_random:1852915-1852937 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1142561005 17:808847-808869 TTAATTTTTTAGTAGAGACGGGG + Intronic
1142974097 17:3633151-3633173 GTTATTTTGTAGTAGAGACAGGG + Intronic
1143160889 17:4870084-4870106 TTTATTTTGTAGTAGAGACGGGG + Intronic
1143487962 17:7265305-7265327 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
1143533221 17:7518474-7518496 CTAATTTTTTAGTAGAGACTGGG + Intergenic
1143899081 17:10159949-10159971 CTAATTTTTTTGTAGAGACAGGG + Intronic
1144035359 17:11360383-11360405 GTATTTTTGTAGTAGAGACAGGG - Intronic
1144451162 17:15380146-15380168 GTATTTTTGTAGTAGAGACTGGG + Intergenic
1144468942 17:15519734-15519756 CTAATTTTTTAGTAGATACAGGG - Intronic
1144741591 17:17585906-17585928 TTAATTTTTTAGTAGAGACGGGG - Intronic
1145008056 17:19348791-19348813 ATAATTTTGGATTAGAGTCTGGG - Intronic
1145084846 17:19928702-19928724 CTAATTTTTTAGTAGAGATGGGG - Intronic
1145216178 17:21054311-21054333 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1145874802 17:28309552-28309574 CTAATTTTTTTGTAGAGACAAGG - Intergenic
1146001853 17:29135274-29135296 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1146097559 17:29946610-29946632 CTATTTTTTTAGTAGAGACTGGG + Intronic
1146113734 17:30115743-30115765 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1146206258 17:30907683-30907705 CTAATTTTTTCGTAGAGACGGGG - Intronic
1146261142 17:31422007-31422029 CTAATTTTCTTGTAGAGACGGGG - Intronic
1146327492 17:31899418-31899440 CTAATTTTTTGGTAGAGACTGGG - Intronic
1146387008 17:32385934-32385956 GTAATTTTTTAGTAGAGACGGGG + Intergenic
1147117831 17:38315438-38315460 CTAATTTTTTTGTAGAGACAGGG + Intronic
1147177593 17:38665869-38665891 CTATTTTTTTAGTAGAGACAGGG - Intergenic
1147209066 17:38860907-38860929 CGTATTTTTTAGTAGAGACTGGG - Intergenic
1147280545 17:39356834-39356856 TTAATTTTGCAGTAGAGACAAGG + Intronic
1147297377 17:39494943-39494965 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1147684385 17:42277928-42277950 GTATTTTTGTAGTAGAGACGGGG + Intergenic
1147751149 17:42734487-42734509 GTAATTTTTTTGTAGAGACTGGG - Intronic
1147858350 17:43500310-43500332 GTATTTTTTTAGTAGAGACTTGG - Intronic
1147948680 17:44094966-44094988 TTAATTTTTTAGTAGAGACAGGG + Intronic
1148545949 17:48519141-48519163 GTAATTTTTTAGTAGAGACAGGG - Intergenic
1148602666 17:48906262-48906284 GTATTTTTTTAGTAGAGGCGAGG - Intergenic
1148969670 17:51468803-51468825 CTATTTTTTTAGTAGAGACGGGG - Intergenic
1148997002 17:51719436-51719458 CCAAATTTGTATTAGATGCTGGG - Intronic
1149017024 17:51919824-51919846 GTAATTTTTTAGTAGAGACGGGG + Intronic
1149594313 17:57855174-57855196 TTAAATTTGTAGTAGAGACGGGG - Intergenic
1149708032 17:58713511-58713533 TTAAATTTTTTGTAGAGGCTGGG + Intronic
1149791116 17:59478333-59478355 GTATTTTTCTAGTAGAGGCGGGG - Intergenic
1149898357 17:60449417-60449439 GTATTTTTTTAGTAGAGGCAAGG - Intronic
1150053721 17:61991680-61991702 CTATTTTTTTAGTAGAGACGGGG + Intronic
1150102065 17:62432494-62432516 CTAATTTTTTTGTAGAGACAGGG - Intronic
1150106013 17:62463075-62463097 GTAATTTTTTAGTAGAGACAGGG - Intronic
1150254264 17:63731436-63731458 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1150507615 17:65715623-65715645 CATATTTTTTAGTAGAGACTGGG + Intronic
1151394938 17:73816806-73816828 AAAATTTTTTTGTAGAGGCTGGG - Intergenic
1151864825 17:76794309-76794331 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1151940778 17:77290431-77290453 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1152221098 17:79067106-79067128 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1153734887 18:8056454-8056476 CTAATTTTGTAGTTTAGAGTCGG - Intronic
1153792083 18:8587766-8587788 TTGTTTTTGTAGTAGAGGCAGGG + Intergenic
1153808580 18:8732282-8732304 TTTATTTTTTAGTAGAGACTGGG + Intronic
1154058702 18:11037137-11037159 GTATTTTTGTAGTAGAGACGGGG + Intronic
1154212414 18:12390984-12391006 CTATATTTTCAGTAGAGGCTGGG - Intergenic
1154267076 18:12888180-12888202 CTAATTTTTTAGTAGAGATGGGG + Intronic
1155028606 18:21964599-21964621 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1155046524 18:22108382-22108404 CTAATTTTTTTGTAGGGGGTGGG + Intergenic
1155492376 18:26412207-26412229 TTAATTTTTTAGTAGAGACGGGG - Intergenic
1155954599 18:31946508-31946530 CTAAATTTTTAGTAGAGACGGGG - Intronic
1157388754 18:47283126-47283148 GTAATTTTTTAGTAGAGACAGGG + Intergenic
1157466651 18:47953029-47953051 TTTATTTTTTAGTAGAGGCGAGG - Intergenic
1157818241 18:50746677-50746699 CTAATTTTTTAGTAGAGACAGGG + Intergenic
1158222397 18:55163158-55163180 TTAATTTTTTAGTAGAGACAAGG - Intergenic
1158620519 18:59028708-59028730 ATATTTTTGTAGTAGAGACGGGG + Intergenic
1160207690 18:76848829-76848851 CTAATTTTTTAGTAGAGATGGGG + Intronic
1160783355 19:888347-888369 GTAATTTTTTAGTAGAGACGGGG - Intronic
1161197570 19:2995467-2995489 TTAATTTTTTTGTAGATGCTGGG + Intergenic
1161303422 19:3554262-3554284 TTAAATTTTTAGTAGAGGCAAGG - Intronic
1161564100 19:4990115-4990137 TTAATTTTTTTGTAGAGACTGGG - Intronic
1161749549 19:6084804-6084826 TTATATTTTTAGTAGAGGCTGGG + Intronic
1162065766 19:8124416-8124438 GTTATTTTTTAGTAGAGACTCGG + Intronic
1162154325 19:8666687-8666709 CTAATTTAGGAGCAGAGGGTTGG + Intergenic
1162420328 19:10562509-10562531 TTAATTTTTTTGTAGAGGCGGGG + Intronic
1162519632 19:11172147-11172169 TTAATTTTTTAGTAAAGGCAGGG + Intronic
1162712299 19:12604475-12604497 CTATGTTTTTAGTAGAGGCAGGG - Intronic
1162813168 19:13176977-13176999 CTAATTTTTTTGTACAGGCGGGG - Intergenic
1163064275 19:14781653-14781675 CTAATTTTTTAGTAGAGACGGGG + Intergenic
1163118615 19:15202494-15202516 CTATTTTTTTAGTAGAGACTGGG + Intergenic
1163560251 19:18014876-18014898 CTATTTTTTTAGTAGAGACAGGG + Intergenic
1163585791 19:18162709-18162731 TTAATTTTTTAGTAGAGACGGGG - Intronic
1163613711 19:18313983-18314005 CTAATTTTTTAGTAGAGACGGGG + Intronic
1164004547 19:21136483-21136505 TTAATTTTTTAGTAGAGGCGGGG - Intergenic
1164659919 19:29955136-29955158 TTAATTTTTTAGTAGAGACGGGG + Intronic
1164851595 19:31488831-31488853 CTTTTTTTTTGGTAGAGGCTGGG + Intergenic
1165056794 19:33182342-33182364 CTAATTTTTTTGTAGAGACAGGG + Intronic
1165201281 19:34146919-34146941 CTAATTTTTTTGTAGAGACAGGG + Intergenic
1165870495 19:38969275-38969297 CTAATTTTTTTGTAGAGACGGGG - Intronic
1165910160 19:39220870-39220892 TGAATTTTTTAGTAGAGACTGGG + Intergenic
1166525077 19:43505423-43505445 CTTTTTTTTTAGTAGAGACTGGG + Intergenic
1166778491 19:45326871-45326893 ATATTTTTGTAGTAGAGACAGGG - Intergenic
1166838050 19:45679305-45679327 CTATTTTTTTAGTAGAGACAGGG - Intronic
1166932567 19:46309912-46309934 CTAATTTTTTTGTAGAGACGGGG - Intronic
1166974183 19:46594250-46594272 TTAATTTTGTTGTAGAGGTTGGG + Intronic
1167165163 19:47794260-47794282 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1167838139 19:52091975-52091997 CTAATTTTTTAGTAGAGACAGGG - Intronic
1167953617 19:53046991-53047013 CTAATTTTTTAGTAGAGACAGGG - Intronic
1168080979 19:54010184-54010206 CTAATTTTGTAGTAGAGATAGGG + Intronic
1168094384 19:54106341-54106363 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1168218228 19:54942078-54942100 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1168403781 19:56100447-56100469 CTAATTCCGCAGAAGAGGCTGGG + Intronic
1168593154 19:57653219-57653241 CTAATTTTTTAGTAGAGGCAGGG - Intergenic
1202644424 1_KI270706v1_random:127536-127558 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
925492852 2:4414137-4414159 CTAAGTGTGTAGTATAAGCTGGG - Intergenic
925779214 2:7365331-7365353 CTTATTTTTTAGTAGAGACGGGG - Intergenic
925973017 2:9120750-9120772 TTATATTTTTAGTAGAGGCTGGG - Intergenic
926336299 2:11865243-11865265 CTAACTTTTTAGTAGAGACGAGG - Intergenic
926344717 2:11934812-11934834 CTGACTTTGGAGTAGAGGCATGG + Intergenic
926569248 2:14511298-14511320 GTATTTTTGTAGTAGAGACAGGG - Intergenic
927529544 2:23781986-23782008 GTAATTTTTTTGTAGAGGCGAGG + Intronic
927693114 2:25222257-25222279 CTATTTTTTTAGTAGAGACGGGG - Intergenic
928116258 2:28547026-28547048 CTTGTATTGTAGTAGAGGCAGGG - Intronic
928135419 2:28684194-28684216 CTAGTTTTGGAGCAGAGGCCTGG + Intergenic
928313474 2:30229595-30229617 CTCATTTTGGAGAAGAGGGTGGG - Intergenic
928531409 2:32196138-32196160 ATAATTTTTTAGTAGAGACAGGG - Intronic
928545189 2:32322828-32322850 CTAATTTTTTTGTAGAGACAGGG - Intergenic
928565236 2:32538756-32538778 CATATTTTTTAGTAGAGGCAGGG - Intronic
928788509 2:34921022-34921044 AGAATTTTGTAGAAGAGACTAGG + Intergenic
928893852 2:36238633-36238655 CCAATTTTCTATTACAGGCTTGG - Intergenic
929016251 2:37499200-37499222 CTAAGGTTGTCGTAGAGTCTTGG + Intergenic
930849563 2:55944279-55944301 CTATTTTTTTAGTAGAGACAGGG + Intergenic
931687197 2:64804513-64804535 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
932221065 2:69999479-69999501 GTATTTTTGTAGTAGAGACTAGG - Intergenic
932241449 2:70160312-70160334 GTATTTTTATAGTAGAGACTGGG + Intronic
932333412 2:70914273-70914295 GTAATTTTTTAGTAGAGACAGGG - Intronic
932859801 2:75278341-75278363 CTAATTTTGTACATGAGGATAGG + Intergenic
933067717 2:77818856-77818878 TTTTTTTTTTAGTAGAGGCTGGG + Intergenic
933087358 2:78072358-78072380 CTATTTTTTTAGTAGAGGCAGGG - Intergenic
933745646 2:85569153-85569175 GTATTTTTTTAGTAGAGACTGGG - Intronic
933761587 2:85675938-85675960 TTTATTTTTTAGTAGAGACTAGG + Intergenic
933822525 2:86126660-86126682 GTATTTTTGTAGTAGAGACGGGG - Intronic
933913716 2:86967018-86967040 ATAATTTTGTAAAAGAGGCCGGG + Intronic
934009278 2:87802880-87802902 ATAATTTTGTAAAAGAGGCCGGG - Intronic
934321735 2:91977060-91977082 GTATTTTTTTAGTAGAGACTGGG + Intergenic
934506803 2:94901129-94901151 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
935772862 2:106443590-106443612 ATAATTTTGTAAAAGAGGCCGGG - Intronic
935907207 2:107852339-107852361 ATAATTTTGTAAAAGAGGCCGGG + Intronic
935941339 2:108242484-108242506 CTTATTTTTTAGTGGAGGGTGGG + Intergenic
935973886 2:108558381-108558403 CTAATTTTTTAGTAGAGATGGGG + Intronic
935980789 2:108624904-108624926 TTTATATTTTAGTAGAGGCTGGG - Intronic
935993608 2:108744492-108744514 ATAATTTTGTAAAAGAGGCCGGG + Intronic
936069501 2:109356214-109356236 GTCATTTTGGTGTAGAGGCTGGG - Intronic
936128998 2:109817480-109817502 ATAATTTTGTAAAAGAGGCCGGG + Intronic
936215699 2:110554005-110554027 ATAATTTTGTAAAAGAGGCCGGG - Intronic
936414805 2:112296643-112296665 CTGATTTTATAGTAGAAGCTGGG + Intronic
936424836 2:112408578-112408600 ATAATTTTGTAAAAGAGGCCGGG - Intronic
936743714 2:115547598-115547620 CTAATTCTTTTGTAGAGGCGGGG - Intronic
937039406 2:118809192-118809214 CTAATTTGGGAGGATAGGCTGGG + Intergenic
937066964 2:119024620-119024642 CTAATTTTGAGGTAGAAGATAGG - Intergenic
939352236 2:141054008-141054030 CTGATTTTGTATTAAATGCTGGG - Intronic
940242507 2:151578485-151578507 TTTATTTTTTAGTAGAGGCAGGG - Intronic
940243499 2:151589163-151589185 TTTATTTTTTAGTAGAGGCAGGG - Intronic
940244455 2:151599716-151599738 TTTATTTTTTAGTAGAGGCAGGG - Intronic
940966721 2:159846350-159846372 CTAATTTTTTTGTAGAGACAGGG - Intronic
940968049 2:159862124-159862146 CTAATTTTTTAGTAGAGATGGGG - Intronic
941077361 2:161020897-161020919 TGTATTTTGTTGTAGAGGCTGGG - Intergenic
941188758 2:162350049-162350071 TTTATTATGTAATAGAGGCTGGG + Intronic
941605770 2:167594738-167594760 CTAATTTTTTAATAGAGACGGGG - Intergenic
941758216 2:169211719-169211741 CTGATTTTGTAGTCTAGGGTAGG - Intronic
942053817 2:172164245-172164267 TTAATTTTTTAGTAGAGACAGGG + Intergenic
942280230 2:174355591-174355613 GTATTTTTCTAGTAGAGCCTGGG - Intronic
942360332 2:175165961-175165983 CTAAGATAATAGTAGAGGCTGGG - Intronic
943243605 2:185419270-185419292 CTAATTTTTTTGTAGAGACGGGG + Intergenic
944065075 2:195611089-195611111 CTAATTTTTTTGTAGAGGTGGGG + Intronic
944491871 2:200266374-200266396 ATATTTTTGTAGTAGGTGCTGGG - Intergenic
944551972 2:200852345-200852367 CTAATTTTTTAGTAGAGATGGGG + Intergenic
944634826 2:201665242-201665264 CTATTTTTTTAGTAGAGGCAGGG + Intronic
944703750 2:202268358-202268380 CTATTTTTTTAGTAGAGACGGGG - Intronic
944722301 2:202436278-202436300 CTAATTTTTTTGTAGAGACGGGG - Intronic
945692367 2:213053955-213053977 TCAATTTTATATTAGAGGCTGGG + Intronic
946149390 2:217753906-217753928 ATAATTTTGTAAACGAGGCTTGG - Intronic
946395914 2:219443670-219443692 CAAATATTGTAATAGAGGGTGGG + Intronic
946903080 2:224390875-224390897 GTATTTTTGTAGTAGAGACGGGG + Intronic
947459590 2:230292293-230292315 CAAATTTGGAAGTAGAGGCCAGG - Intronic
947574857 2:231264930-231264952 CTAATTTTTTAGCAGAGACAGGG - Intronic
1168950582 20:1798107-1798129 CTAATTTTTTTTTAGAGGCGGGG - Intergenic
1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG + Intergenic
1169282125 20:4276961-4276983 CTAATTTTTAAGAAGAGGTTTGG - Intergenic
1169427358 20:5506900-5506922 CTAATTTTGTATTAGAGACGAGG - Intergenic
1169498591 20:6137817-6137839 GTATTTTTTTAGTAGAGTCTGGG - Intergenic
1170636746 20:18112868-18112890 GTAATTTTTTAGTAGAGGCAGGG + Intergenic
1171220800 20:23395287-23395309 ATAATTTTGGAGTGGAGGGTGGG + Intronic
1171894391 20:30746469-30746491 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
1172048726 20:32100078-32100100 TTAATTTTTTTGTAGAGACTTGG + Intronic
1172218587 20:33254821-33254843 CTATTTTTTTAGTAGAGGCAAGG - Intergenic
1172249223 20:33467188-33467210 CAAATTTTTTAGTAGAGGCAGGG + Intergenic
1172260246 20:33557999-33558021 CTAAATTTTTAGTAGAGACGGGG + Intronic
1172472968 20:35214510-35214532 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1172724547 20:37027925-37027947 TTAATTTTTTGGTAGAGACTGGG + Intronic
1172745973 20:37209329-37209351 TTAATTTTTTAGTAGAGACGGGG + Intronic
1173006095 20:39140880-39140902 GTAATTTTTTAGTAGAGACAGGG + Intergenic
1173038112 20:39432125-39432147 GTAATTTTGTAATAGAGCGTTGG + Intergenic
1173528976 20:43754064-43754086 GTATTTTTGTAGTAGAGACGGGG + Intergenic
1173585136 20:44176627-44176649 CTAATTTTTTTGTAGAGACGGGG - Intronic
1174535285 20:51246726-51246748 CCCATTTTGCAGTGGAGGCTTGG + Intergenic
1175102071 20:56586409-56586431 CTAATTTTTTAGTGGAGACAGGG - Intergenic
1176607457 21:8845118-8845140 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
1177187115 21:17808870-17808892 CTAATATTGGAGGAGGGGCTTGG + Intronic
1177221035 21:18193519-18193541 GTATTTTTTTAGTAGAGACTGGG - Intronic
1177259227 21:18707153-18707175 TTAAATTTTTAGTAGAGACTGGG + Intergenic
1177292137 21:19127431-19127453 TAATTTTTGTAGTAGAGGCAGGG - Intergenic
1178062143 21:28864001-28864023 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1178081089 21:29065906-29065928 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1178262581 21:31113800-31113822 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1179121337 21:38548934-38548956 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1179498294 21:41789603-41789625 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1180357540 22:11854905-11854927 TTAATTCTGGAGTAGGGGCTAGG + Intergenic
1180380724 22:12137428-12137450 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
1180548483 22:16522827-16522849 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1180559835 22:16607176-16607198 CTAATTTTTTTGTAGAGACAAGG - Intergenic
1180718192 22:17886492-17886514 CTAATTTTTTAGTAGAGATGGGG - Intronic
1180730926 22:17981928-17981950 TTAATTTTTTTGTAGAGGCAAGG - Intronic
1180737685 22:18030543-18030565 CTAATTTTTTGGTAGAGACGGGG - Intergenic
1180792655 22:18584860-18584882 CTAATATTTTAGTAGAGACAGGG - Intergenic
1180897515 22:19347764-19347786 TTATTTTTTTAGTAGAGGCGGGG - Intronic
1180978239 22:19863168-19863190 CTAATTTTTTAGTAAAGACGGGG + Intergenic
1181017250 22:20078325-20078347 CTAATTTTTTTGTAGGGGGTTGG + Intergenic
1181229082 22:21410451-21410473 CTAATATTTTAGTAGAGACAGGG + Intergenic
1181249569 22:21524414-21524436 CTAATATTTTAGTAGAGACAGGG - Intergenic
1181263824 22:21618388-21618410 GTAATTTTTTAGTAGAGACGGGG - Intronic
1181363435 22:22356175-22356197 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1181753236 22:25004649-25004671 CTAAAAGTGTAGAAGAGGCTGGG + Intronic
1181783852 22:25211586-25211608 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1181965869 22:26656488-26656510 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1182110564 22:27720185-27720207 CTATATTTTTAGTAGAGGCAGGG + Intergenic
1182413515 22:30206330-30206352 CTAATTTTGTATTAGAGATGGGG + Intergenic
1182488493 22:30654156-30654178 TTATTTTTTTAGTAGAGACTGGG + Intronic
1182588124 22:31358260-31358282 ATTTTTTTTTAGTAGAGGCTGGG - Intergenic
1183049127 22:35246445-35246467 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
1183714537 22:39526020-39526042 CTAATTTTTTAGTAGAGATAGGG - Intergenic
1183718599 22:39548979-39549001 CTAATTTTGAGATAGAGTCTCGG + Intergenic
1183804467 22:40196312-40196334 CTAATTTTTTTGTAGAGGTGGGG + Intronic
1183819409 22:40333169-40333191 CTAATTTTTTAGTAGAGACGGGG - Exonic
1183846552 22:40545897-40545919 CTAATTTTTTAGTAGAGGAGGGG + Intronic
1183878903 22:40809450-40809472 TTAATTTTTTTGTAGAGACTGGG - Intronic
1183988603 22:41583305-41583327 GTACTTTTTTAGTAGAGGCAGGG - Intronic
1184914845 22:47562435-47562457 CTATTTTTTTAGTAGAGACGGGG + Intergenic
1185354120 22:50356136-50356158 CTATTTTTTTAGTAGAGACGGGG + Intronic
950004150 3:9680669-9680691 CTAATTTTTTAGTAGAGATTGGG - Intronic
950025057 3:9814471-9814493 CTATTTTTTTAGTAGAGACAGGG - Intronic
950070591 3:10148990-10149012 ATAATTCTGTAGTCCAGGCTGGG + Intronic
950734693 3:14996734-14996756 CTAATTTTTTGGTAGAGACAGGG + Intronic
950771230 3:15313069-15313091 TTTATTTTTTAGTAGAGACTGGG - Intronic
951533007 3:23715382-23715404 CTAATTTTTTTGTAGAGGCAGGG + Intergenic
951805311 3:26637160-26637182 CTAATTTTTTAGTAGAGACAGGG + Intronic
951973420 3:28475014-28475036 TTTATTTTTTAGTAGAGGCAGGG + Intronic
952165080 3:30739160-30739182 CTGATTTTATAGTAGATGCAGGG + Intronic
952429691 3:33211064-33211086 TTATTTTTTTAGTAGAGACTGGG + Intronic
952616360 3:35278268-35278290 CTCATGTTGTAGTGGAGTCTGGG - Intergenic
952776072 3:37047840-37047862 CTATTTTTTTAGTAGAGACGGGG - Intronic
952787824 3:37173360-37173382 CTAATTTTTTTGTAGAGACAGGG + Intronic
952789440 3:37187804-37187826 TTAATTTTTTAATAGAGACTGGG + Intergenic
953055803 3:39386406-39386428 CTAATTTTTTTGTAGAGACGGGG - Intronic
953260515 3:41334367-41334389 CTCTCTTTGTAGCAGAGGCTTGG - Intronic
953715944 3:45317134-45317156 CTAATATTTTAGTAGAGACAGGG - Intergenic
953751753 3:45614351-45614373 TTATATTTGTTGTAGAGGCTGGG - Intronic
954198651 3:49011248-49011270 CTAATTTTTTAGTAGAGATGGGG + Intronic
954247717 3:49344827-49344849 CTATGTTTTTAGTAGAGACTGGG - Intergenic
954267357 3:49480124-49480146 TTTTTTTTTTAGTAGAGGCTGGG + Intronic
954355478 3:50081190-50081212 GTATTTTTTTAGTAGAGACTGGG + Intronic
954681447 3:52348227-52348249 CAGATTTTGTAGGTGAGGCTTGG + Intronic
956197065 3:66663584-66663606 GTATGTTTTTAGTAGAGGCTGGG - Intergenic
956445990 3:69326250-69326272 TTAATAATGTAGAAGAGGCTGGG - Intronic
957450389 3:80373736-80373758 GTATTTTTGTAGTAGAGACGGGG + Intergenic
958500247 3:94896563-94896585 CTATTTTTTTAGTAGAGACGGGG - Intergenic
958830431 3:99081566-99081588 CTATTTCTGTAGGAAAGGCTTGG - Intergenic
958906421 3:99946960-99946982 GTATTTTTTTAGTAGAGGCGGGG - Intronic
958935040 3:100247633-100247655 CTAATTTTTTTGTAGAGACAGGG + Intergenic
959159332 3:102704768-102704790 CTATTTTTTTAGTAGAGACAAGG - Intergenic
959177637 3:102935918-102935940 AAAATTTTTTAGTAGAGGCAAGG - Intergenic
959483109 3:106897334-106897356 CTAATTCTGGAGTGGGGGCTGGG + Intergenic
959780971 3:110232887-110232909 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
959971096 3:112410933-112410955 CTAATTTTTTAGTAGAGACAGGG + Intergenic
960931447 3:122854915-122854937 GTATTTTTTTAGTAGAGACTGGG - Intronic
961544625 3:127623809-127623831 GTATTTTTTTAGTAGAGACTGGG - Intergenic
961759320 3:129153930-129153952 GTAATTTTTTAGTAGAGACAGGG - Intronic
962492693 3:135909501-135909523 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
963072375 3:141315034-141315056 CTAATTTTTTTGTAGAGACAGGG - Intergenic
963222354 3:142826179-142826201 GTATTTTTTTAGTAGAGGCGGGG + Intronic
963853562 3:150231547-150231569 CTAATTTTTTAGTAGAGACGGGG + Intergenic
965531819 3:169778054-169778076 CTATTTTTTTTGTAGAGGCAGGG - Intronic
965591765 3:170367282-170367304 CTATTTTTTTAGTAGAGACGGGG + Intronic
965914112 3:173820012-173820034 CTAATTTTTCAGTAGAGACGGGG - Intronic
966608850 3:181848322-181848344 TTACTTTTGTAGTCCAGGCTGGG - Intergenic
966760027 3:183409726-183409748 TGTATTTTGTAGTAGAGGCGAGG + Intronic
966791269 3:183672690-183672712 ATAATTTTTTAGTAGAGACGGGG - Intronic
967140109 3:186550411-186550433 TTGTATTTGTAGTAGAGGCTGGG - Intronic
967286175 3:187872730-187872752 CTAATTTTTTAATAGAGACAGGG + Intergenic
967477713 3:189940665-189940687 CTAGTTTTGTGTTAGAGTCTTGG + Intergenic
967931515 3:194693793-194693815 TTAAATTTTTAGTAGAGGCGAGG + Intergenic
968080332 3:195841949-195841971 CTAATTTTTTTGTAGAGACGGGG - Intergenic
968906125 4:3451637-3451659 CTAATTTTTTTGTAGAGACTGGG - Intergenic
969806208 4:9611008-9611030 CTAATTTTTTTGTAGAGACGGGG - Intergenic
969964449 4:10979497-10979519 CTTTTTTTGTAGTAAGGGCTTGG - Intergenic
970162641 4:13204775-13204797 GTGATTTTGTAATAGAGGCTGGG - Intergenic
970541394 4:17083497-17083519 GTATTTTTGTAGTAGAGACAGGG - Intergenic
970702391 4:18757669-18757691 CTAATTTTTTAGTAGAGACGGGG - Intergenic
970795419 4:19906883-19906905 GTATTTTTTTAGTAGAGACTGGG + Intergenic
970998980 4:22301292-22301314 CTAATTTTGTTCTATAGGCAAGG - Intergenic
971314523 4:25556296-25556318 TTATATTTGTAGTAGAGACTGGG + Intergenic
972435283 4:39027927-39027949 TTAATTTTTTAGTAGAGACAGGG + Intronic
972506812 4:39727531-39727553 CTAATTTTTTTGTAGAGACAGGG + Intronic
972591131 4:40488147-40488169 CTAATTTTGTAGTAGAGGCTGGG - Intronic
972648056 4:40988929-40988951 ATAATTTTTTAGTAGAGACGAGG + Intronic
972889938 4:43544893-43544915 CTAATTTTGTTCTAGAGACAAGG + Intergenic
973370662 4:49246071-49246093 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
973390366 4:49549363-49549385 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
973610365 4:52630570-52630592 CTAATTTTTTAGTAGAGACAGGG - Intronic
973694340 4:53475464-53475486 TTAATTTTGTATTTGAGGCAGGG + Intronic
974252563 4:59405608-59405630 CTGATTTTTTAGTAGAGACGGGG + Intergenic
974463088 4:62215255-62215277 GTGTTTTTGTAGTAGAGACTGGG + Intergenic
975440245 4:74401566-74401588 TTAATTTTTTTGTAGAGACTGGG + Intergenic
975799891 4:78049338-78049360 CTAATTTTTTTGTAGAGACAGGG + Intergenic
976004017 4:80406663-80406685 TTAAGTTTGTACTAGGGGCTGGG - Intronic
976406741 4:84667880-84667902 CTAATTTTTTAGTAGAGACGGGG + Intergenic
976712446 4:88086835-88086857 CTAATTTTTTTGTAGAGACAAGG - Intergenic
977629015 4:99220944-99220966 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
977638738 4:99331071-99331093 GTATTTTTTTAGTAGAGGCGTGG + Intergenic
977812246 4:101370480-101370502 TTTTTTTTTTAGTAGAGGCTGGG - Intergenic
979277622 4:118831199-118831221 CTATTTTTTTAGTAGAGACCGGG + Intronic
980123241 4:128749302-128749324 CTTATTTTTTAGTAGAGACAGGG - Intergenic
980427437 4:132644639-132644661 CTACTTTTGTAGTCTAGTCTAGG - Intergenic
980487216 4:133474197-133474219 GTATTTTTTTAGTAGAGACTGGG - Intergenic
980510624 4:133782239-133782261 CAAATTTTGTCTTAGAGACTGGG + Intergenic
980530260 4:134044100-134044122 CTAATTTTTTTGTAGAGACAGGG + Intergenic
980651046 4:135714704-135714726 CTATTTTTTTAGTAGAGACGGGG + Intergenic
980934784 4:139216407-139216429 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
981164810 4:141545237-141545259 CTAATTTTGTGGCAGTGGGTAGG - Intergenic
981927266 4:150153584-150153606 ATAATTTTTTAGTAGAGACGGGG + Intronic
981990754 4:150917752-150917774 GTATTTTTTTAGTAGAGGCAGGG - Intronic
982005326 4:151057862-151057884 CTAATTTTGTAGTAGAGACGGGG - Intergenic
982984407 4:162187654-162187676 CTATTTTTTTAGTAGAGACGGGG + Intergenic
983223221 4:165062698-165062720 TTTATTTTTTAGTAGAGACTGGG + Intergenic
983989625 4:174101759-174101781 TTAATTTTTTTGTAGAGGCAGGG - Intergenic
984179282 4:176462224-176462246 TTAATTTTTTAGTAGAGACAGGG - Intergenic
984818067 4:183856978-183857000 TAAATTGTGTGGTAGAGGCTGGG + Intronic
985259980 4:188106223-188106245 GTATTTTTGTAGTAGAGACGGGG + Intronic
986477122 5:8146036-8146058 GTAATTTTTTAGTAGAGACAGGG + Intergenic
987196270 5:15529560-15529582 GTATTTTTGTAGTAGAGACGGGG + Intronic
987603807 5:20107244-20107266 CTATTTTTTTAGTAGAGACACGG + Intronic
988089573 5:26519306-26519328 CTAATTTTTTTGTAGAGACTGGG - Intergenic
988119590 5:26943337-26943359 GTATTTTTTTAGTAGAGGCAGGG - Intronic
988325969 5:29768442-29768464 GTATTTTTTTAGTAGAGACTGGG - Intergenic
988714291 5:33809863-33809885 CCAATTCTTTAGTAGAGACTGGG + Intronic
988862947 5:35303750-35303772 CTTATTTTTTAGTAGAGACAGGG + Intergenic
989042772 5:37246733-37246755 TTATATTTTTAGTAGAGGCTAGG - Intronic
989049323 5:37303773-37303795 CTAATTTTTTTGTAGAGACGAGG - Intronic
989312276 5:40033958-40033980 CTAATTTTGGAGTCTAGACTAGG + Intergenic
990266960 5:54087160-54087182 CTAATTTTTTAGTAGCGACGGGG - Intronic
990921690 5:60974979-60975001 CTTATTTTTTAGTAGAGACGAGG + Intronic
991004495 5:61814175-61814197 CTAATTTTTTGGTAGAGACAGGG - Intergenic
991662775 5:68967361-68967383 ATAATTTTTTAGTAGAGACAGGG + Intergenic
991719152 5:69479631-69479653 CTAATTTTTTTGTAGAGACCGGG + Intergenic
992051074 5:72941540-72941562 GTATTTTTGTAGTAGAGACGGGG + Intergenic
992311354 5:75502863-75502885 CAAATTTTGTAGCAGGGGCTGGG + Intronic
992482044 5:77160822-77160844 CTTATTTTTTAATAGAGACTGGG + Intergenic
992581698 5:78184510-78184532 GTATTTTTTTAGTAGAGGCGGGG - Intronic
992665008 5:78999505-78999527 GTATTTTTTTAGTAGAGGCGGGG + Intronic
992861760 5:80918549-80918571 CTTATTTTTTAGTAGAGACGAGG + Intergenic
993161245 5:84294207-84294229 CTATTTTTTTAGTAGAGACGGGG - Intronic
994133126 5:96253921-96253943 AGCATTTTGTAGGAGAGGCTAGG + Intergenic
994473684 5:100240551-100240573 CTAATGTTGGAGGAGGGGCTTGG + Intergenic
995510469 5:112904002-112904024 CTAAATTTTTAGTAGAGACAAGG + Intronic
995643659 5:114286522-114286544 CTAATGTTTTAGTGTAGGCTGGG + Intergenic
996067912 5:119100254-119100276 TTTATTTTGTAGTAGAGACGGGG - Intronic
996275977 5:121666544-121666566 TTAAATTTGTTGTAGAGGCACGG - Intergenic
996294737 5:121898320-121898342 TTAATTTTTTTGTAGAGGCAGGG + Intergenic
996543888 5:124657485-124657507 TTTATTTTTTAGTAGAGACTGGG - Intronic
996739347 5:126784834-126784856 TTATATTTTTAGTAGAGGCTGGG + Intronic
997153871 5:131529736-131529758 CTAATTTTTTTGTAGAGACAAGG - Intronic
997313949 5:132916070-132916092 ATAATTTTTTAGTAGAGACAGGG - Intronic
997516949 5:134496668-134496690 CTAATTTTTTTGTAGAGACGGGG - Intergenic
997519961 5:134516735-134516757 TTTATTTTTTAGTAGAGGCGGGG - Intergenic
997559689 5:134835470-134835492 GTATTTTTTTAGTAGAGACTGGG - Intronic
997909913 5:137861558-137861580 CTAATTTTTTAGTAGAGACAGGG + Intergenic
997917667 5:137944591-137944613 CTAATTTTTTAGTAGAGACAGGG - Intronic
998217414 5:140247764-140247786 CTAATTTTTTTGTAGAGACAGGG - Intronic
998304982 5:141066302-141066324 CAAGTTTTGTAGTAGTGGCCAGG - Intergenic
998942390 5:147298705-147298727 CAAATTTTGTATTAGAGGAAAGG + Intronic
999857669 5:155612829-155612851 CAAATATTGTAGTAGGTGCTTGG - Intergenic
999905443 5:156136283-156136305 TTAATTTTTTTGTAGAGGCAGGG + Intronic
1000720552 5:164701055-164701077 TTAATTTTGTTGTAGAGACAGGG - Intergenic
1001033652 5:168281207-168281229 CTAATTTTTTAGTAGAGAAGGGG + Intergenic
1001201408 5:169720894-169720916 CTAATTTTTTAGTAGAGACGGGG + Intronic
1001283477 5:170405374-170405396 TTAATTTTTTAGTAGAGACAGGG + Intronic
1001417783 5:171559429-171559451 GTAATTTTTTAGTAGAGACGAGG + Intergenic
1001780919 5:174368395-174368417 CTATTTTTTTAGTAGAGACGAGG - Intergenic
1001797206 5:174512645-174512667 CTAATTTTGTAATTGGGGATGGG + Intergenic
1003335218 6:5164793-5164815 TTAAATTTTTAGTAGAGACTGGG - Intronic
1003575051 6:7285104-7285126 CTAATTGTGAACTAGAAGCTGGG + Exonic
1003788464 6:9514775-9514797 GTAATTTTTTAGTAGTGGCAGGG + Intergenic
1004226618 6:13790623-13790645 TTAATTTTTTAGTAGAGACGGGG + Exonic
1004239084 6:13902475-13902497 ATAAATCTGTAGTAGAGGGTGGG + Intergenic
1004545159 6:16591127-16591149 TTAATTTTTTAGTAGAGACAGGG + Intronic
1004587591 6:17016966-17016988 TTAAGTTTTTAGTAGAGGCTGGG + Intergenic
1005206021 6:23405528-23405550 TGAATTTTTTAGTAGAGGCGGGG - Intergenic
1005453371 6:25995230-25995252 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1005592484 6:27343358-27343380 GTAATTTTTTAGTAGAGACAGGG + Intergenic
1005669786 6:28093609-28093631 CTAAGTGTGTAGTAGAGGTTGGG - Intergenic
1005956063 6:30664309-30664331 CTAATTTTTTAGTAGAGATGGGG - Intronic
1006176103 6:32122672-32122694 CTATTTTTTTAGTAGAGACGGGG - Intronic
1006834939 6:36992258-36992280 CTAATTTTTTAGTAGAGACGGGG + Intergenic
1006850756 6:37096574-37096596 CTACTTTGGTAGTATAGGCCCGG - Intergenic
1007551115 6:42730237-42730259 CTAATTTTTTAGTAGAGACAGGG + Intergenic
1007643059 6:43358434-43358456 CTGATTTTTTAGTAGAGACAGGG + Intronic
1007658867 6:43469874-43469896 CTAATTTTTTAGTAGAGACAAGG - Intergenic
1007844920 6:44745982-44746004 TTAATTTTTTAGTAGAGACAGGG + Intergenic
1007962582 6:45973762-45973784 CTAATTTTTTAGTAGAGATGGGG - Intronic
1008528943 6:52436477-52436499 CTCTTATTCTAGTAGAGGCTTGG + Intronic
1009606317 6:65873184-65873206 CTAATTTTATAATAAAAGCTGGG + Intergenic
1009969702 6:70613866-70613888 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1009989026 6:70818219-70818241 GTAATTTTTTAGTAGAGACGGGG - Intronic
1010169800 6:72961441-72961463 CTATTTTTTTAGTAGAGACGGGG - Intronic
1010920949 6:81679981-81680003 TTAATTTTTTTGTAGAGACTGGG - Intronic
1010925595 6:81742286-81742308 CTATTTTTTTAGTAGAGACGGGG - Intronic
1011732159 6:90275801-90275823 CTAATTTTTTTGTAGAGACTGGG - Intronic
1011785894 6:90844804-90844826 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1011838099 6:91458679-91458701 TTAATCTTGCAGTAGAAGCTGGG + Intergenic
1012358174 6:98342378-98342400 TTAATTATGTAGTAGTGGCATGG + Intergenic
1012668507 6:102010557-102010579 TGTATTTTTTAGTAGAGGCTGGG + Intronic
1012925069 6:105259398-105259420 CTAATTTTTTAGTAGAGATGGGG + Intergenic
1013075705 6:106769374-106769396 TTAATTTTTTTGTAGAGACTGGG + Intergenic
1013820844 6:114152094-114152116 CGAATTTTTTAGTAGAGACGGGG + Intronic
1013974043 6:116056392-116056414 TTAATTTTTTTGTAGAGACTGGG + Intronic
1014442537 6:121490107-121490129 TTTATTTTTTAGTAGAGGCGGGG - Intergenic
1015515523 6:134079195-134079217 CTAATTTTGTAGTAGAGATGAGG - Intergenic
1015963201 6:138671282-138671304 CTAATTTTTTAGTAGAGACGGGG - Intronic
1016264512 6:142215262-142215284 GTAATTTTTTAGTAGAGACGGGG - Intronic
1016460402 6:144275395-144275417 TTTATTTTTTTGTAGAGGCTGGG - Intergenic
1016841695 6:148532240-148532262 CTAATTTTGTTGTAGAGACGGGG + Intronic
1017108913 6:150913953-150913975 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1017165737 6:151406985-151407007 CTAATTTTTTTGTAGAGACAGGG - Intronic
1017308528 6:152949608-152949630 CTAATTTTTTTGTAGAGACAGGG + Intergenic
1017802577 6:157910945-157910967 CTAATTTTTTAGTAGAGACAGGG - Intronic
1017832700 6:158145693-158145715 CTATTTTTTTAGTAGAGACAGGG + Intronic
1017935766 6:159003492-159003514 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1018256896 6:161929687-161929709 CTAATTTTTTAGTAGAAACGGGG + Intronic
1018781177 6:167067101-167067123 CTGAATTTGTAGTAGAGACAGGG + Intergenic
1020063724 7:5171476-5171498 AAAATTTTTTTGTAGAGGCTGGG - Intergenic
1020075462 7:5255146-5255168 GTATTTTTGTAGTAGAGACAGGG + Intergenic
1020089201 7:5328682-5328704 GTATTTTTTTAGTAGAGGCGGGG + Intronic
1020135867 7:5587558-5587580 TTAATTTTTTGGTAGAGGCAGGG - Intergenic
1020421738 7:8014161-8014183 TTAATTTTTTAGTAGAGACGGGG + Intronic
1020457950 7:8395525-8395547 TTAATTTTGTTGTAGAGACGGGG + Intergenic
1021488873 7:21196885-21196907 TTAATTTTTTAGTAGAGACGGGG + Intergenic
1021764398 7:23932310-23932332 CTAATTTTGCAGTAGTGGTGAGG - Intergenic
1022538798 7:31116316-31116338 CTAACTATGTGGTAGAGGCATGG + Intergenic
1022644872 7:32220639-32220661 ATATTTTTTTAGTAGAGGCGGGG - Intronic
1023074773 7:36472047-36472069 GTATTTTTTTAGTAGAGACTTGG + Intergenic
1023313830 7:38915093-38915115 GTATTTTTGTAGTAGAGACGGGG - Intronic
1023324939 7:39043927-39043949 ATAATTTTGTACTTGAGCCTGGG - Intronic
1024746818 7:52416991-52417013 GTATTTTTTTAGTAGAGGCGGGG - Intergenic
1025114380 7:56245282-56245304 TTACATTTGTAGTAGAGGCAGGG - Intergenic
1025203614 7:56978416-56978438 GTATTTTTGTAGTAGAGACGGGG - Intergenic
1025668328 7:63598512-63598534 GTATTTTTGTAGTAGAGACGGGG + Intergenic
1025730632 7:64103690-64103712 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1025788923 7:64669619-64669641 CTAATTTTTCAGTAGAGACGGGG - Intronic
1025929669 7:65983512-65983534 CTAATTTTTTAGTAGAGATGGGG - Intergenic
1026344550 7:69462840-69462862 GTAATTTTTTAGTAGAGACAGGG - Intergenic
1026351794 7:69523320-69523342 CTAATTTTTTAGTAGAGACAGGG + Intergenic
1026701667 7:72652200-72652222 TTATTTTTTTAGTAGAGGCGGGG - Intronic
1026816282 7:73514905-73514927 CTAGTTTTTTAGTAGAGACAGGG - Intronic
1026836637 7:73644068-73644090 CTAATTTTTTTGTAGAGACAGGG + Intergenic
1026844094 7:73687866-73687888 CTGGCTTTTTAGTAGAGGCTGGG - Intronic
1026910535 7:74089334-74089356 CTAATTTTTTTGTAGAGACAAGG - Intronic
1027127347 7:75566192-75566214 CTAATTTTTTAGTAGAGACGGGG + Intronic
1027336495 7:77156092-77156114 CTGATTCTGTAATAGAGACTTGG + Intronic
1027384427 7:77646238-77646260 GTAATTTTTTAGTAGAGACAGGG + Intergenic
1027427155 7:78072831-78072853 CTAATTTTTTTGTAGAGACAAGG + Intronic
1027614827 7:80409035-80409057 CTAATTTTTTTGTACAGACTGGG - Intronic
1027643131 7:80762645-80762667 CTAATTTTGTAGTAGAGACAGGG - Intronic
1028020872 7:85769392-85769414 CTAATTTTTTTGTAGAGACAGGG + Intergenic
1028168001 7:87561811-87561833 TTAATTTTTTTGTAGAGGCGGGG - Intronic
1028548810 7:92033608-92033630 CTAATTTTTTTGTAGAGACAGGG + Intronic
1028570819 7:92285044-92285066 TAAATCTTGGAGTAGAGGCTAGG + Intronic
1028843273 7:95451819-95451841 CTAATTTTGTGATAGAGACGGGG + Intergenic
1029117295 7:98243888-98243910 TTAAATTTTTTGTAGAGGCTGGG - Intronic
1029384226 7:100233147-100233169 GTAATTTTTTAGTAGAGACGGGG + Intronic
1029569641 7:101361121-101361143 CTATTTTTTTAGTAGAGACAGGG + Intergenic
1029779294 7:102715009-102715031 CTGATTCTGTAATAGAGACTTGG - Intergenic
1029838097 7:103334387-103334409 CGTATTTTTTAGTAGAGACTGGG - Intronic
1030456867 7:109785740-109785762 TTATTTTTGTAGTAGAGACAGGG + Intergenic
1030855221 7:114547581-114547603 GTAATTTTTTAGTAGAGACGGGG - Intronic
1030894123 7:115036237-115036259 CTATTTGTGTAGTACAGTCTGGG + Intergenic
1032031210 7:128485358-128485380 CTAATTTTTTTGTAGAGACGGGG - Intronic
1032243776 7:130189359-130189381 CTAATTTTTTAGTAGAGGTGGGG + Intronic
1032553262 7:132805479-132805501 CTCAGGTTGTAGTAGAGGGTTGG + Intronic
1033307238 7:140233856-140233878 CTAATTTTGTTTTAGAGGTGGGG + Intergenic
1034486989 7:151372001-151372023 ATAATTATGTATTAAAGGCTGGG - Intronic
1034605233 7:152306984-152307006 TTAAATTTTTTGTAGAGGCTAGG - Intronic
1034617411 7:152430695-152430717 CTAATTTTTTTGTAGAGACAAGG + Intronic
1034815623 7:154169894-154169916 CTAATTTTTTAGTAGAGATAGGG + Intronic
1035012873 7:155735530-155735552 CTAGTTTTTTTGTAGAGGCAGGG - Intronic
1035820124 8:2582051-2582073 CTAAAATTGTAGTAATGGCTTGG + Intergenic
1035899076 8:3437911-3437933 CTAATTCTTTAGTAGAGACAGGG + Intronic
1036069523 8:5425313-5425335 CAAATTTTGAAGTAGGAGCTTGG - Intergenic
1036464503 8:8984012-8984034 GTAATTTTTTAGTAGAGGTGGGG + Intergenic
1036650441 8:10638970-10638992 TTTATTTTTTAGTAGAGCCTGGG - Intronic
1037325228 8:17682341-17682363 GTAATTTTCTAGTAGAGACAGGG - Intronic
1037345945 8:17901383-17901405 CTAATTTTGTAGTAGGAGAATGG - Intronic
1038119238 8:24593634-24593656 CTAATTCTGCAGTATAGGGTAGG - Intergenic
1038208790 8:25495592-25495614 TTTATTTTTTAGTAGAGACTGGG + Intronic
1038565431 8:28616449-28616471 ATACTTTTTTAGTAGAGGCGGGG - Intronic
1038758328 8:30362712-30362734 CTCATCTTGAAGCAGAGGCTTGG - Intergenic
1039615484 8:38951920-38951942 TTAATTTTTTTGTAGAGACTGGG + Intronic
1039617845 8:38970622-38970644 CATATTTTTTAGTAGAGGCGGGG - Exonic
1040780811 8:51107378-51107400 ATATTTAAGTAGTAGAGGCTGGG + Intergenic
1041040130 8:53838289-53838311 CTAATTTTTTAGTAGAGATGAGG + Intronic
1041109087 8:54468521-54468543 CTTATTTTTTAGTAGAGACGTGG + Intergenic
1041606637 8:59789391-59789413 GTAATTTTTTAGTAGAGACGGGG + Intergenic
1041982867 8:63882854-63882876 CTATATTTTTAGTAGAGGCGGGG + Intergenic
1042286683 8:67120744-67120766 ATAATTTTGTTGTAGAATCTAGG + Intronic
1042604321 8:70530470-70530492 CTACTTTTGTAAGAGATGCTGGG + Intergenic
1042965430 8:74346890-74346912 CTAATTTTTTAGTAGAGACAGGG + Intronic
1043546490 8:81321391-81321413 CAAATTTGGAAGTTGAGGCTTGG + Intergenic
1043683010 8:83054771-83054793 ATATTTTTTTAGTAGAGACTGGG + Intergenic
1044585161 8:93862857-93862879 CGTATTTTGTGGTAGAGGCAGGG - Intronic
1044986835 8:97763308-97763330 CTATTTTTTTTGTAGAGACTAGG + Intergenic
1045218454 8:100173202-100173224 CTAATTTTTTTGTAGAGACAGGG + Intronic
1045383979 8:101653575-101653597 CTAATTTTCTGGTAGAGACAGGG - Intronic
1045483198 8:102609407-102609429 CTATTTTTGTAGTAGAGACGGGG + Intergenic
1045592356 8:103612742-103612764 CTGATTTTTTAGTAGAGACAGGG + Intronic
1045787235 8:105936108-105936130 TTAAATTTTTTGTAGAGGCTGGG - Intergenic
1046165174 8:110424393-110424415 CTAATTTTTTTGTAGAGACGTGG - Intergenic
1046899460 8:119508499-119508521 CTAATTTTTTTGTAGAGACAGGG - Intergenic
1046912610 8:119645647-119645669 CTAATTTTGTATTAGAGATGGGG - Intronic
1046991931 8:120467440-120467462 CTATTGTTTTAGTAGAGGCGGGG - Intronic
1047261378 8:123263657-123263679 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1047803302 8:128332290-128332312 ATGATTTTTTAGTAGAGGATAGG + Intergenic
1047997991 8:130355049-130355071 CTAATTTTTTAGTAGAGATGGGG + Intronic
1048397794 8:134031255-134031277 CTAATTTTTTGGTAGAGACAGGG + Intergenic
1050054991 9:1642902-1642924 CTAATTTTTTTGTAGAGATTGGG + Intergenic
1050440256 9:5654419-5654441 GTAATTTTTTAGTAGAGACGGGG + Intronic
1051056108 9:12988590-12988612 CGAATTTTATAGCACAGGCTTGG + Intergenic
1052754843 9:32530064-32530086 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1052907136 9:33845420-33845442 CTATTTTTTTAGTAGAGACGGGG + Intronic
1052993243 9:34534829-34534851 TTAAATTTTTAGTAGAGGCAGGG + Intergenic
1053400159 9:37812012-37812034 CTAATTTTTTTGTAGAGTCAGGG - Intronic
1053504307 9:38628212-38628234 GTATTTTTTTAGTAGAGGCGGGG + Intergenic
1054354263 9:64046305-64046327 CTAATTCTGGAGTAGGGACTAGG + Intergenic
1054979927 9:71194131-71194153 CTAATTTAGTAGAAAAGGGTGGG - Intronic
1056607172 9:88095718-88095740 CTAATTTTTTAGTAGACACAGGG - Intergenic
1056647673 9:88429037-88429059 CTAATTTTTTTGTAGAGACAGGG + Intronic
1057357484 9:94343931-94343953 GTAATTTTTTAGTAGAGACAGGG - Intergenic
1057731310 9:97611261-97611283 CTAATTTTTTTGTAGAGACGGGG - Intronic
1058225677 9:102359146-102359168 GTATTTTTCTAGTAGAGACTGGG - Intergenic
1058540359 9:106005833-106005855 TGTATTTTTTAGTAGAGGCTGGG - Intergenic
1058998000 9:110318560-110318582 GTATTTTTGTAGTAGAGACAGGG - Intronic
1059095641 9:111410689-111410711 TTTATTTTTTTGTAGAGGCTAGG + Intronic
1059227449 9:112685261-112685283 TTAATTTTTTAGTAGAGACAGGG + Exonic
1059417764 9:114172508-114172530 ATAAAGCTGTAGTAGAGGCTGGG + Intronic
1059677870 9:116557045-116557067 GTATTTTTTTAGTAGAGGCGGGG - Intronic
1059927837 9:119229385-119229407 GTAAGTTAGTAATAGAGGCTCGG + Intronic
1060286274 9:122255831-122255853 CTAATTTTTTTGTAGAGACGAGG - Intronic
1060589694 9:124808981-124809003 TTAATTTTTTAGTAGAGACGGGG - Intronic
1060650626 9:125323477-125323499 TTATATTTTTAGTAGAGGCTGGG + Intronic
1060944817 9:127563686-127563708 CTAATTTTTTAGTAGAGACGTGG + Intronic
1061000864 9:127901757-127901779 GTATTTTTTTAGTAGAGACTGGG - Intronic
1061066917 9:128284121-128284143 CTAATTTTTTAGTAGAGATGGGG - Intronic
1061689099 9:132310317-132310339 ATAATTTTGTACAATAGGCTTGG + Intronic
1203695072 Un_GL000214v1:90898-90920 CTAATTCTGGAGTAGGGGCTAGG - Intergenic
1203742596 Un_GL000218v1:15424-15446 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
1203567502 Un_KI270744v1:104001-104023 CTAATTCTGGAGTAGGGACTAGG - Intergenic
1203641201 Un_KI270751v1:13165-13187 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
1185518304 X:717298-717320 GTATTTTTTTAGTAGAGACTGGG - Intergenic
1185595501 X:1304232-1304254 CTAATTTTTTAGTAGAGACGGGG - Intronic
1186482472 X:9906620-9906642 CTAATATTTTAGTAGAGACGGGG - Intronic
1186633134 X:11372596-11372618 CTATATTTTTAGTAGAGGCAGGG - Intronic
1186959548 X:14720958-14720980 CTAATTTTTTTGTAGAGGTGGGG - Intronic
1187315496 X:18189872-18189894 GTATTTTTTTAGTAGAGACTGGG - Intronic
1187647251 X:21361644-21361666 CTAATTGTTTTGTAGAGGCAGGG - Intergenic
1187655063 X:21462877-21462899 CTAATTTTTTAGTAGAGATGGGG + Intronic
1187855128 X:23629317-23629339 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1187899698 X:24016172-24016194 CTAATTTTTTAGTAGAGACGGGG - Intronic
1187937412 X:24349369-24349391 CTATTTTTTTAGTAGAGACGGGG + Intergenic
1188402129 X:29758519-29758541 GTAATTTTTTAGTAGAGACGGGG - Intronic
1188517757 X:31005542-31005564 GTAATTTTTTAGTAGAGACGGGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189386596 X:40541926-40541948 TTAATTTTGTAATAGAGGCAGGG + Intergenic
1189533060 X:41907132-41907154 ATAGTTTAGTAGTAGATGCTGGG - Intronic
1189671442 X:43414566-43414588 TTAATTTTTTTGTAGAGACTGGG - Intergenic
1189888440 X:45574303-45574325 TTAATTTTTTTGTAGAGACTGGG + Intergenic
1189903191 X:45729607-45729629 GTAATTTTTTAGTAGAGACGGGG - Intergenic
1189976747 X:46468360-46468382 CTAATTTTTTAGTATAGACGGGG - Intronic
1190253556 X:48745798-48745820 GTATTTTTTTAGTAGAGACTGGG + Intergenic
1190329959 X:49229822-49229844 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1190661454 X:52658025-52658047 GTATTTTTGTAGTAGAGACAGGG - Intronic
1190822467 X:53986405-53986427 CTAATTTTTTAGCAGAGACAGGG + Intronic
1190982776 X:55471275-55471297 GTAGTTTTGTAGTAGAGACAGGG + Intergenic
1190985923 X:55501908-55501930 GTAGTTTTGTAGTAGAGACAGGG - Intergenic
1192003510 X:67183084-67183106 ATATTTTTGTAGTAGAGACGGGG + Intergenic
1192461854 X:71323804-71323826 CTAATTTTTTTGTAGAGACATGG + Intergenic
1193152918 X:78143198-78143220 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1195263670 X:103159594-103159616 CTAATTTTTTTGTAGAGACGGGG - Intergenic
1195902059 X:109809449-109809471 CTAATTTTCTAGTAGAGATGGGG - Intergenic
1196835601 X:119811214-119811236 CTATTTTTTTAGTAGAGGTGGGG + Intergenic
1197066061 X:122235788-122235810 CTGATCTTGTAGTGGTGGCTTGG + Intergenic
1197610051 X:128628103-128628125 CTAATTTTTTAGTAGAGACGGGG - Intergenic
1197928843 X:131675384-131675406 TTGAATTTGTAGTAGAGACTGGG + Intergenic
1198013068 X:132579421-132579443 CTCTTTTTGTTGGAGAGGCTAGG - Intergenic
1199021525 X:142883987-142884009 TTAATTTTTTTGTAGAGTCTGGG - Intergenic
1200020150 X:153196603-153196625 GTAATTTTTTAGTAGAGACGGGG - Intergenic
1200783555 Y:7238441-7238463 CAAATTTTGTAGTAGAGATAGGG - Intergenic
1201156127 Y:11132897-11132919 CTAATTCTGGAGTAGGGGCTAGG + Intergenic
1201671033 Y:16520412-16520434 CTTATTTTTTAGTAGAGACAAGG - Intergenic
1201733741 Y:17234790-17234812 CTATATTTTTAGTAGAGACTGGG + Intergenic