ID: 972593635

View in Genome Browser
Species Human (GRCh38)
Location 4:40511191-40511213
Sequence GCCGCCAGAATCACCTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972593634_972593635 3 Left 972593634 4:40511165-40511187 CCTACGCATGTGACTTTTCTGGC 0: 1
1: 0
2: 0
3: 10
4: 91
Right 972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
972593631_972593635 26 Left 972593631 4:40511142-40511164 CCGTGTAGTTCTGACTCCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 73
Right 972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
972593630_972593635 27 Left 972593630 4:40511141-40511163 CCCGTGTAGTTCTGACTCCGAGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
972593632_972593635 10 Left 972593632 4:40511158-40511180 CCGAGCTCCTACGCATGTGACTT 0: 1
1: 0
2: 1
3: 7
4: 128
Right 972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972593635 Original CRISPR GCCGCCAGAATCACCTTGAA AGG Intronic
900014875 1:141156-141178 GCCTCCATAAACACCCTGAAAGG + Intergenic
900045141 1:499765-499787 GCCTCCATAAACACCCTGAAAGG + Intergenic
900067338 1:741495-741517 GCCTCCATAAACACCCTGAAAGG + Intergenic
908189211 1:61684085-61684107 CCTGCCAGAACCACCTGGAATGG + Intronic
912493676 1:110077495-110077517 GCCTCCAGGATGACCTTCAAGGG - Intergenic
913284144 1:117211748-117211770 GCCCCCAGAAGTACCTTGGATGG + Intergenic
922101946 1:222484269-222484291 GCCTCCATAAACACCCTGAACGG + Intergenic
922263026 1:223959391-223959413 GCCTCCATAAACACCCTGAAAGG + Intergenic
923405364 1:233654005-233654027 TTCACCAGAATCACCTTTAAAGG - Intronic
924344865 1:243064392-243064414 GCCTCCATAAACACCCTGAAAGG + Intergenic
1066601658 10:37114668-37114690 ACTGACAGAATGACCTTGAAGGG - Intergenic
1066731468 10:38440683-38440705 GCCTCCATAAACACCCTGAACGG - Intergenic
1072419868 10:95281167-95281189 TCCTCCAGAAACACCTTCAAGGG + Intronic
1075133776 10:119764114-119764136 CTCACCAGAATCACCTTTAAAGG + Intronic
1076971470 11:136256-136278 GCCTCCATAAACACCCTGAAAGG + Intergenic
1077578844 11:3404303-3404325 GTCCTCAGAGTCACCTTGAAAGG - Intergenic
1078679031 11:13458013-13458035 ACCGCCACACTCAGCTTGAATGG - Intronic
1081667902 11:44927215-44927237 GGCCCCAGAGTCCCCTTGAAAGG + Intronic
1082262242 11:50085578-50085600 GCCTCCATAAACACCCTGAATGG + Intergenic
1083214700 11:61211082-61211104 GCCCTCAGCATCACCATGAACGG + Exonic
1083217584 11:61229911-61229933 GCCCTCAGCATCACCATGAACGG + Exonic
1087276439 11:96165241-96165263 AGCATCAGAATCACCTTGAAAGG + Intronic
1092171303 12:6375461-6375483 GCTGCCAGATTCAACTGGAAAGG - Intronic
1094026007 12:25959728-25959750 GCCGGAAGATTCAACTTGAAGGG + Intronic
1096404038 12:51329819-51329841 GCCCCCAGAGTCACCCTGCAGGG + Exonic
1100139819 12:91603734-91603756 GAAGCCAGAATCTCCTTCAAAGG + Intergenic
1104420411 12:128630152-128630174 GCCGCCTGAGACACCTTGGAGGG - Intronic
1113014393 13:105811292-105811314 GCCGCCAGCATCTCCTTGACGGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1123099367 14:105785860-105785882 GCAGCCTAAATCAGCTTGAAGGG + Intergenic
1136717435 16:32293486-32293508 ACTGACAGAATGACCTTGAAGGG - Intergenic
1136835809 16:33499749-33499771 GCTGACAGAATGACCTTGAAGGG - Intergenic
1140545737 16:75806707-75806729 GCCGGCAGGAACATCTTGAAAGG + Intergenic
1140967564 16:79981570-79981592 GCTGCCAGAAAAATCTTGAAGGG - Intergenic
1203008994 16_KI270728v1_random:224288-224310 GCTGACAGAATGACCTTGAAGGG + Intergenic
1203145987 16_KI270728v1_random:1800084-1800106 ACTGACAGAATGACCTTGAAGGG - Intergenic
1142458706 17:74023-74045 GCCTCCATAAACACCCTGAAAGG + Intergenic
1144830501 17:18128423-18128445 GCCCCCAGGATCACCTTGCTGGG - Intronic
1147262780 17:39218234-39218256 ACCGCCAGAGACACCCTGAAGGG - Intronic
1151130381 17:71890572-71890594 TTCACCAGAATCACCTTAAATGG + Intergenic
1151513418 17:74576912-74576934 GCGGGCAAAATCACCTTGAGTGG + Intergenic
1156755347 18:40517098-40517120 GCTGCCAAAATCACTTGGAATGG - Intergenic
1156803815 18:41151810-41151832 GAAGCCAGAAACTCCTTGAAAGG - Intergenic
1157916033 18:51664678-51664700 GGCGCCAGAATCACCAGGGAGGG - Intergenic
1160558107 18:79739244-79739266 GCCGCCAGCAACACCCTGACTGG - Intronic
1160648424 19:206536-206558 GCCTCCATAAACACCCTGAAAGG + Intergenic
1165672551 19:37692000-37692022 GCAGCCAGAATCCCCTCGGATGG + Intronic
1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG + Exonic
926731451 2:16038794-16038816 GCCGCCAGAAACAGCTGGAACGG - Intergenic
932281518 2:70496942-70496964 ACTGCCAGAATCACCATGCAGGG + Intronic
935058245 2:99586311-99586333 AGCGCCGGAATCACCTTGAAAGG - Intronic
937011122 2:118563645-118563667 GCAGTCAGAGTCACCTGGAAGGG + Intergenic
939952868 2:148496221-148496243 AGCACCAGAATCTCCTTGAAAGG + Intronic
940255220 2:151721334-151721356 GCCGGCAGCAGGACCTTGAAAGG - Intronic
945447310 2:209953524-209953546 GGTGCCAGAAACACCTTGAAGGG - Intronic
946228626 2:218278175-218278197 GGCGCCAGAAACACCTGGATTGG + Intronic
946756525 2:222953098-222953120 GCCCCCAGAATAACCATAAATGG - Intergenic
1170892301 20:20386479-20386501 GCCACAAGAACCACCTTGAGTGG - Intergenic
1172779202 20:37425812-37425834 GGCTCCAGAATCACCCTGTAAGG + Intergenic
1173439113 20:43059664-43059686 CTCACCAGAATCACCTTTAAAGG + Intronic
1175353611 20:58344544-58344566 GCTGCCAGAGACACCTTGGAAGG - Intronic
1177022643 21:15882497-15882519 TCAGCCAGCATCACATTGAATGG - Intergenic
950446436 3:13041554-13041576 GTCGCCATGGTCACCTTGAACGG - Intronic
953200018 3:40770188-40770210 TGCGTCAGAATCACCTGGAAGGG - Intergenic
968369424 3:198213579-198213601 GCCTCCATAAACACCCTGAAAGG - Intergenic
969470002 4:7382083-7382105 GCCTCCAGAAGGACCTTGAAGGG + Intronic
970817557 4:20176023-20176045 GCTGCCACAATCACCAGGAAGGG + Intergenic
972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG + Intronic
979257850 4:118623293-118623315 GCCTCCATAAACACCCTGAACGG - Intergenic
979330499 4:119417269-119417291 GCCTCCATAAACACCCTGAACGG + Intergenic
982084661 4:151821921-151821943 GCCTCCAGATCCACCTGGAAAGG - Intergenic
991335458 5:65541700-65541722 CCCACCAGAATCGCCTTTAAAGG + Intronic
993865848 5:93194334-93194356 GCTGCCTGACTCACCTTTAAAGG + Intergenic
1000786719 5:165553960-165553982 GCCGACAGAAACAGATTGAAAGG + Intergenic
1002728703 5:181319164-181319186 GCCTCCATAAACACCCTGAAAGG - Intergenic
1002785914 6:400045-400067 GCCCCGAGAATCACCTCGAATGG + Intronic
1003171096 6:3722809-3722831 GCTGCCATAATGAACTTGAAAGG - Exonic
1005823711 6:29619127-29619149 TCCGTCAGAACCACCTGGAAAGG - Intronic
1007076400 6:39069693-39069715 CTCACCAGAATCACCTTGTATGG + Intronic
1007720501 6:43882377-43882399 CCCTCCAGAATCACCTCCAAGGG - Intergenic
1009497924 6:64373988-64374010 GCAGCTAGAAGCACCTGGAAGGG - Intronic
1018714379 6:166520705-166520727 CTCACCAGAATCACATTGAAAGG - Intronic
1019168028 6:170111985-170112007 GGTGCCAGATTCACCTGGAATGG + Intergenic
1020548837 7:9572193-9572215 CCCTCCAGAATAACTTTGAAGGG - Intergenic
1022459219 7:30588078-30588100 GCCCCAAGAGGCACCTTGAAGGG + Intergenic
1023056239 7:36292154-36292176 GCCGCCAGAAGCGCCTGGCACGG - Intronic
1023399839 7:39784579-39784601 GCCTCCATAAACACCCTGAATGG - Intergenic
1024325736 7:48107913-48107935 GCTGCAAGCACCACCTTGAAAGG - Intronic
1025184401 7:56846033-56846055 GCCTCCATAAACACCCTGAATGG + Intergenic
1025687526 7:63730935-63730957 GCCTCCATAAACACCCTGAATGG - Intergenic
1031891299 7:127295997-127296019 GAAGCCATAATCACCATGAAAGG + Intergenic
1033582914 7:142752860-142752882 GCCACCAGAATCACCCTGGGGGG - Exonic
1033585940 7:142774348-142774370 GCCACCAGAATCACCCTGGGGGG - Intergenic
1034715394 7:153236875-153236897 GCTGCCAGAAACACCCTGAAGGG - Intergenic
1035082715 7:156231221-156231243 GCAGCTAAAATCACCTTGATTGG - Intergenic
1035545173 8:475395-475417 ACAGCCAAAATCATCTTGAAAGG - Intergenic
1038759667 8:30374919-30374941 TTCTCCAGAATCACCTTTAATGG + Intergenic
1047071307 8:121346948-121346970 GCCTCCAGACTCAGCTTGAGTGG + Intergenic
1047934187 8:129760716-129760738 GCCTTCTGAATCACTTTGAAAGG + Intronic
1057038992 9:91833809-91833831 GCTGCAAGACTCAGCTTGAAGGG + Intronic
1060558259 9:124521362-124521384 GGAGCCAGAAGCACCTGGAAGGG - Exonic
1062512400 9:136914061-136914083 CCTGCCAGCATCACCATGAAGGG - Intronic
1062753763 9:138276263-138276285 GCCTCCATAAACACCCTGAAAGG - Intergenic
1203576279 Un_KI270745v1:11042-11064 GCCTCCATAAACACCCTGAAAGG - Intergenic
1194634677 X:96330327-96330349 GCAGCCAGACTCAGCCTGAAGGG - Intergenic