ID: 972594303

View in Genome Browser
Species Human (GRCh38)
Location 4:40516558-40516580
Sequence AAGGAGAAATAGAATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 922
Summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 831}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972594303_972594306 17 Left 972594303 4:40516558-40516580 CCCTCATCATTCTATTTCTCCTT 0: 1
1: 0
2: 7
3: 83
4: 831
Right 972594306 4:40516598-40516620 ATATCACACAACCCAGTGCATGG 0: 1
1: 0
2: 1
3: 7
4: 128
972594303_972594307 27 Left 972594303 4:40516558-40516580 CCCTCATCATTCTATTTCTCCTT 0: 1
1: 0
2: 7
3: 83
4: 831
Right 972594307 4:40516608-40516630 ACCCAGTGCATGGTTTACACAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972594303 Original CRISPR AAGGAGAAATAGAATGATGA GGG (reversed) Intronic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900993517 1:6108529-6108551 ACGGAGAGATGGAAGGATGAAGG + Intronic
901001374 1:6150548-6150570 ATGGACAAATGGATTGATGATGG + Intronic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903683432 1:25113090-25113112 AAGGAGAAAGAAAAGGATAAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905002112 1:34680669-34680691 CAGGAGGAATAGAAAGATGGGGG + Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905320741 1:37115310-37115332 GAGGAGAAATGGAAGGATTATGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905929752 1:41778809-41778831 AAGGAGATGGAGCATGATGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906485811 1:46234007-46234029 GAGGAGAACTGGAAAGATGATGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907044133 1:51289365-51289387 AAGGAGGGATAGAATGAGAAGGG - Intronic
907536883 1:55170202-55170224 AAGAAAAAATAGAAAGCTGAAGG + Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908339198 1:63159045-63159067 AATGTTAAATGGAATGATGAAGG + Intergenic
908345093 1:63224563-63224585 AAAGAGAAAGAGAATAATTAAGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908530380 1:65028245-65028267 AAGGAGAATAAGAATTGTGAGGG - Intergenic
908563074 1:65326452-65326474 AGGAAGAAATAGAATGATAAAGG + Intronic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909332618 1:74432431-74432453 AGAGAGAAATAGAAGGGTGACGG - Intronic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
910324108 1:85984677-85984699 AAGCAGAAATAGAAGTATGAAGG - Intronic
910348141 1:86264429-86264451 AAGCATAAATAGAATTTTGATGG - Intergenic
910623378 1:89280432-89280454 AATGAGAAATAGAATGAAACAGG - Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910985907 1:93004284-93004306 AAAGAGAAATAGGAGGAAGATGG - Intergenic
911389358 1:97219633-97219655 GAGGAGAATTAAAATTATGAAGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
913120197 1:115732977-115732999 AAGGGGAAAAATAAAGATGAAGG + Intronic
913211601 1:116587365-116587387 AAGGAAATCTAGAGTGATGAGGG + Intronic
913427502 1:118750263-118750285 AAGCAGGATTAGAATGGTGAAGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914256658 1:145965457-145965479 AAGGAGAACTGGAATGGTGAGGG + Intronic
915691940 1:157698633-157698655 AACAGGAAATAGAAAGATGAAGG + Intronic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
916007317 1:160674398-160674420 AATGAGAGATGGAAAGATGATGG + Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916374380 1:164136260-164136282 AGGGAGAAATAGGGAGATGATGG + Intergenic
916894276 1:169145757-169145779 AACAAGAAATAGAATTATGGAGG + Intronic
916952227 1:169792315-169792337 AAGGTCAAATAGAATGAAGATGG + Intronic
917518407 1:175727895-175727917 AAGGAGAAATAAAATTGTGGAGG + Intronic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919798089 1:201333303-201333325 AAAGAGAAATTCAAAGATGAAGG + Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920447392 1:206029043-206029065 GAGGTGAAATAGTATGATGTGGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
921633751 1:217466791-217466813 AAGGAGAAAAAGAAAGGTAAAGG + Intronic
922114526 1:222599051-222599073 GAAGAGAGAAAGAATGATGATGG - Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922395457 1:225195877-225195899 AAGGATATGTAGAATGATGGTGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923340175 1:233000231-233000253 GAGAAGAAATAGAATGGTGGTGG - Intronic
923430511 1:233915581-233915603 AAAAAGGAATAGAATGATGATGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924393248 1:243586893-243586915 AAAAAGAAATGGAATAATGAAGG + Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063181164 10:3601696-3601718 ACACAGAAATAGAATGAGGAAGG + Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1064168487 10:13007151-13007173 AATGAGAAATATATTAATGAAGG - Intronic
1065031196 10:21587728-21587750 AGGGAAAAATAGAATGATTTTGG + Intronic
1065323095 10:24526846-24526868 AAGGAGGGTTAGAATGGTGAAGG + Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065712391 10:28531395-28531417 ATGGAGAGATGGAATGATGTAGG - Intergenic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1066533181 10:36362708-36362730 AAGGAAAAATAAAAGGGTGACGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1068139873 10:52992202-52992224 GATGAGAAATAGGATGATGAGGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068324996 10:55473353-55473375 AAGAAGAAAAAGAATGATTTAGG - Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1068950468 10:62771410-62771432 AAGAAGAAATCAAATTATGAGGG - Intergenic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1071089216 10:81899462-81899484 AAAGAGAAATGGAATCATGATGG - Intronic
1071278155 10:84075474-84075496 AAGGAGCAAAAGAATGCTTACGG + Intergenic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1073234880 10:102005548-102005570 AAGGAGAGAAAGAATAAAGAAGG + Intronic
1073265650 10:102226841-102226863 AAGCAGAAATAAGAGGATGAGGG + Intronic
1073354260 10:102841305-102841327 AAGGAGGAATAGAAGAATAAGGG + Intergenic
1074453133 10:113575581-113575603 GAGGAGAAAAACACTGATGAGGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1078865369 11:15292433-15292455 AAAAAGAAATAGAATCATGTAGG - Intergenic
1079733484 11:23965239-23965261 AAGGTAAAATAGAATCTTGAGGG + Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080053922 11:27885500-27885522 TCGGGGAAATAGAATGATGAAGG + Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080415223 11:32063686-32063708 ATGGAGGAATGGAAGGATGAAGG - Intronic
1080784460 11:35462242-35462264 AATGACAAATAGAGTAATGATGG - Intronic
1081007657 11:37767060-37767082 GAGGAGAAAGAGAAATATGAAGG + Intergenic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1082141029 11:48609845-48609867 GAGGAGAAATAGTATCATCAGGG + Intergenic
1082245103 11:49912335-49912357 AAGGAGAAATTAAATGCTGCTGG + Intergenic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082568183 11:54706667-54706689 GAGGAGAAATAGAATCATCAGGG + Intergenic
1082612481 11:55318343-55318365 GAGGAGAAATAGAATTGTCAAGG + Intergenic
1082618174 11:55388311-55388333 GAGGAGTAATAGAATCATCAAGG + Intergenic
1082621601 11:55430253-55430275 GAGGAGAAATAGAATTGTCAAGG + Intergenic
1082690076 11:56290964-56290986 CAGGAGAAATAGTATAAAGAGGG + Exonic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084762422 11:71282553-71282575 AAGGTGCAATTGAATGAAGAGGG - Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085371450 11:76010444-76010466 AAGGAGAAATATAAAATTGAGGG + Intronic
1085665699 11:78414184-78414206 AAGGAAAATTGAAATGATGAGGG - Intronic
1085676293 11:78521899-78521921 AAAGAGAATTAAAATGATAAAGG + Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087635732 11:100699004-100699026 AAGAAGAAATAAAATGAAAATGG - Intronic
1087694184 11:101356836-101356858 AAGGAGGAATAGGATGAGAAGGG - Intergenic
1087966984 11:104427865-104427887 AAAGAAAAATAAAATGATCATGG - Intergenic
1088809667 11:113382808-113382830 AACGAGAAATAGAAGGGGGAAGG + Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089095996 11:115920523-115920545 AATGAGAGAGACAATGATGAAGG - Intergenic
1089206699 11:116770142-116770164 AAGGAGGAAGAGGAAGATGATGG - Exonic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090141530 11:124269654-124269676 AAGCAAAAATAGATAGATGAGGG - Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090420470 11:126571895-126571917 ACAGAGAAATAGGATCATGAAGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091075673 11:132613738-132613760 AAGTAGAAATAGTATTATCAAGG + Intronic
1091528605 12:1332468-1332490 AAGGAGAACTAGATTGATTGTGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094113972 12:26890148-26890170 AAGGACAAAAGGAATAATGAAGG + Intergenic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1094820046 12:34217532-34217554 AAAGAAAAAAAGAAAGATGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095481589 12:42641821-42641843 AAGAAGAAATAGACAAATGAGGG + Intergenic
1095508130 12:42920341-42920363 AAGGAGACATAGAGCCATGAAGG - Intergenic
1095598442 12:43986767-43986789 ACAGAGAAATAGAAAGGTGAAGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096251801 12:50038239-50038261 AAGAACAAATACAAGGATGAGGG - Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097611929 12:61834031-61834053 AAGGAAAAGTAGAATTTTGATGG - Intronic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1097935702 12:65248490-65248512 AAGGAAAAATAAAATGCTGAGGG - Intergenic
1098143070 12:67470192-67470214 AAGGAGGAAAAGCAAGATGATGG - Intergenic
1098828773 12:75332891-75332913 CAGGGGATATAGAATGATCAGGG + Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099124765 12:78739710-78739732 AAGGAGAAAGAAAAAAATGAAGG + Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099455906 12:82862714-82862736 AAGCAGAAAGTGAATGATGGAGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100101080 12:91106726-91106748 AAAGAGAAAAAGAAATATGATGG - Intronic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100186775 12:92147067-92147089 AAAGAAAAAAAGAAAGATGAAGG + Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100670542 12:96807593-96807615 GAGGAGAAATACACTCATGATGG - Intronic
1100865394 12:98852049-98852071 AAGGAGGGAAAGGATGATGATGG + Intronic
1101220557 12:102634819-102634841 AAGGTAAAACAGAATCATGAAGG + Intergenic
1101226092 12:102689576-102689598 AAGCAGAAAGAGACAGATGAGGG + Intergenic
1101456250 12:104834431-104834453 AAGTATAAAGAGAATGATAAAGG - Intronic
1102015777 12:109646969-109646991 AAGGTGAAAGAGAAGGATAAAGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104513593 12:129403767-129403789 AAGAAGAAAGGGAATAATGAGGG + Intronic
1104553451 12:129778856-129778878 AAGCAGCTATATAATGATGATGG - Intronic
1104577285 12:129979514-129979536 AAGAAGAAAGACAATGTTGAGGG - Intergenic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105678123 13:22696920-22696942 AACTAGAAATTGAAAGATGAGGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106067787 13:26373190-26373212 AAAGAGAATTAGAATAATGGGGG - Intronic
1106947082 13:34840395-34840417 AAGGAGGAAGAGAAGGATAAAGG + Intergenic
1107161594 13:37235942-37235964 AAGGCAAAATACAATCATGAAGG + Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107998738 13:45887578-45887600 AGAGAGAAATAAAATGATGATGG + Intergenic
1108006508 13:45952351-45952373 AAGGAGAAATAAATGGATAAGGG + Intergenic
1109376402 13:61500140-61500162 AACGAGAAATGGAGAGATGATGG - Intergenic
1109461557 13:62666010-62666032 AAGGTGAAATAAATTGATCATGG + Intergenic
1109714387 13:66202390-66202412 AAGGAGAAAGAGAAATACGAGGG - Intergenic
1110861349 13:80347650-80347672 AATGACAAAGAGGATGATGATGG + Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111529758 13:89521588-89521610 AAGGAGAACAAGAATAATTAAGG + Intergenic
1112150706 13:96759344-96759366 AAGGAGAAACAGAAAACTGATGG - Intronic
1112384201 13:98922615-98922637 AAGGAGAGATAAAGTGATGGGGG + Intronic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1113496457 13:110733777-110733799 AAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114188878 14:20425685-20425707 AAGATGAAAGAGAATGAAGATGG + Intergenic
1114285464 14:21238663-21238685 GAGGGGAAATATGATGATGAGGG - Intronic
1114691796 14:24589726-24589748 AAGAAAAAAAAGAATGGTGATGG + Intergenic
1114748780 14:25180754-25180776 GAAGACAAACAGAATGATGAGGG + Intergenic
1114799403 14:25755968-25755990 ATGGAGAAATAGAAGAATGCTGG - Intergenic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1115054520 14:29106503-29106525 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116349231 14:43837898-43837920 ACGGAGATTTAGAATCATGAAGG - Intergenic
1116388022 14:44356710-44356732 ACAGAGAAATAGATTTATGAGGG + Intergenic
1116453308 14:45088144-45088166 ATGGAGAAAAAGAATGCTGTTGG + Intronic
1116737812 14:48716338-48716360 AAGGAGCAATAGCATGTTGTTGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1117606766 14:57438456-57438478 AAGAAGAAATAGAGAGATAAAGG - Intergenic
1118505417 14:66405549-66405571 AAGAAGGAAAAGAATAATGAAGG + Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1118726989 14:68635901-68635923 AAGGAGAGGTAGCAAGATGATGG - Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119577482 14:75739523-75739545 AAGGAGAAATATAGAGATAATGG - Intronic
1120000283 14:79295155-79295177 AAGGAAAAAGAAAAAGATGAAGG - Intronic
1120271120 14:82314398-82314420 AAGTAGAAGTAGATTGATAATGG + Intergenic
1120835908 14:89038126-89038148 AAGTACAAATTGAATGTTGACGG - Intergenic
1120957953 14:90099462-90099484 CAAGAGAAATAGAATGCTCATGG + Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121226622 14:92325911-92325933 GTGGAGAAATAGAAAGTTGATGG + Exonic
1121250078 14:92492896-92492918 AAGGAAAGATAGAAGGATCAGGG + Intronic
1121628161 14:95402000-95402022 AAGGAGAAAGGGATTTATGATGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122437229 14:101708430-101708452 AAAGAGAAAGGGAAGGATGAAGG + Intergenic
1123826872 15:24091492-24091514 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123841479 15:24252356-24252378 AAGGAGGAATAGATAGAAGAAGG + Intergenic
1123856261 15:24415323-24415345 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123999673 15:25744853-25744875 AAAGAGAGAGAGAATGATGCAGG + Intronic
1124037831 15:26072632-26072654 ATGGATAAATAAAAAGATGATGG - Intergenic
1125067291 15:35503532-35503554 AATGAGAAATGGAATGATAAAGG - Intronic
1125319299 15:38466477-38466499 AAGGAGAAAGGGAACCATGATGG - Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126333169 15:47555973-47555995 AAGGAGAGAAACACTGATGAGGG - Intronic
1126394349 15:48197344-48197366 AAGTAGAAAGAGAATGATGGTGG - Intronic
1126522309 15:49609203-49609225 AACTAGAAATAGAATTGTGATGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1126822789 15:52521326-52521348 TAGGAGAAGTAAAATGATCAGGG - Intronic
1126889559 15:53189857-53189879 GAGGAGAATTAGAATGATATTGG - Intergenic
1127142483 15:55992257-55992279 GAAGAGAAATAAAGTGATGATGG - Intronic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1127702803 15:61517747-61517769 AAGAGGAGATAGAATGTTGAAGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128681914 15:69658624-69658646 AAGGAGCAATATGGTGATGAGGG - Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1130820202 15:87487175-87487197 AAGGAGACATAGAATGCAAATGG + Intergenic
1131306873 15:91252747-91252769 AAGGAGAAAGGGAAGAATGAAGG - Intronic
1131770631 15:95733702-95733724 AAGGAAAACTAGACTGTTGATGG + Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132109229 15:99090097-99090119 AAGAGGAAAGAGAATGCTGAGGG - Intergenic
1132169319 15:99631773-99631795 ATGAAGAAATAAAATAATGAGGG + Intronic
1133434143 16:5764789-5764811 AATGATAAAAAAAATGATGATGG - Intergenic
1133652875 16:7829525-7829547 AAGGAGAAATTGGATGATGGAGG - Intergenic
1133758658 16:8781083-8781105 AAGGAAGAAGAGAATGATGGAGG + Intronic
1134627741 16:15734877-15734899 GATGAGAAATAAGATGATGAGGG + Intronic
1135744882 16:25008580-25008602 AAACTGAAATAGAATGATAAAGG + Intronic
1135756515 16:25103166-25103188 AAAGGGAAATAGAATGATATAGG + Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135842215 16:25887170-25887192 AAGGAGTAACAGAAAGCTGATGG + Intronic
1135849407 16:25949677-25949699 AAGGAGAAATATCATGAATAAGG + Intronic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135892631 16:26371420-26371442 AAGGAAAGATAAAATGAGGAGGG + Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137899573 16:52252337-52252359 ACGGAGACAAACAATGATGATGG + Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139114716 16:63936107-63936129 AAGCAGAAATACAATGAGTATGG - Intergenic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140574675 16:76152721-76152743 AAGGAGAAAAAGAGAGATGGAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143037182 17:4006011-4006033 AAGCAGAAATAAAATTATGTGGG + Exonic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143616269 17:8051873-8051895 ATGGGGCAATAGAAGGATGAAGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144250058 17:13407431-13407453 AAGCAGAACTAGACTGATGCTGG + Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145929314 17:28673438-28673460 GAGGAAGAATACAATGATGAAGG + Exonic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146771915 17:35576857-35576879 AAGTATACCTAGAATGATGAAGG + Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148982742 17:51592995-51593017 AGGTAGAAATGGATTGATGATGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149084334 17:52696411-52696433 ATAGAGAAATAGAATTTTGAAGG + Intergenic
1149367259 17:55958311-55958333 AAAGAAAAAGAGACTGATGATGG + Intergenic
1150912840 17:69406916-69406938 AAAGAGAAATTGATTGATTAGGG + Intergenic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1152310428 17:79546656-79546678 AAAAAAAAATAGAATGAGGAAGG - Intergenic
1152991457 18:367190-367212 AAGGACTAATATAATGACGAGGG + Intronic
1153061060 18:995455-995477 AAAGACAAAAAGAATTATGACGG - Intergenic
1153480392 18:5542650-5542672 CAGAACAAATAGAATGATAAAGG - Intronic
1153595765 18:6723922-6723944 AAAGAGAAATATAATAATTAAGG + Intergenic
1153855937 18:9146656-9146678 AAGGAGAAATATGGTAATGAGGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154107863 18:11539490-11539512 AATTAGATATAGAATGCTGAGGG + Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155121767 18:22828017-22828039 AAGGATAAAGAGAGTGATTATGG - Intronic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155531600 18:26772467-26772489 AAGGTGAAAATGAAAGATGAAGG - Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156231193 18:35155490-35155512 AGGAAGAAATTGAATGATGTAGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156614334 18:38765701-38765723 AAGGAGAAAGAGGAAGGTGAGGG - Intergenic
1156736845 18:40270336-40270358 AGGGAGGAATGGAAGGATGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158227333 18:55214854-55214876 AAGGAGAAATGGGAGGAGGAGGG - Intergenic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1158740204 18:60133219-60133241 AAGCTGAAATAAAATGTTGAAGG + Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159126058 18:64226083-64226105 AAGTAGAAATAGAAAGAAAACGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159834483 18:73321334-73321356 ATGGAGAAATAGAATGTTAGTGG + Intergenic
1159926502 18:74274500-74274522 AAGGAGAAAGAAAATGCTGTGGG + Intronic
1160025685 18:75213572-75213594 AAGGACAAACAAAATGCTGAGGG + Intronic
1160343855 18:78113194-78113216 TGGGAGAAAAAGAATGATGTAGG - Intergenic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162746721 19:12802660-12802682 AAGGAGAAATGGAAAGAGGTCGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164537468 19:29096834-29096856 AAGGATGAATAGAATGGTTAGGG - Intergenic
1164706544 19:30324275-30324297 AAGGATAAAAAAATTGATGATGG - Intronic
1164948654 19:32317757-32317779 AAAGAAAAAGAAAATGATGATGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168190307 19:54733588-54733610 ACAGAGAAATAGAAAAATGATGG - Intronic
925829748 2:7882541-7882563 AATGAGAAATAGAAAGAGGCTGG + Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
926749681 2:16188696-16188718 AAGGAGAGAGAGAATGTTGGGGG - Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
927248351 2:20976363-20976385 AAGATCAAATAGAAAGATGAAGG - Intergenic
928109036 2:28491662-28491684 AAGAAGAGATAAAATGAAGAAGG - Intronic
928114198 2:28535282-28535304 AAGAAGAAATAGAATAAAGAGGG - Intronic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
930204959 2:48578479-48578501 AAGGAGAATTAGAATTGTGTTGG - Intronic
930502776 2:52243720-52243742 AAGTAGCAATTGACTGATGATGG - Intergenic
930662860 2:54072546-54072568 AAGAAGAAAGAAAATAATGAAGG - Intronic
931173528 2:59830132-59830154 GAGGAGAAATAAAATGTTAAGGG - Intergenic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932115633 2:69044240-69044262 AAGGAGAAATTAAAAGTTGATGG + Intronic
933170020 2:79114875-79114897 GAGGAGGAAGAGAGTGATGATGG - Intergenic
933197861 2:79412786-79412808 AAGGAGAAACTGGATGGTGAAGG + Intronic
933244151 2:79956252-79956274 AAGCAGAAATTGACTGATTAGGG - Intronic
933431416 2:82184824-82184846 AAATAGAAAATGAATGATGAAGG + Intergenic
933564589 2:83934665-83934687 AAGGAGAAATGCGTTGATGAGGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935270579 2:101431150-101431172 AATGAGAGATGGATTGATGATGG - Intronic
935435829 2:103031118-103031140 AGGGAGAAATAGAAAGTTCAAGG - Intergenic
935437599 2:103053166-103053188 AATGATAAATAGACTGATCAAGG - Intergenic
936433751 2:112485466-112485488 AAGGAGAACTAGAATGATGCTGG - Intronic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937185263 2:120034362-120034384 AAGCAAATATAGAATGTTGATGG + Intronic
937487165 2:122327143-122327165 AACGAGGAAAAGAAAGATGAGGG - Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937588038 2:123580103-123580125 AAAGAGAAAAAGAAAGATCATGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938243132 2:129758377-129758399 AAGGAGAATGAGGATTATGAAGG + Intergenic
939070437 2:137534122-137534144 AAGGGGAAATGGAAAGATTAGGG - Intronic
939086629 2:137726955-137726977 AAAGAGAAAAATAATGTTGAAGG - Intergenic
939137766 2:138316743-138316765 AAGGAGTAATTGAATTATGGAGG - Intergenic
939147522 2:138433982-138434004 AAGGAGACAAACAATCATGATGG + Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
940049038 2:149441338-149441360 AAGGAGAAATATGGTGATGCTGG + Intronic
940599125 2:155835213-155835235 AAGGAGAGATTGAAGGAAGAAGG + Intergenic
940738791 2:157483034-157483056 AAGGAGAGATAGTATCCTGAAGG + Intronic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941407322 2:165106798-165106820 AAGAAGAAAAAGAGTGATGTAGG + Intronic
941440092 2:165523868-165523890 AAAGAGCAATAGAATGAAGATGG - Intronic
941647604 2:168057954-168057976 AAGGAAAAATTGAATGAGGGAGG - Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941760066 2:169232578-169232600 AAAGAGCAAAAGAATTATGAGGG + Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942948755 2:181699288-181699310 AAAGAGTAATTGAATCATGATGG - Intergenic
943037580 2:182766100-182766122 AAGGGGAAAGAGAATGCTGTTGG + Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943763536 2:191635711-191635733 AAGGATAAAATGAATGATGGAGG + Intergenic
943770119 2:191707105-191707127 AATGAGAAATGGAAGCATGATGG + Intergenic
944027987 2:195194887-195194909 AAGGAGATAGAGAAAGATAAAGG + Intergenic
944529035 2:200649614-200649636 AAGGAGAAATTGGATCATCATGG - Intronic
945786255 2:214241608-214241630 AAATAGAAATAAATTGATGATGG + Intronic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946641622 2:221789829-221789851 AAGGAGAAATAGTTTTAGGATGG - Intergenic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
946856843 2:223958188-223958210 AAAGAGAAAAAGCAAGATGAAGG - Intronic
946914228 2:224500072-224500094 AAAGAGAAAGTAAATGATGATGG - Intronic
947200162 2:227607869-227607891 AATGAAAAATAGAATAGTGAAGG - Intergenic
947538844 2:230960515-230960537 AAGGAGAAAAAGAATTAGTAGGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947874496 2:233459350-233459372 AAGGAGGAACGGGATGATGATGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948008392 2:234630473-234630495 AAAGTGAAATCGCATGATGAGGG + Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1170341779 20:15336756-15336778 AAGGAAAAATGGAATGCTTAAGG - Intronic
1170388036 20:15841738-15841760 GAGGAGACTTAGAATGATGGTGG + Intronic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171991765 20:31702274-31702296 AGGGAGAGACAGAATGATGGAGG + Intronic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173083383 20:39891201-39891223 AAAGAGGAAAAGAATGATCATGG - Intergenic
1173754311 20:45501580-45501602 AAGGAGAGAAAGAAGGATGGTGG - Intergenic
1173871837 20:46347074-46347096 AAGGTGAAATAAAATAATGTAGG - Intronic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175534075 20:59695356-59695378 AAGGAGGAAGAGAATGAAGCAGG - Intronic
1175754120 20:61518548-61518570 GATGACAAATAGAAGGATGATGG - Intronic
1177043170 21:16137871-16137893 AAGGAGATAAAGAATTTTGAAGG - Intergenic
1177439269 21:21099434-21099456 CAGGAAAAATACAATCATGATGG + Intronic
1177606260 21:23381422-23381444 AGGAAGAAATAGAATAATGGAGG - Intergenic
1177687862 21:24463387-24463409 AAAGAGAAACAGAAATATGATGG - Intergenic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1178155353 21:29847210-29847232 AAGGCAAAATAGAAAAATGATGG - Intronic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179623628 21:42634577-42634599 ATGGAGGAATAGGAGGATGATGG - Intergenic
1180520080 22:16189986-16190008 AATGAAAAATAAAATGCTGAAGG + Intergenic
1182740969 22:32567294-32567316 CAGGTGCAATAGAACGATGACGG + Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183237284 22:36629026-36629048 AATCAGAAATACAATGTTGAGGG + Intronic
1183401514 22:37607886-37607908 AGGGAGAAAAAGTAGGATGAAGG - Intergenic
1184447212 22:44555730-44555752 AAGGAGAAAGAGAAAGAAAAAGG + Intergenic
1184785482 22:46669530-46669552 AAGGAGAAAGACAAAGATAAAGG - Intronic
949099701 3:129186-129208 AAGGAGAAGTTGAATTCTGATGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949389821 3:3547264-3547286 AAAGAGAAAAATAATGATGAGGG - Intergenic
949561548 3:5207351-5207373 AAGGAGACAGAGAATGCTCAGGG - Intronic
949677044 3:6467393-6467415 AGGGAGGAAGAGAAGGATGAAGG + Intergenic
949730851 3:7111063-7111085 ATGGAGAAATTGACTGATGTGGG + Intronic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
950399251 3:12758382-12758404 AAGGGGAATGAGAATGATTATGG - Intronic
950526879 3:13529407-13529429 AGGGAGAAATGGATGGATGATGG - Intergenic
951205500 3:19922170-19922192 AAAGAAAAATAAAATTATGAAGG + Intronic
951273141 3:20652364-20652386 AAGGAGACATATGCTGATGAAGG - Intergenic
951431793 3:22616462-22616484 AAGGAAGAATGGAAAGATGAGGG + Intergenic
951445178 3:22771063-22771085 AATGAGAAATAAAATCATGGTGG + Intergenic
951807296 3:26660095-26660117 ATGGAGTAATATAATTATGAAGG - Intronic
951847086 3:27096237-27096259 AAAGAGAAGTATAATGTTGATGG - Intergenic
952049532 3:29366790-29366812 AAAGAGGAATAAAATGATGCAGG - Intronic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952636701 3:35541823-35541845 AAAGAGAAATAAACAGATGATGG + Intergenic
952647957 3:35684934-35684956 AAGCACAAATAAAATGCTGAAGG - Intronic
953065782 3:39468623-39468645 AGAGAGAAAGAGAATGATAAAGG - Intronic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953840074 3:46382944-46382966 AATGAGAAATTGCATGTTGAGGG + Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954423397 3:50430636-50430658 GAGGAGGAATGTAATGATGAGGG + Intronic
955187929 3:56732771-56732793 AAAGGGAAATAGAATCAAGAAGG + Intronic
955484391 3:59420938-59420960 AAAGAGAGGTAGAATGCTGAAGG - Intergenic
955624510 3:60903175-60903197 AAGGAGATATTAAGTGATGACGG + Intronic
955966159 3:64391316-64391338 AAATAAAAATTGAATGATGAAGG + Intronic
956321157 3:67998371-67998393 AAGGAGAATTAGGATAATAATGG - Intergenic
956665430 3:71637601-71637623 AGGGAGAAAAAGAAGGATGTAGG + Intergenic
956758524 3:72415277-72415299 AAAAAGGTATAGAATGATGATGG + Intronic
957200863 3:77134485-77134507 AAGGAGAAACTGAAGGATAAAGG + Intronic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957866749 3:86035292-86035314 AAGGAGAAATAGAATACTAGAGG - Intronic
957957059 3:87201295-87201317 AAAGAGAACGTGAATGATGAGGG - Intergenic
957962341 3:87272834-87272856 CAGAAGAAATATAATGATGAGGG + Intronic
958105045 3:89061097-89061119 AAGGACAAAGAGAGTGTTGATGG - Intergenic
959084738 3:101839764-101839786 AAGGAGAAAAAAAATTTTGAAGG - Intronic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960096154 3:113691685-113691707 AAAGGGAGATAGAATAATGAAGG - Intronic
960430551 3:117563395-117563417 AAGGACAAAAATATTGATGATGG - Intergenic
960930891 3:122848514-122848536 GAGGAGAAATATAATGATCATGG - Intronic
961130581 3:124463040-124463062 AATGTGAAATAAAATGAGGATGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962062456 3:131944504-131944526 CAGGAGAAATGTAATGGTGAGGG + Intronic
962188244 3:133282665-133282687 AAGGAGAAATAAAATTATGATGG - Intronic
962326943 3:134442255-134442277 AAGGAGACAGAGACTGCTGATGG - Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962823820 3:139080767-139080789 AAGGAGAAGTATAATCATCAGGG + Intronic
963513809 3:146282354-146282376 AAGAAGAGAGAGAATGAAGAAGG + Intergenic
963541128 3:146590031-146590053 AAAAAGAAAAAGAATTATGATGG - Intronic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964372460 3:156015043-156015065 AAGGAGAAAGAGGATGCTGTAGG + Intergenic
964436957 3:156663595-156663617 AATGATAAAAAGAATAATGATGG - Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964755090 3:160085361-160085383 AAGATAAAATAAAATGATGAAGG - Intergenic
964982742 3:162706172-162706194 AAGGAGAAATAAAATAATGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966160352 3:176961177-176961199 AAGGCCAAATAGAATCAAGAAGG - Intergenic
966582556 3:181584624-181584646 AAGAAGAAAGATAATGAAGATGG - Intergenic
967230443 3:187332793-187332815 AAGGAGGAACACAATGGTGAGGG - Intergenic
967435371 3:189438793-189438815 ATGGAGTAATAGAATGTTGGGGG + Intergenic
967986894 3:195101917-195101939 AAGGAGAAATGTAAGGAGGAAGG + Intronic
968335144 3:197907193-197907215 ATTGAGAAATAGAATAGTGAGGG - Intronic
968842517 4:3018043-3018065 AAAGAAAAAGAAAATGATGAGGG - Intronic
969622872 4:8287484-8287506 CAGGAGACATACAATCATGACGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970294688 4:14615985-14616007 ATGAAGAAATAGAATCGTGATGG - Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
971825096 4:31610899-31610921 AATAAGGAATAGAATGAAGAAGG - Intergenic
971941007 4:33214852-33214874 AAGGAGAAATAGGATGTTCTAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972281347 4:37604610-37604632 AAGGAGAGATGGAATGCAGATGG + Intronic
972393388 4:38634374-38634396 CAGAAGAAATAGAATGACAAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972832313 4:42828541-42828563 AGTGAGAAATAAAATGATGCTGG - Intergenic
973141954 4:46780567-46780589 GAGGACAGATAGAATGATAAAGG + Intronic
973700826 4:53535318-53535340 AAGGAGAAAGATAATGACTACGG - Intronic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
973821492 4:54665599-54665621 AAGGAGAACTGGAATTATCATGG + Intronic
973893815 4:55393252-55393274 AATGAGGACTAGAAGGATGATGG + Intergenic
974003500 4:56533604-56533626 GAGGAGGAATACAATGATGCAGG - Intronic
974338469 4:60582765-60582787 GAAGACAAGTAGAATGATGATGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975198392 4:71553864-71553886 AAAGTGACATAGAATGTTGACGG - Intronic
975260691 4:72294306-72294328 AAGGAGTAATGGAAAGATGTTGG + Intronic
976138902 4:81969103-81969125 AAGGGGAAATGGCATGATGTTGG + Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976967117 4:91056925-91056947 AAGGAGAAAGACAAAAATGAAGG + Intronic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
976997084 4:91447389-91447411 AAGGAGAAATAGCAGGTTTAGGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978014074 4:103722305-103722327 AAGGAAAAAAAGGATAATGATGG + Intergenic
978697614 4:111601076-111601098 AAGAAGATATGGAATGATTAAGG - Intergenic
978861776 4:113458934-113458956 AAGGAAAAAGAGAAGGATAAAGG + Intronic
979405579 4:120306699-120306721 TAGGAGAAATAAAATGTTGGTGG - Intergenic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
980554919 4:134391353-134391375 AAAAAGAGAGAGAATGATGAAGG - Intergenic
981491854 4:145348129-145348151 CAAGAAATATAGAATGATGATGG + Intergenic
982079182 4:151770857-151770879 AAGGAAAAAAAGAAGGATCAAGG + Intergenic
982401703 4:154975153-154975175 AAGGAGAGATAGGAAGATCACGG - Intergenic
983381013 4:166993487-166993509 AAAGAGAAATAGCATGAGGGTGG - Intronic
983446124 4:167855271-167855293 CAGGAGAAATCTAATGATGGTGG + Intergenic
983680113 4:170343671-170343693 AGGGAAAGAAAGAATGATGATGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984173712 4:176390469-176390491 AGGGAAAAAGAAAATGATGAGGG + Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
984537590 4:180996222-180996244 AAGGAGAAATGGAGAGATGTTGG - Intergenic
984737941 4:183128575-183128597 AAGTAGAAAGTAAATGATGAAGG - Intronic
984881386 4:184412737-184412759 AGGGAGGAAGAGAATGACGATGG - Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985617908 5:935489-935511 CAGAAGAAATAGGATGATGTGGG - Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
986963010 5:13238362-13238384 AAGGAAAACTAGAATGCTGTAGG - Intergenic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
987055272 5:14185163-14185185 AAGGAGAGAGAGAATGGTGGTGG - Intronic
987299670 5:16586173-16586195 AAGAAGAAATAAACTCATGAAGG + Intronic
987856045 5:23422221-23422243 AAGGGGAAAGAAAGTGATGAGGG + Intergenic
987995848 5:25278546-25278568 TTGGACAAATAGAATAATGAGGG + Intergenic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988027840 5:25722263-25722285 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
988237046 5:28559507-28559529 AGGGAGAAAGAGAAAGATGGGGG - Intergenic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988934580 5:36069211-36069233 AAGGAAAAATAGAATTATAGTGG - Intronic
989180329 5:38569908-38569930 AAGGGGGAATAAAATGATGAGGG - Intronic
989465718 5:41752871-41752893 AAGGAGAAAGAGAAAGATTAGGG - Intronic
989747139 5:44842766-44842788 CAGGAGAGATGGAAGGATGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990977171 5:61570269-61570291 AAGAAGAAAGAAAATGATGGGGG + Intergenic
991009345 5:61866795-61866817 ATGGAGAAATAGACTCTTGATGG - Intergenic
991074023 5:62514900-62514922 AAGGGGAAGTGCAATGATGAAGG - Intronic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991457002 5:66814567-66814589 AAGGTGAAATGCACTGATGAAGG + Intronic
991669961 5:69037774-69037796 AAGAAGAAATAGGATGAAAAAGG + Intergenic
992288523 5:75261058-75261080 AAGAAAAAAAAGAATGTTGAAGG - Intergenic
992321223 5:75614904-75614926 ATGGAGGAAAAGAATGGTGAGGG + Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992750326 5:79855330-79855352 AAGGAGAAAGAGAATGTAGGTGG + Intergenic
993317569 5:86429901-86429923 GAGGAGAAATTGAAACATGAAGG - Intergenic
993472774 5:88326231-88326253 AAGGAGAAATGGGAAGATGTTGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994143713 5:96369065-96369087 AAAGAGATATAGAATATTGAGGG - Intergenic
994690685 5:103015912-103015934 TAGGAAAAATATAATGATGGGGG - Intronic
995183498 5:109249895-109249917 AAGGAGAGCAAGAATGATCAAGG + Intergenic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996633336 5:125663520-125663542 GAGGAGAGATAGAGTGTTGAAGG + Intergenic
996764852 5:127025760-127025782 AAGAAGAAAGAAAAAGATGAAGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997080167 5:130728766-130728788 AATTAGAGATAGAATGATGCCGG - Intergenic
997804640 5:136905092-136905114 GAGGAGGAAGAGAAAGATGAAGG - Intergenic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
998697664 5:144658562-144658584 AAGCAAAAATAAAATGATAATGG - Intergenic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000552214 5:162681104-162681126 AAGGAGAAAGAGAATGATAGGGG + Intergenic
1000624332 5:163521987-163522009 ATGAATAAATAGAATAATGAGGG - Intergenic
1001132755 5:169078369-169078391 AAGGAGAAATATATTTGTGAAGG - Intronic
1002378749 5:178809154-178809176 AAGGAGAATTGGAATTATGTGGG + Intergenic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003017314 6:2478489-2478511 AGGGAGAAAGAGAAAGATGAAGG - Intergenic
1003164784 6:3666735-3666757 AAGGAGAAATAGAAAGTTCCAGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004187967 6:13437903-13437925 ACAGAGAAATAAAATGCTGAGGG + Intronic
1004502520 6:16221832-16221854 AAGGAGAGATAGAAAGCTGTGGG - Intergenic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004766435 6:18732983-18733005 AAGGAGGAATTGGATCATGACGG - Intergenic
1005250759 6:23943282-23943304 AAGGAATAATAAAATAATGATGG + Intergenic
1005279163 6:24252622-24252644 AAGTAGAAAGAGAATGGTGAGGG + Intronic
1005377004 6:25193013-25193035 AAAGAGGAATAGAATGATTAAGG - Intergenic
1006040766 6:31252725-31252747 AAGGAGGAATATCCTGATGAGGG + Intergenic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1006233703 6:32608561-32608583 AAGGAGAAAGAGATTGATTAAGG + Intergenic
1006563376 6:34933245-34933267 AAGTAGTGATAGAATGATCACGG - Intronic
1006695870 6:35930479-35930501 AAAAAGGAATAGAATGATGCAGG - Intergenic
1007865259 6:44962112-44962134 AAAGAAAAAGAAAATGATGAGGG + Intronic
1008176014 6:48269225-48269247 AAGGAGAAATAAAATCTTTACGG - Intergenic
1008403683 6:51094894-51094916 AAGGAGAAATGGGAAGTTGATGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008465203 6:51822389-51822411 AAGGAGCAATACCACGATGATGG - Intronic
1008639628 6:53448550-53448572 AAGTGGAATTAGAATCATGAGGG - Intergenic
1008716939 6:54299958-54299980 AAGGAAAAGTTGAATGATCAAGG + Intergenic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1008993002 6:57625648-57625670 AATAAAAAAGAGAATGATGAAGG + Intronic
1009167168 6:60355220-60355242 AAGGAGGTATAAAAAGATGAAGG + Intergenic
1009181616 6:60524753-60524775 AATAAAAAAGAGAATGATGAAGG + Intergenic
1009380088 6:63016915-63016937 AATGACAACTAGAATGGTGAAGG - Intergenic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1009950900 6:70394543-70394565 ACCGAGAAAGAGAACGATGAGGG + Intergenic
1010169662 6:72960364-72960386 AAATAGAAATAGAATATTGAGGG - Intronic
1010207141 6:73333094-73333116 AATGTGAAATAGAGTTATGATGG + Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010359790 6:74979311-74979333 AGGGAGCAATAGAATGCTTATGG + Intergenic
1010665515 6:78625421-78625443 AAGGAGAAATAGAATCACTCTGG + Intergenic
1011390601 6:86848414-86848436 AAGAAGAAATAGAAGGTTGGAGG - Intergenic
1011739042 6:90341178-90341200 AAGGAGAAATATACTCATGTTGG - Intergenic
1012195117 6:96332300-96332322 AAAAAGTAATAGAAAGATGAGGG - Intergenic
1012569871 6:100710868-100710890 AATTATAAATAGTATGATGAAGG + Intronic
1012604878 6:101145400-101145422 AAAGAGATAGAAAATGATGATGG + Intergenic
1012873718 6:104700674-104700696 AAAGAGAAAAAGCAGGATGAGGG + Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013384159 6:109607927-109607949 CAGGAGAAATAGGGTGCTGAAGG + Intronic
1013490869 6:110645540-110645562 AAGTAGAAGTAGAAAGATAAAGG + Intronic
1014096757 6:117469670-117469692 AAGGGGAAATAAAAGCATGAAGG - Intronic
1014600521 6:123406144-123406166 AAGCCAAAATAGAATGATGTAGG + Intronic
1014783339 6:125589533-125589555 AAGTATAAATAGGTTGATGAAGG - Intergenic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015669779 6:135675321-135675343 AAGAATAAATAGAAATATGAGGG - Intergenic
1016437958 6:144057288-144057310 AAGGATAAATAGAATACTGCTGG - Intronic
1016684344 6:146864383-146864405 AAGGTGAAATGAAATGGTGAAGG - Intergenic
1016912417 6:149212209-149212231 AAGGAGAAATATATTCATCAAGG + Intergenic
1017645620 6:156537378-156537400 AAGGTGAAATAGAATGGATAAGG - Intergenic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017880077 6:158556482-158556504 AGGGAGGTATAGAAAGATGAAGG + Intronic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020667593 7:11067775-11067797 AAGGAGAACTGGTATGATCAGGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021197438 7:17688869-17688891 AAGGAGATATACAATATTGATGG + Intergenic
1021885733 7:25136812-25136834 AAGGAGAAAAAAATTGATCAGGG + Intronic
1023614265 7:42003503-42003525 ACAGAGAAATAAAATAATGAAGG + Intronic
1023622582 7:42088103-42088125 AAGGAGAAATAGAAGAAAAATGG - Intronic
1023747572 7:43335852-43335874 AAAGAGAAAGAGAGAGATGAAGG - Intronic
1023747574 7:43335878-43335900 AAAGAGAGAAAGAAAGATGAAGG - Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024494779 7:50032991-50033013 AAGCAGAAAAAGAATTATGTGGG + Intronic
1024773930 7:52759910-52759932 AAGAAGAAATGGAAGGAGGAGGG + Intergenic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1025868571 7:65408541-65408563 AGGGAGAAATAGAATTACCAGGG + Intergenic
1025929613 7:65983117-65983139 AAGGAGACATAGATTTATGGAGG + Intergenic
1025969843 7:66312204-66312226 AGGCAGAAAGAGAAGGATGAGGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026475195 7:70729130-70729152 CAGGAGAAAAAGAGTGATGGAGG - Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027940282 7:84669849-84669871 AAGGAGAAAAACAAGGCTGAAGG + Intergenic
1028120944 7:87056227-87056249 AAGGAGAAATATAAATATGAGGG - Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028233895 7:88337345-88337367 AAGGAGAAACTGAACTATGATGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030353335 7:108515777-108515799 AATGAGGAATAGAATGTTTAGGG + Intronic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030901141 7:115125396-115125418 AAGAAGAAATAGAATCAGTAGGG - Intergenic
1030917123 7:115328862-115328884 AGGGAGAAATTGAACTATGATGG - Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031584123 7:123513609-123513631 AAGGAAAAATAGAAAGATAGAGG + Intronic
1031609214 7:123805598-123805620 AAAAAGAAATAGAATGATGGAGG + Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031700036 7:124913256-124913278 AAGAAGAAATACAATACTGATGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033574259 7:142664927-142664949 AAGTAGAATTAGATTGGTGAGGG - Intergenic
1033729164 7:144157690-144157712 AAGGAGAATTAGATTTATGAGGG - Intergenic
1033996750 7:147359583-147359605 AAGGAGAAATAGCATGGGGTGGG - Intronic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1034289494 7:149918138-149918160 AAGGAGAAATAGAAAATTTAAGG - Intergenic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034661569 7:152774686-152774708 AAGGAGAAATAGAAAATTTAAGG + Intronic
1035559514 8:594081-594103 AAGAAGGGAGAGAATGATGAAGG - Intergenic
1035794719 8:2344256-2344278 AAGTAGATACAGACTGATGAGGG + Intergenic
1035850151 8:2910934-2910956 AAGGAGAAATGGAAGGATTATGG + Intergenic
1035973374 8:4278097-4278119 AAGGAGAAAGAGAACCATAAAGG - Intronic
1036494559 8:9258481-9258503 AAGGACAAAGAAAATGATGGAGG + Intergenic
1036615575 8:10385011-10385033 AAGGAAAAATAAAATGATTCAGG + Intronic
1037310939 8:17555686-17555708 AAGGAAAAATAGATTCCTGATGG - Intronic
1037393876 8:18421797-18421819 AGGCAGAAATAGAAAGTTGAGGG - Intergenic
1038115264 8:24546700-24546722 TAGGAGAAAAATAATAATGAGGG + Intergenic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1039129733 8:34249441-34249463 AATTTGAAATAGAATGATCAAGG + Intergenic
1039157718 8:34580411-34580433 AAGGAGAACAAAAATAATGATGG - Intergenic
1039312391 8:36331225-36331247 AAGGAGTAATAGAAAGAATAGGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1041083473 8:54235298-54235320 AAGGAGAAATTGAACAAGGAGGG + Intergenic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041296853 8:56365647-56365669 AAGGAGAAAAACAATAATGAAGG + Intergenic
1041299426 8:56395259-56395281 AAGAAGAAAAAGAATGTTGCTGG - Intergenic
1041766060 8:61419440-61419462 AATGAGAAAGAAAATAATGAGGG + Intronic
1042060054 8:64806764-64806786 AAGGAGAAAGAGAATAACCATGG - Intergenic
1042128783 8:65565794-65565816 ATGGAGAAATAGAATCTTGGAGG - Intergenic
1042190716 8:66184253-66184275 AAGGAAAATTAGAATGATACTGG - Intergenic
1042337664 8:67645519-67645541 AAGTATAAATTGAAAGATGAAGG + Intronic
1042364441 8:67919986-67920008 AAGGAGAAATAAATAAATGAGGG - Intergenic
1042605337 8:70540615-70540637 AAGGAGGACTAGAATGAAGGGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043114199 8:76228812-76228834 AAAGAGAAATAAAGTAATGAAGG + Intergenic
1043142805 8:76611316-76611338 AATGAGTAATTGAATGATGTTGG + Intergenic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1043158258 8:76814032-76814054 ACGGAAGAATAGCATGATGACGG - Intronic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043551985 8:81384955-81384977 AAGGAGAAATAAAATACTGAGGG - Intergenic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1043863079 8:85343882-85343904 AAGCAGAAAAAGAAGGATAAAGG - Intronic
1044038944 8:87341591-87341613 AAGAAGTAATTGAATCATGAGGG + Intronic
1044376026 8:91472051-91472073 AAGGAATAAAAGATTGATGAAGG + Intergenic
1044705614 8:95005610-95005632 AAGGCACAATAAAATGATGAGGG - Intronic
1044802999 8:95976262-95976284 AAGGAGAGAGAGAAGGATGGAGG + Intergenic
1045137350 8:99234863-99234885 AAGGAGAAATAGAATGTTTGAGG + Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1045972120 8:108090850-108090872 AAAGACAAATGGAATGATTAGGG - Intergenic
1046579684 8:116076945-116076967 AACGAGAAAAAGAAAGATTAGGG + Intergenic
1046816766 8:118593188-118593210 AATGAGAGATATAATGATGAAGG + Intronic
1047880808 8:129190788-129190810 AACGAGAAATAGAATCAGAATGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048246345 8:132806146-132806168 AAGGAAAAAAAGCATGATGCTGG - Intronic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048545424 8:135382181-135382203 TAGGAGAAATAGCAGCATGAGGG + Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1048828364 8:138451954-138451976 AAGGTGAAAAAGAATGAAGGAGG - Intronic
1049923354 9:385799-385821 AAAGAAAAATAGAAAGATCAAGG - Intronic
1049971000 9:821912-821934 AATGAGAAAGAGAATTCTGAGGG + Intergenic
1050081408 9:1919711-1919733 AAAAAGAGATAGAATGATGCAGG + Intergenic
1050405058 9:5299308-5299330 CAGAAGAAATAGTATAATGAAGG - Intergenic
1050408385 9:5334553-5334575 CAGAAGAAATAGTATAATGAGGG - Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050985561 9:12077518-12077540 AAGGACAAAAAGAATTATCAAGG + Intergenic
1051138074 9:13946710-13946732 AATGAAATATAGAAAGATGAGGG - Intergenic
1051216444 9:14803155-14803177 AAAGAGAGAAAGAAAGATGAAGG - Intronic
1051522813 9:18009218-18009240 AAGAAGAAATAGGAAGATGAAGG - Intergenic
1051793271 9:20833148-20833170 TAAGAGATATAGAATGTTGATGG - Intronic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052124086 9:24754533-24754555 AGGGAGAAATGGAATGACAAAGG + Intergenic
1052403520 9:28030803-28030825 AGGGAGTAATCCAATGATGAAGG + Intronic
1052406346 9:28065808-28065830 AATGAGAATGAGAATGATGGTGG + Intronic
1052685420 9:31749335-31749357 AGGGAGAAATAGAGAGATGTTGG + Intergenic
1053384914 9:37679313-37679335 AAGGAGAAAAAGAAAAGTGATGG - Intronic
1053508028 9:38661514-38661536 AGGGAGAAAAGGAAGGATGAAGG + Intergenic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1055027058 9:71733488-71733510 AAGGAAAAGTACAATGTTGACGG + Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055660786 9:78501956-78501978 AAGGAGAAATAGGATGTTTGTGG + Intergenic
1055681232 9:78717612-78717634 AAGAAGAAATCAAATGCTGATGG + Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055749897 9:79493585-79493607 AAGGACAAAAAAAATGCTGATGG + Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057944763 9:99316111-99316133 AAGGAGAATAAGAATCATCAGGG - Intergenic
1058268785 9:102942495-102942517 GAGGATAAATTGAATGATTAAGG - Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059369906 9:113820851-113820873 AGAGAGAAATAGATTGACGATGG + Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1060102465 9:120852490-120852512 AAGAACAAAGAGAATGATAATGG + Intergenic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186044543 X:5520591-5520613 CAGGTGAAATACAATGATAAGGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186286427 X:8048756-8048778 AGGGAGAAATGGAATGGTCATGG - Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186437141 X:9552314-9552336 ACAGAGAAATAGACTGATGGTGG - Intronic
1186536274 X:10352195-10352217 AAAGGGAAATAAAATTATGAAGG + Intergenic
1187284892 X:17895823-17895845 AAAGTGATAGAGAATGATGAGGG + Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187704183 X:21993286-21993308 ATCGAGAACTAGAATGATGTTGG + Intronic
1188819311 X:34754125-34754147 AAGGAGAAAGAGAGTGATGGAGG + Intergenic
1189857612 X:45239026-45239048 AAGGGGAAATAGAGTAAGGAAGG - Intergenic
1190417446 X:50193953-50193975 ATGGACAGATTGAATGATGAAGG + Exonic
1190719763 X:53137810-53137832 AACAAGATATAGAATGATAAGGG - Intergenic
1190887279 X:54541094-54541116 AAGAAGAAAAAGAGAGATGAAGG - Intronic
1191631654 X:63328634-63328656 AAGGAGAATTATTAGGATGATGG + Intergenic
1191803656 X:65109160-65109182 AAAGTAAAATAAAATGATGAAGG - Intergenic
1192308984 X:69993432-69993454 AAGGATAAATAAAATGACCATGG - Intronic
1192433463 X:71127784-71127806 AAGGAGAAAGTGAGGGATGAAGG - Intronic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1193691316 X:84647857-84647879 CAGAAGAAATATAATGATAAGGG - Intergenic
1194178222 X:90679221-90679243 AAGGAGAAAGAGAAGGAAAAGGG - Intergenic
1194353498 X:92852298-92852320 AAAGAAAAAAAGAATGATGGTGG - Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194610389 X:96035952-96035974 AGGAAGAAATAGAATGGTGAAGG - Intergenic
1194665108 X:96668646-96668668 AAGAAGAAATGCAATGTTGAAGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194975168 X:100387727-100387749 AAGGACAAAAAGAATGAAAAAGG + Intronic
1195027560 X:100893176-100893198 TGGGAGAAATAGAAAGATGTTGG + Intergenic
1195709592 X:107763462-107763484 AAGGACAAATAAACTGATCAAGG - Intronic
1195811571 X:108838254-108838276 AAGAAGAAATAATAAGATGATGG - Intergenic
1196070844 X:111519915-111519937 GAGCAGAAATAAAATGATGTTGG + Intergenic
1196081450 X:111637225-111637247 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1196205209 X:112931575-112931597 AAGGAGAGAGGGAAAGATGATGG - Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196623744 X:117854144-117854166 AAACAGAAATACTATGATGATGG + Intergenic
1196886105 X:120246961-120246983 AAAGGGATAGAGAATGATGAGGG - Intergenic
1197110646 X:122770294-122770316 GAGCAGAAATAAAATAATGAAGG - Intergenic
1197166088 X:123379212-123379234 AAAGGGAAATAAAATGGTGATGG - Intronic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198383359 X:136105001-136105023 AAGGAAAAAAAGAAAGATGGAGG + Intergenic
1198627458 X:138593713-138593735 AAGGGGCTATAGACTGATGATGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199034857 X:143037873-143037895 AAGGAAACTTAGAATTATGATGG - Intergenic
1199269456 X:145865545-145865567 AAGAATAATTAAAATGATGAGGG + Intergenic
1199470859 X:148194124-148194146 AAGGAGAGATAGAATTTTGAAGG - Intergenic
1199540442 X:148952587-148952609 AATGAGAAAAAGAAAGGTGATGG + Intronic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1199680937 X:150224170-150224192 AAGGAGGAAGAGGAAGATGAAGG - Intergenic
1200661858 Y:5969372-5969394 AAAGAAAAAAAGAATGATGGTGG - Intergenic
1200979515 Y:9248802-9248824 AAGGAGAAAGAGGATGGTCAAGG + Intergenic
1201062322 Y:10058711-10058733 AAGGAGAAAGAGGATGGTCAAGG - Intergenic
1201412744 Y:13716987-13717009 AAGGAGAAAGAGAATGGAGGAGG + Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic