ID: 972597497

View in Genome Browser
Species Human (GRCh38)
Location 4:40542793-40542815
Sequence TCCCTATGTGCTGGGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590457
Summary {0: 2, 1: 82, 2: 8827, 3: 308303, 4: 273243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972597489_972597497 8 Left 972597489 4:40542762-40542784 CCTGAGCTCAAGTGATCCTCTCA 0: 83
1: 2099
2: 15979
3: 54563
4: 128871
Right 972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG 0: 2
1: 82
2: 8827
3: 308303
4: 273243
972597488_972597497 26 Left 972597488 4:40542744-40542766 CCAGGTTGGTCTTGAACTCCTGA 0: 1723
1: 56932
2: 142215
3: 225544
4: 174716
Right 972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG 0: 2
1: 82
2: 8827
3: 308303
4: 273243
972597487_972597497 27 Left 972597487 4:40542743-40542765 CCCAGGTTGGTCTTGAACTCCTG 0: 1016
1: 20650
2: 40218
3: 58862
4: 50113
Right 972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG 0: 2
1: 82
2: 8827
3: 308303
4: 273243
972597491_972597497 -8 Left 972597491 4:40542778-40542800 CCTCTCACCCTGGCCTCCCTATG 0: 1
1: 1
2: 49
3: 2218
4: 29595
Right 972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG 0: 2
1: 82
2: 8827
3: 308303
4: 273243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972597497 Original CRISPR TCCCTATGTGCTGGGATTGC AGG Intronic
Too many off-targets to display for this crispr