ID: 972599819

View in Genome Browser
Species Human (GRCh38)
Location 4:40562259-40562281
Sequence GTGGTCCTCTTTTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972599819 Original CRISPR GTGGTCCTCTTTTGGAAGCC TGG Intronic
901756349 1:11443793-11443815 GTGGGCCTCCTTGGGAAGCTGGG + Intergenic
904623565 1:31789576-31789598 GAGGTTCTCTCCTGGAAGCCAGG + Intergenic
905934201 1:41810838-41810860 GTGGATCTCTTTAAGAAGCCAGG + Intronic
906804497 1:48767154-48767176 GTGGTCCTAATTTGGAATTCTGG + Intronic
908232435 1:62119053-62119075 GTTGTCATATTTTGGAAACCTGG + Intronic
912351149 1:109014941-109014963 GTGACCCTCTTTTTGAAGGCAGG - Intronic
915138689 1:153752511-153752533 GTGGTCAGATTTAGGAAGCCTGG + Intronic
915679793 1:157570123-157570145 GTGTGGCTCTTTTGGAAGCTGGG + Intergenic
916149673 1:161774657-161774679 GTGGCCTTCTTTTGGGAGGCAGG - Intronic
923365368 1:233255244-233255266 GTGGTCCTAAGTTGGAAGCAGGG - Intronic
924270789 1:242330402-242330424 GTGGCCCTTACTTGGAAGCCTGG + Intronic
1063183433 10:3628008-3628030 GAGCTCATCTTTTGGAAGCAAGG + Intergenic
1063432188 10:6000180-6000202 GTGCTCCTCTGTTGGGGGCCAGG - Intergenic
1063691835 10:8295227-8295249 GTGGTCACCTTGTAGAAGCCAGG - Intergenic
1064323517 10:14328186-14328208 GTTCTCCTCTCTTGGAAACCAGG - Intronic
1065346922 10:24757436-24757458 GTGGTCCGTTTTTGTAATCCTGG - Intergenic
1067264919 10:44733078-44733100 GTGGACCACTTTTGGAATCAAGG - Intergenic
1067424404 10:46194117-46194139 CTGGTGCTCTTTGGGCAGCCTGG + Intergenic
1068102696 10:52575743-52575765 GTGGTGCTCTGTCTGAAGCCAGG + Intergenic
1071089801 10:81905005-81905027 ATGGTCCTGTTCTGGACGCCTGG - Intronic
1079332261 11:19543275-19543297 GTCTTCCTCTTTTGGAAGTTTGG + Intronic
1081017678 11:37903993-37904015 GTGGTCCTGTTTAGGAAGTGAGG + Intergenic
1086587954 11:88477865-88477887 AATGACCTCTTTTGGAAGCCTGG + Intergenic
1088422140 11:109660188-109660210 GTAGGTCTCTTGTGGAAGCCTGG - Intergenic
1088766272 11:112982480-112982502 TTGCTCTTCTTTTGGAAGCTGGG + Intronic
1093028915 12:14270162-14270184 TTGGTCCTAATTTGGAAGCAGGG + Intergenic
1093702627 12:22239784-22239806 GTGTGCTTCTGTTGGAAGCCAGG + Intronic
1094220251 12:27985388-27985410 TTGCTTCTCTGTTGGAAGCCCGG - Intergenic
1095872774 12:47048834-47048856 GTTGTCTACTTTTAGAAGCCAGG + Intergenic
1098137627 12:67419451-67419473 GGGGAACTCTTGTGGAAGCCAGG + Intergenic
1099396317 12:82145452-82145474 TTTGTCATCTTTTGGAATCCTGG + Intergenic
1100102550 12:91126539-91126561 TTAGTATTCTTTTGGAAGCCAGG + Intergenic
1100477710 12:94949298-94949320 ATGGTCCACTCTTGGAAGGCTGG - Intronic
1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG + Intronic
1104073946 12:125373010-125373032 GTGGTCCTCTTTGGCAATCCTGG + Intronic
1104371135 12:128224907-128224929 CTGGTAGTCTTTTGGAAGACAGG + Intergenic
1105505867 13:21009247-21009269 GTGGTCAGCTCTTGGAAGGCAGG + Intronic
1113437620 13:110306342-110306364 GTGGGGCTCTTCTGGACGCCCGG - Intronic
1115377627 14:32695069-32695091 GTGATTCTCTATTGAAAGCCTGG - Intronic
1116593989 14:46816725-46816747 GTGGTGTTCTTTTTGAAGCCAGG + Intergenic
1119637457 14:76288171-76288193 TTTGTCCTCTTTTGTATGCCAGG + Intergenic
1120945791 14:89995856-89995878 GAGGTCCTCCTGTGGATGCCAGG + Intronic
1128197128 15:65768474-65768496 GTGGTTCTCTTTGGGAAGGTTGG - Intronic
1129797717 15:78390835-78390857 CTGGACCTCTTTGGGAAGCTGGG - Intergenic
1135752839 16:25070683-25070705 CTGGTACTCATTTGGAGGCCCGG + Intergenic
1138295851 16:55884551-55884573 GTGGCCCTCTTCTGCAGGCCAGG - Intronic
1140066824 16:71618518-71618540 GTGGCCCTCTTTTGGGTGGCAGG - Intergenic
1141490281 16:84368168-84368190 GTGATCCTCTTGAGGAACCCAGG - Intergenic
1142679961 17:1541457-1541479 GTGGTCCTCTTTTGCCTGGCCGG - Intronic
1143012618 17:3874277-3874299 GTGGTCCTCGATTGGATTCCGGG + Intronic
1143588001 17:7861061-7861083 GTGGTTCTCTTTTGGTCACCAGG - Exonic
1144088644 17:11833555-11833577 GTGGTCCACAGTTGGAAGCAGGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1146524508 17:33554698-33554720 GTGGTGCTTCTTTTGAAGCCAGG - Intronic
1147332869 17:39709228-39709250 CTGCTCCTCTTTTAGAAGGCAGG + Intronic
1148253483 17:46107097-46107119 TTGTTGCTCTCTTGGAAGCCAGG - Intronic
1148989860 17:51656322-51656344 GTGGGGTTCTTTTGGGAGCCAGG + Intronic
1152008977 17:77699111-77699133 GAGGTCCTCTTCTGGAGGCTGGG + Intergenic
1152574783 17:81135231-81135253 GGTGTCCTGATTTGGAAGCCGGG - Intronic
1152685978 17:81694072-81694094 GCTGTCCTCTCTGGGAAGCCCGG - Intronic
1155818925 18:30350725-30350747 GTAGTCCTACTTTGGAGGCCTGG + Intergenic
1158432356 18:57400848-57400870 GTGTTCCTCTTTTGGGAGTTAGG - Intergenic
1159322294 18:66867478-66867500 TTGGTGATCTTTTGGAAGCTAGG + Intergenic
1165813012 19:38623623-38623645 GTTGTCCTCTTTTGCAAGGGAGG + Intronic
1165858912 19:38896707-38896729 GTGGTCGTGCTTTGGGAGCCAGG + Intronic
1167492046 19:49798698-49798720 GAGCTCCTCCTTTGGAAGACAGG + Intronic
925139424 2:1539750-1539772 GTGGTCCTCTTCAGGCAGGCGGG + Intronic
925857965 2:8148979-8149001 TTGGTGCTCTTTTGGAAGCTTGG - Intergenic
926893176 2:17656329-17656351 TTGTCCCTCTTTTGGGAGCCTGG - Exonic
938950900 2:136253710-136253732 GCGTTCCTCTTTGGGAAGGCTGG + Intergenic
940004486 2:148998553-148998575 TCGGTCCTCTTGGGGAAGCCTGG + Intronic
943172694 2:184424067-184424089 GTACTCCTTCTTTGGAAGCCAGG + Intergenic
944038406 2:195325856-195325878 GTACCTCTCTTTTGGAAGCCAGG - Intergenic
945219452 2:207468960-207468982 GTGGACCTCTTTTGGAGGCCTGG - Intergenic
947867439 2:233409026-233409048 GCTGTCCTCTTCTGGCAGCCTGG + Intronic
1171343022 20:24445291-24445313 GTGGTTGTCTTTTGGGTGCCTGG - Intergenic
1173682733 20:44897587-44897609 GTGGTCATCCTTTGGTATCCAGG + Intronic
1175773628 20:61639306-61639328 TTGGTCCTCCTTTGGAGGCGGGG + Intronic
1183742641 22:39677398-39677420 GTGGAGCTCTTTGGGAAGCTGGG + Exonic
949102820 3:166312-166334 CTAGTCCTTATTTGGAAGCCTGG + Intergenic
949416429 3:3819709-3819731 GTGGCCCTTTTTTGGAAACAGGG - Intronic
954554726 3:51508864-51508886 CTGGTCCTTTTTTGGATGCAGGG + Intergenic
954588005 3:51753657-51753679 TTTTTCCTCTTTTGGGAGCCAGG - Intergenic
962385436 3:134928866-134928888 GAGGTCCAGTTTTAGAAGCCAGG + Intronic
962882054 3:139587492-139587514 GCTGCCCTGTTTTGGAAGCCAGG + Intronic
963315124 3:143751099-143751121 GCAGTTCTGTTTTGGAAGCCAGG + Intronic
964510005 3:157439549-157439571 GTGATCCTCTTTTGGGGACCAGG - Intronic
965453023 3:168861773-168861795 GTGGGCCTCTTTGAGAAGGCAGG + Intergenic
967576152 3:191096191-191096213 GTGGTCCACCTTTGGAAGGAAGG - Intergenic
972599819 4:40562259-40562281 GTGGTCCTCTTTTGGAAGCCTGG + Intronic
972644402 4:40954066-40954088 GTGGTCCTTGTTCAGAAGCCAGG - Intronic
977289086 4:95143898-95143920 CTGTTCGTATTTTGGAAGCCAGG - Intronic
977531136 4:98201527-98201549 CTGGTCCTAATTTGGAAGCTGGG - Intergenic
980698307 4:136389626-136389648 CTGGTCCTACTTTGGAATCCTGG + Intergenic
982849605 4:160296092-160296114 GTGGTCTTCCTTTGAAATCCAGG - Intergenic
985873589 5:2578051-2578073 GTGGTCCCCTTGTGGAAGTACGG + Intergenic
989156828 5:38352258-38352280 GTGGCCCTGTCTTGGAAACCTGG + Exonic
989243752 5:39230074-39230096 GTGGACATCTTTTGGAAGATGGG - Intronic
997157213 5:131573584-131573606 CTGGTGCCCTCTTGGAAGCCTGG - Intronic
1000263890 5:159616465-159616487 ATGGTCTTCTTTTGGAAGTTAGG - Intergenic
1001749854 5:174120588-174120610 GAGGCCCTGTGTTGGAAGCCAGG + Intronic
1003781700 6:9435461-9435483 GTGGTCCTCTTTTAGAAACTGGG + Intergenic
1005163477 6:22892721-22892743 GAGCTCATCTTTTGTAAGCCAGG + Intergenic
1009625682 6:66137018-66137040 GTGGGCCAATGTTGGAAGCCGGG + Intergenic
1012863702 6:104592952-104592974 CTGGTGCTCATTTGGAAGTCTGG - Intergenic
1016710575 6:147166602-147166624 TTGGTCCTAAGTTGGAAGCCAGG - Intergenic
1016866868 6:148776235-148776257 GTGCTCCTCTTCTGGAAACCAGG - Intronic
1017895827 6:158679060-158679082 GTGGTCCTCCTTTGTAAACTTGG + Intronic
1018801908 6:167229450-167229472 GAGGTCCTCTTCTGGTAGCCTGG + Intergenic
1023520788 7:41048254-41048276 GTGCTCCTCTTAGGAAAGCCCGG + Intergenic
1024376165 7:48640939-48640961 GTGTTTCTATTTTGGAAGACTGG + Intronic
1025899454 7:65732079-65732101 GGGGTCCTCTTTTGAAATCCAGG + Intergenic
1030470583 7:109958193-109958215 ATGGCCATCTTTTGTAAGCCAGG + Intergenic
1032392991 7:131568566-131568588 GTGGGCCTCTTTGGGGATCCAGG - Intergenic
1033616441 7:143020736-143020758 GGGTTCCTCTTTTGGAACCTTGG - Intergenic
1041547725 8:59064923-59064945 GTGGGCCCCTTTTAGAAACCTGG - Intronic
1045946705 8:107804839-107804861 GTGGTCCCCTTTTGGCACCAAGG + Intergenic
1048706717 8:137161848-137161870 GTGGTCCTCTTCTGGCAGCATGG - Intergenic
1057974743 9:99593457-99593479 GAGGTACTCTGTTGGAAGGCTGG - Intergenic
1060798196 9:126526739-126526761 GTGGTCCTCCTGGGGTAGCCAGG + Intergenic
1061241629 9:129377853-129377875 GTGGTCCTCTTCTGGGAGATGGG - Intergenic
1062105932 9:134754797-134754819 TGTGTCCTCTTTTAGAAGCCAGG - Intronic
1062724624 9:138064848-138064870 GTGGTTCTCTTCTGCAGGCCAGG - Intronic
1188727118 X:33599392-33599414 GTGGTCTTTATTTGGAAGCTTGG - Intergenic
1192736000 X:73850524-73850546 GTGTTCCTCTTGAGGAAGGCAGG + Intergenic
1195095742 X:101499517-101499539 GTGGATCTCTTTTGCATGCCAGG + Intronic
1197010900 X:121561982-121562004 CTAGTCATCTTTTGGAAGGCAGG + Intergenic
1198494176 X:137174081-137174103 GTAGTCCTCTTCTGGCAGCATGG - Intergenic