ID: 972610369

View in Genome Browser
Species Human (GRCh38)
Location 4:40650612-40650634
Sequence CTGTCTCAAAAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972610369_972610370 -2 Left 972610369 4:40650612-40650634 CCTCTCTTCTTCTTTTGAGACAG No data
Right 972610370 4:40650633-40650655 AGAGTCTTACTCTGTTGCACAGG 0: 8
1: 866
2: 18167
3: 70653
4: 149045
972610369_972610372 12 Left 972610369 4:40650612-40650634 CCTCTCTTCTTCTTTTGAGACAG No data
Right 972610372 4:40650647-40650669 TTGCACAGGCTGGAGTGCAGTGG 0: 597
1: 71609
2: 181811
3: 231665
4: 190728
972610369_972610373 23 Left 972610369 4:40650612-40650634 CCTCTCTTCTTCTTTTGAGACAG No data
Right 972610373 4:40650658-40650680 GGAGTGCAGTGGCACAATCTTGG 0: 14825
1: 56358
2: 118884
3: 139454
4: 107895
972610369_972610371 2 Left 972610369 4:40650612-40650634 CCTCTCTTCTTCTTTTGAGACAG No data
Right 972610371 4:40650637-40650659 TCTTACTCTGTTGCACAGGCTGG 0: 26
1: 2554
2: 51789
3: 139011
4: 235310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972610369 Original CRISPR CTGTCTCAAAAGAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr