ID: 972613115

View in Genome Browser
Species Human (GRCh38)
Location 4:40673442-40673464
Sequence GTGTCCTCACCTAGAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972613110_972613115 30 Left 972613110 4:40673389-40673411 CCAGGTTTTCTGCTAAGAGCCTT No data
Right 972613115 4:40673442-40673464 GTGTCCTCACCTAGAGCTCAGGG No data
972613111_972613115 11 Left 972613111 4:40673408-40673430 CCTTGAAACGCTGAAATCAAGAT No data
Right 972613115 4:40673442-40673464 GTGTCCTCACCTAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972613115 Original CRISPR GTGTCCTCACCTAGAGCTCA GGG Intergenic
No off target data available for this crispr