ID: 972614096

View in Genome Browser
Species Human (GRCh38)
Location 4:40681545-40681567
Sequence TGGAGTCTCGCTGTCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972614096_972614099 23 Left 972614096 4:40681545-40681567 CCCTGGGTGACAGCGAGACTCCA No data
Right 972614099 4:40681591-40681613 GAAAAAAGAAAAGTGTCCATTGG No data
972614096_972614100 29 Left 972614096 4:40681545-40681567 CCCTGGGTGACAGCGAGACTCCA No data
Right 972614100 4:40681597-40681619 AGAAAAGTGTCCATTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972614096 Original CRISPR TGGAGTCTCGCTGTCACCCA GGG (reversed) Intergenic
No off target data available for this crispr