ID: 972614482

View in Genome Browser
Species Human (GRCh38)
Location 4:40685125-40685147
Sequence TGGCCTTCCTTGGGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972614482_972614490 -1 Left 972614482 4:40685125-40685147 CCACTTTTTCCCAAGGAAGGCCA No data
Right 972614490 4:40685147-40685169 ACAGGGATGGGAGATGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972614482 Original CRISPR TGGCCTTCCTTGGGAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr