ID: 972618041

View in Genome Browser
Species Human (GRCh38)
Location 4:40719112-40719134
Sequence CTGGACTCCCTGTGTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972618041_972618045 15 Left 972618041 4:40719112-40719134 CCTGTGTTACACAGGGAGTCCAG No data
Right 972618045 4:40719150-40719172 GACTCCTAACCAATCGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972618041 Original CRISPR CTGGACTCCCTGTGTAACAC AGG (reversed) Intergenic
No off target data available for this crispr