ID: 972620822

View in Genome Browser
Species Human (GRCh38)
Location 4:40746795-40746817
Sequence GAAACTCTGGGGACTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972620822_972620829 -5 Left 972620822 4:40746795-40746817 CCTGCCCTAGTCCCCAGAGTTTC No data
Right 972620829 4:40746813-40746835 GTTTCAATTGGATATAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972620822 Original CRISPR GAAACTCTGGGGACTAGGGC AGG (reversed) Intergenic
No off target data available for this crispr