ID: 972624029

View in Genome Browser
Species Human (GRCh38)
Location 4:40778527-40778549
Sequence CTGTATCCTCAGATGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2326
Summary {0: 1, 1: 3, 2: 106, 3: 643, 4: 1573}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972624029_972624033 6 Left 972624029 4:40778527-40778549 CCTTTCACCATCTGAGGATACAG 0: 1
1: 3
2: 106
3: 643
4: 1573
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972624029 Original CRISPR CTGTATCCTCAGATGGTGAA AGG (reversed) Intronic
Too many off-targets to display for this crispr