ID: 972624033

View in Genome Browser
Species Human (GRCh38)
Location 4:40778556-40778578
Sequence GGCACTATCTGTAAGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972624023_972624033 25 Left 972624023 4:40778508-40778530 CCAGGGACCTAGGTAGCCCCCTT 0: 1
1: 0
2: 2
3: 16
4: 140
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624031_972624033 -1 Left 972624031 4:40778534-40778556 CCATCTGAGGATACAGCAGGAAG 0: 1
1: 3
2: 134
3: 840
4: 2478
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624021_972624033 27 Left 972624021 4:40778506-40778528 CCCCAGGGACCTAGGTAGCCCCC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624024_972624033 18 Left 972624024 4:40778515-40778537 CCTAGGTAGCCCCCTTTCACCAT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624027_972624033 8 Left 972624027 4:40778525-40778547 CCCCTTTCACCATCTGAGGATAC 0: 1
1: 4
2: 72
3: 390
4: 1015
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624029_972624033 6 Left 972624029 4:40778527-40778549 CCTTTCACCATCTGAGGATACAG 0: 1
1: 3
2: 106
3: 643
4: 1573
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624022_972624033 26 Left 972624022 4:40778507-40778529 CCCAGGGACCTAGGTAGCCCCCT 0: 1
1: 0
2: 0
3: 17
4: 132
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624026_972624033 9 Left 972624026 4:40778524-40778546 CCCCCTTTCACCATCTGAGGATA 0: 1
1: 1
2: 10
3: 89
4: 411
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
972624028_972624033 7 Left 972624028 4:40778526-40778548 CCCTTTCACCATCTGAGGATACA 0: 1
1: 6
2: 91
3: 595
4: 1443
Right 972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972624033 Original CRISPR GGCACTATCTGTAAGAAAGC AGG Intronic
904743291 1:32695132-32695154 GGCACTTTCTCCAGGAAAGCCGG - Exonic
905496764 1:38395393-38395415 GGCACTGTCTATAAGAAAACAGG + Intergenic
905511600 1:38525886-38525908 GACACTATCAGAAATAAAGCAGG + Intergenic
910544638 1:88400081-88400103 GGCAGCATCTATGAGAAAGCAGG - Intergenic
913067679 1:115271602-115271624 GGCACCATCTATAAGGAAGCAGG - Intergenic
913240040 1:116822051-116822073 GGCACTGTCTGTGAGAAAGCAGG - Intergenic
914356061 1:146885639-146885661 TTCACTACCTGGAAGAAAGCAGG - Intergenic
917397204 1:174606344-174606366 GGCACAATCTGAAAGACAGTGGG - Intronic
921363700 1:214354040-214354062 AGCACAAGCTGAAAGAAAGCAGG + Exonic
1065247153 10:23769845-23769867 GGCAAAATCTGTGAGAAAGTTGG - Intronic
1068052464 10:51967808-51967830 GGCACATTCTGCAAGAAAGAGGG - Intronic
1069338004 10:67376017-67376039 GGCACTGTCTATGAGAAAGTGGG + Intronic
1069659108 10:70111848-70111870 GCCTCCATCTGTAAGGAAGCAGG + Exonic
1069820527 10:71224832-71224854 GGCAATATCAGAAAGAAAGAAGG - Intronic
1074139773 10:110661629-110661651 TGCCTTCTCTGTAAGAAAGCAGG + Intronic
1083068869 11:59955580-59955602 GGCACACTGTGTAGGAAAGCAGG - Intergenic
1083410984 11:62492197-62492219 GGAACAATGTGTAAGAAAGGAGG + Intronic
1084031484 11:66483600-66483622 GGCACTGTTTGTAAGAAAAACGG - Intronic
1085074785 11:73581294-73581316 GACAGTATCTTTAATAAAGCTGG + Intronic
1086727004 11:90198893-90198915 GGCACTATCTCTAAAATACCAGG - Intergenic
1088144594 11:106660636-106660658 GGCACCATCTATGAGGAAGCTGG + Intergenic
1092068096 12:5609201-5609223 GTGACTTTCTGTCAGAAAGCAGG + Intronic
1092102433 12:5896477-5896499 GGCACTGTATGTATTAAAGCTGG - Intronic
1097418259 12:59341018-59341040 GGTTCTACCTGGAAGAAAGCAGG - Intergenic
1100053658 12:90482820-90482842 GGAACTATCTCTAAGAAATCTGG + Intergenic
1100705063 12:97191609-97191631 GTAACAATGTGTAAGAAAGCAGG - Intergenic
1101757601 12:107633263-107633285 GGCACCATCTATGAGAAAGTGGG + Intronic
1102005513 12:109586934-109586956 TGCACTAGCTGCAAGGAAGCAGG + Intronic
1104796668 12:131524885-131524907 AACACTACCTGAAAGAAAGCTGG + Intergenic
1105683108 13:22750223-22750245 AGCAAAACCTGTAAGAAAGCAGG - Intergenic
1107057166 13:36118862-36118884 GGCACCATCTGTGAGGAAGTGGG - Intronic
1109478090 13:62911477-62911499 GGCACAGTCTATAAGAAAGCAGG - Intergenic
1110813781 13:79839640-79839662 GGCAGTATCTAAAAGAAATCAGG + Intergenic
1111742722 13:92224831-92224853 GGCAAAGTCTGTAAGAAACCAGG - Intronic
1114511239 14:23263121-23263143 GACAGTATCTTTAATAAAGCTGG - Intronic
1116948512 14:50857772-50857794 GGCTCCATCTATGAGAAAGCAGG - Intergenic
1120516584 14:85478089-85478111 CGCTCTGTCTCTAAGAAAGCTGG + Intergenic
1121167554 14:91821097-91821119 GTCAATTTCTGTAAAAAAGCTGG - Intronic
1123810333 15:23918450-23918472 ACCACTATTTGTAAGAAAGCAGG - Intergenic
1125547524 15:40517397-40517419 GGAACATTCTGTAAGAAAGCTGG + Intergenic
1129907780 15:79201618-79201640 GGCACTGTCTGTGAGGAAGTGGG - Intergenic
1131753513 15:95535716-95535738 GACAATGTCTGTAAGAGAGCTGG + Intergenic
1131788150 15:95935065-95935087 GTTACCATCTGTGAGAAAGCTGG + Intergenic
1133137938 16:3725187-3725209 GGAAATTTCTGTAAGAAACCTGG - Exonic
1133205858 16:4233086-4233108 GGGGCTATCTGGAAGAAAACAGG + Intronic
1135856717 16:26018351-26018373 GGAACTAACAGTAAGAAACCAGG + Intronic
1136562678 16:31049673-31049695 GGCAGTATTTGTAAGGAAGAGGG + Intergenic
1139977955 16:70829823-70829845 TTCACTACCTGGAAGAAAGCAGG + Exonic
1141010248 16:80390096-80390118 GGGACCATCTGTAAGAATGTCGG - Intergenic
1149464831 17:56869572-56869594 GGCACTGTTTAAAAGAAAGCAGG - Intergenic
1149956720 17:61059585-61059607 GGCAGTATCTGTCATAAAGTAGG - Intronic
1151206584 17:72512627-72512649 GAAAATATCTGTAAGAAAGCTGG + Intergenic
1151455699 17:74224611-74224633 GGCACCAGCAGTAAGAAAACAGG + Intronic
1151652566 17:75479165-75479187 GGCACAATGAGCAAGAAAGCAGG + Intronic
1152396010 17:80033917-80033939 GGCACCCTCTGTAAGACAGAGGG + Intronic
1153189683 18:2523884-2523906 GACACTAATTATAAGAAAGCTGG + Intergenic
1157517908 18:48324045-48324067 GGCACCATCTATGAGAAAGTGGG + Intronic
1160065344 18:75568760-75568782 GGCACAATCGGGAAGAAAGCTGG - Intergenic
1160202623 18:76808020-76808042 GGGACTATTTGTAACAAACCCGG - Intronic
926759945 2:16269621-16269643 AGCACTATATGCAAGAAAGAGGG + Intergenic
928306057 2:30171326-30171348 GGCACCATCTGTAAGGAGGCAGG - Intergenic
929273138 2:39996404-39996426 GACATTATTTGGAAGAAAGCAGG - Intergenic
937490329 2:122360065-122360087 GGGAATATCTGTAAGCAAGAGGG + Intergenic
938651764 2:133390503-133390525 AGCATTTTCTGTAAGAAACCAGG - Intronic
939410865 2:141823123-141823145 TGCCCTATCTGTAAGAGAGATGG - Intronic
940749981 2:157614803-157614825 CACACTAACTATAAGAAAGCTGG - Intronic
941629731 2:167870798-167870820 GACACTGTCTGGAAGGAAGCAGG - Exonic
947923642 2:233901836-233901858 GGCTGTATCTGTAAGAGGGCAGG - Intergenic
1170861751 20:20110983-20111005 GGCAACATGTGTAAGATAGCAGG + Intronic
1170910445 20:20561407-20561429 GGCACTGTATGTATGAAAGGAGG - Intronic
1173209696 20:41022611-41022633 GTCAGTATCAATAAGAAAGCTGG - Intergenic
1174764877 20:53243752-53243774 GGCACTATCAGAAAGCAGGCTGG - Intronic
1182249633 22:28989799-28989821 GGCATTGTCTGTAAGTACGCGGG - Intronic
949672257 3:6412681-6412703 GTAACAATGTGTAAGAAAGCAGG - Intergenic
950205129 3:11074214-11074236 GTAACTATGTGTAAGAAAACAGG - Intergenic
953498104 3:43406048-43406070 GGCCCTATCAGTATGAAAGCAGG + Intronic
954956094 3:54519291-54519313 GGCAGGGGCTGTAAGAAAGCGGG + Intronic
956680571 3:71775713-71775735 AGCAAAATCTGGAAGAAAGCAGG - Intronic
960084266 3:113573741-113573763 GGCACCATCTATGAGGAAGCAGG + Intronic
961927172 3:130493303-130493325 GGCACCATCTATGAGAAAGCAGG + Intergenic
962982360 3:140502090-140502112 GGCACAAAATGTATGAAAGCAGG + Intronic
963015491 3:140820491-140820513 GGCACTAATTGTACCAAAGCTGG + Intergenic
965041308 3:163510684-163510706 GGCACTATGTATTATAAAGCAGG - Intergenic
965799789 3:172479840-172479862 GTAACTATGTGTGAGAAAGCAGG - Intergenic
971124030 4:23732876-23732898 GGCACTATTTGTAAACAAACAGG - Intergenic
971670068 4:29544977-29544999 GGCACTATCTGTGAAGAAGTGGG + Intergenic
971743285 4:30547090-30547112 GGCACCATCTCTGAGGAAGCAGG + Intergenic
972624033 4:40778556-40778578 GGCACTATCTGTAAGAAAGCAGG + Intronic
973045274 4:45529424-45529446 GTAACAATGTGTAAGAAAGCAGG - Intergenic
976776436 4:88711298-88711320 GGCACAATCTGTGAGAAAGTAGG + Intergenic
977170154 4:93751890-93751912 GGGAGTATGGGTAAGAAAGCAGG - Intronic
977306060 4:95324785-95324807 GGCACCATCTAGAAGGAAGCAGG + Intronic
979091912 4:116493936-116493958 TGTACTATATGTAAGGAAGCAGG + Intergenic
981555359 4:145987601-145987623 GGCCCTATCTGTATGTAAACAGG - Intergenic
981661491 4:147172416-147172438 GGCACTATCTATGAGAAACAGGG - Intergenic
982076257 4:151740080-151740102 GCTATTATCTGTAATAAAGCTGG + Intronic
982152699 4:152479525-152479547 GGGACATTCTGTAAGAAAACTGG - Intronic
987798462 5:22661752-22661774 GCCATTTACTGTAAGAAAGCTGG + Intronic
989405118 5:41051710-41051732 AGCACCATCTGTTAGGAAGCAGG + Intronic
994163274 5:96580969-96580991 GGCACCATCTATGAGAAAGCAGG + Intronic
996516629 5:124377351-124377373 TGCAGTATCCGTAAGAAAGATGG - Intergenic
1002063258 5:176639167-176639189 AGAACTTTCTGTAGGAAAGCAGG + Intronic
1002547000 5:179955620-179955642 GGCAAAATCAGTCAGAAAGCAGG + Exonic
1003035954 6:2640328-2640350 GGCACTGTTTGTATGAGAGCTGG + Intergenic
1003811071 6:9781507-9781529 AACACTGTATGTAAGAAAGCTGG - Intronic
1003980918 6:11388964-11388986 GGCACTATCTATGAGGAAGAGGG + Intergenic
1007767852 6:44171518-44171540 GGCTCTGTCTCAAAGAAAGCAGG + Intronic
1007833124 6:44654063-44654085 GGAACTATCCGGAAGACAGCTGG + Intergenic
1011799268 6:90992463-90992485 GGGTCTATCTGTAGGAATGCTGG - Intergenic
1013051110 6:106536094-106536116 GGCACACTCTCTAAGACAGCTGG - Intronic
1013825964 6:114212103-114212125 AGCATTATCTGTTAGCAAGCAGG - Intronic
1014572674 6:123029823-123029845 GGCAGTATTTGTAAGAAATATGG - Intronic
1018545063 6:164926550-164926572 GGCACCATTTGTCAGGAAGCAGG - Intergenic
1019902808 7:4036766-4036788 GGCACCATCTCTAAGAAAACAGG + Intronic
1019963979 7:4484154-4484176 GTAACTATGTGTAAGAAAACAGG + Intergenic
1022305554 7:29143558-29143580 GGCACTATCTTTTTGAAAGAGGG + Intronic
1027670986 7:81098891-81098913 GGCCTTACCTGTTAGAAAGCAGG + Intergenic
1027679689 7:81204946-81204968 GGCACTATCTGTAAATATGTAGG - Intergenic
1029945572 7:104529286-104529308 GGGCCTATCTGTGAGAAATCTGG - Intronic
1030942706 7:115674419-115674441 TTCATTATCTGTAAGAAACCTGG - Intergenic
1031165662 7:118224510-118224532 GAGGCTATTTGTAAGAAAGCTGG + Intronic
1031602698 7:123731086-123731108 AACACTAACTGAAAGAAAGCTGG + Intronic
1033588621 7:142792507-142792529 GCCACAGTCTGAAAGAAAGCAGG - Intergenic
1035150345 7:156865550-156865572 GTCAATTTCTGTAAGAAAGTAGG - Intronic
1038512199 8:28149045-28149067 GGCACCATCTGTGAGAAAGTGGG + Intronic
1038721234 8:30037377-30037399 GGCTCTATTTGTAAGAATGGTGG - Intergenic
1042628630 8:70790887-70790909 GGCACCATTTATAAGGAAGCAGG - Intergenic
1043540486 8:81256515-81256537 GTCACTCTCTGAAAAAAAGCTGG - Intergenic
1045123870 8:99068113-99068135 GGAAGTATCTGTAAGAAAATGGG - Intronic
1046691174 8:117286296-117286318 CACCCTATCTGTAAGAAACCTGG - Intergenic
1047103215 8:121703857-121703879 GGCACTATAGGTTAGAAATCTGG - Intergenic
1048552803 8:135449295-135449317 GGGACTAGCTGTAAGCAACCAGG - Intergenic
1051043174 9:12840223-12840245 GGCACAATCTATGAGAAAACAGG + Intergenic
1051820956 9:21167303-21167325 GGCAATATCTGGATGAATGCTGG - Intergenic
1051880510 9:21835088-21835110 GGTGCTATCTGTGAGAAAGTAGG - Intronic
1052596562 9:30568031-30568053 GGCACTATCTATGAGAAAACCGG - Intergenic
1056100287 9:83294225-83294247 GGCACCATCTATGAGGAAGCAGG + Intronic
1058778134 9:108305699-108305721 AGAACAATCTGTAAGATAGCAGG - Intergenic
1059384272 9:113951948-113951970 GGCAGTCACTGAAAGAAAGCGGG - Intronic
1203626180 Un_KI270750v1:25818-25840 GGCAGTAACCGCAAGAAAGCTGG + Intergenic
1187948360 X:24448196-24448218 GGCACCATCTTTGAGAAAGCAGG - Intergenic
1189074147 X:37898129-37898151 GGCACTATCTCTGAGGAAGAAGG - Intronic
1190101773 X:47527636-47527658 GGCAAGTTCTGTCAGAAAGCAGG + Intergenic
1192392071 X:70740291-70740313 GGCACTGTCTTTGAGTAAGCAGG - Intronic
1193416924 X:81236982-81237004 GGAACCTTCAGTAAGAAAGCAGG + Intronic
1196651017 X:118168475-118168497 GGCACTATGTGTCAGTAACCAGG - Intergenic
1198723633 X:139652744-139652766 GGCACTTTGTGTCAGAGAGCAGG - Intronic
1200835685 Y:7729121-7729143 GCCACTTTCTGTGTGAAAGCTGG + Intergenic
1201461789 Y:14233346-14233368 GGCACTATGTAGAAGAAAGGAGG - Intergenic