ID: 972624106

View in Genome Browser
Species Human (GRCh38)
Location 4:40779314-40779336
Sequence CCACAGTGCCTGGCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 1, 2: 22, 3: 169, 4: 960}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972624106_972624109 4 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624109 4:40779341-40779363 CGCTTGTAATCCCAGCACTTTGG 0: 4214
1: 133667
2: 277190
3: 221574
4: 152657
972624106_972624115 18 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624115 4:40779355-40779377 GCACTTTGGGAGGCCGAGGCTGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
972624106_972624113 14 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624113 4:40779351-40779373 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
972624106_972624110 5 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624110 4:40779342-40779364 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
972624106_972624117 30 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624117 4:40779367-40779389 GCCGAGGCTGGCGGATCACAAGG 0: 68
1: 4059
2: 29134
3: 57220
4: 69805
972624106_972624116 21 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624116 4:40779358-40779380 CTTTGGGAGGCCGAGGCTGGCGG 0: 1587
1: 70998
2: 171225
3: 179455
4: 124446
972624106_972624111 8 Left 972624106 4:40779314-40779336 CCTGTCTCTGCCAGGCACTGTGG 0: 1
1: 1
2: 22
3: 169
4: 960
Right 972624111 4:40779345-40779367 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972624106 Original CRISPR CCACAGTGCCTGGCAGAGAC AGG (reversed) Intronic
900089512 1:913726-913748 CCTCAGTGCCAGGCAGTGTCAGG + Intergenic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900983125 1:6057861-6057883 CCACTGTGCCTGGCCATGACTGG - Intronic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901541669 1:9921677-9921699 CCACTGCGCCCGGCTGAGACAGG + Intergenic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901795849 1:11679328-11679350 CCTGAGTGCCTTCCAGAGACAGG + Intronic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902172823 1:14626915-14626937 GCACAGTCCCTGGCAGAGTCTGG - Intronic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902490918 1:16779818-16779840 GCACAGTGGCTGGCACAGAGTGG + Intronic
902518878 1:17004786-17004808 CCACAGTCCCAGGCAGAGGATGG - Exonic
902617293 1:17630765-17630787 CCTCAGTGCCTGGCACACCCTGG + Intronic
903231179 1:21923117-21923139 CCACCGTGCCCGGCTGAGTCTGG - Intronic
903344711 1:22676956-22676978 CCCCAGTGCGCGGCAGAGCCGGG - Intergenic
903361901 1:22782270-22782292 ACACAATGCCTGGCATAGATTGG + Intronic
903680692 1:25094698-25094720 CACCAGTCTCTGGCAGAGACAGG + Intergenic
903834409 1:26193607-26193629 GCACAGTGCCTGGCACGCACAGG + Intronic
904121086 1:28198277-28198299 CAACAGTGTCTGGCACAGAAGGG - Intergenic
904168810 1:28576602-28576624 CCACCGCGCCCGGCCGAGACGGG + Intronic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904272369 1:29358569-29358591 GCACAGAGCCTGGCACAGAGTGG - Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904894075 1:33800918-33800940 GCACAGGGCCTGGCACAGAGAGG + Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905186294 1:36199426-36199448 CCACCGTGCCTGGCCTGGACTGG - Intergenic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905595154 1:39200409-39200431 CCACTGTGCCTGGCCCAGGCTGG - Intronic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
905815890 1:40950574-40950596 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
905961897 1:42050044-42050066 CCACAGAGCCACGCAGAGAAGGG - Intergenic
906130040 1:43450531-43450553 CCAGATTGCCTGCCAGAGGCAGG + Exonic
906207972 1:43997135-43997157 CAAATGTGCCTGGCAGAGGCTGG + Intronic
906208120 1:43997704-43997726 CCACAAAGCCAAGCAGAGACTGG - Exonic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
907372363 1:54011677-54011699 CCCCAGTGCCTAGCACAGAGGGG - Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
908011429 1:59781821-59781843 GCACAGTGCCGGGCATAGAGTGG - Intergenic
908244142 1:62214411-62214433 CCACTGTGCCCGGCAGAGCAAGG - Intergenic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
908758688 1:67492323-67492345 CCACTGCGCCCGGCAGAAACTGG - Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
909116283 1:71541250-71541272 GCACAGTGACTGGCATATACAGG + Intronic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910779537 1:90913844-90913866 CCACTGCGCCTGGCCCAGACTGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911616691 1:100020619-100020641 CCACAGTGCCTAGCATATATAGG - Intronic
912369496 1:109163009-109163031 GCTCAGTGACTGGCACAGACTGG - Intronic
912417060 1:109516483-109516505 ACACAGTGGGTGGCAGAGCCAGG - Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
912956828 1:114159982-114160004 CCCATGTGCCTGGCACAGACTGG - Intergenic
913086860 1:115446945-115446967 TCAGAGTGCCTGGCACAGGCAGG - Intergenic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914795898 1:150920149-150920171 CCACAGTGCCCGGCCAAGAAGGG - Intergenic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915229137 1:154432866-154432888 CTGCAGGGCCTGGAAGAGACAGG + Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
915485761 1:156219502-156219524 CCACATGCACTGGCAGAGACAGG - Intronic
916099593 1:161382884-161382906 CTTCAGTTCCTGGCAGGGACGGG + Intergenic
916247461 1:162703623-162703645 ACACAGTGCCTTCCACAGACAGG - Intronic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
916789522 1:168112995-168113017 CCAGACCTCCTGGCAGAGACTGG - Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917512325 1:175678736-175678758 CCAAAGGGCTTGGCAGAGACAGG + Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
918082608 1:181218993-181219015 CCACAGTGCCTCCTAGAGCCTGG - Intergenic
918122806 1:181554617-181554639 GCTCAGTGCCTGGCACAGGCTGG - Intronic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918296008 1:183158066-183158088 CCACTGTGCCTGGCCGTCACTGG - Intergenic
918371499 1:183866257-183866279 GCACAATGCCTGGCAGACAGTGG - Intronic
918491936 1:185090205-185090227 CCATCGTGCCTGGCCGAGGCTGG + Intronic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919406644 1:197193248-197193270 CCACCGTGCCTGGCTGTGCCAGG - Intronic
919919318 1:202158997-202159019 CCACAGGGCCTGGCTGGGAGTGG - Intronic
920341592 1:205278570-205278592 CCATAGGGCCTGGCGGGGACAGG + Intergenic
920363084 1:205432719-205432741 CCACTGTGCCTGGCTGAGGTGGG - Intronic
920822785 1:209396976-209396998 GCACAGTCACTGGCTGAGACAGG + Intergenic
920962053 1:210672035-210672057 GCACAGTGCCTGGCATAGCATGG - Intronic
921034927 1:211367843-211367865 GGACAGTGCCTGGCACAGAGAGG - Intronic
921472966 1:215569705-215569727 TCACAGTGCCAGGCTGAGACAGG - Intronic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921667223 1:217887533-217887555 GAACAGTGCCTGGCATAGAAGGG - Intergenic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922483010 1:225952146-225952168 CCACAGTGCCCGGCAGTATCAGG - Intergenic
922697620 1:227739310-227739332 CCACTGTGCCTGGCCAGGACGGG + Intronic
922739008 1:228005346-228005368 CCGCAGTGCCTGGGAGAAGCGGG + Intergenic
922788355 1:228294967-228294989 CCCCAGTGTCTGCCACAGACAGG - Exonic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
923223944 1:231922099-231922121 CCAAAGTGCATGGCAGAATCAGG - Intronic
923485510 1:234426184-234426206 CGATAGTGCATGGTAGAGACAGG - Intronic
923529527 1:234802718-234802740 GCACAGTGGCTGGCACAGACTGG - Intergenic
924188794 1:241525823-241525845 CCAGAGTGCCTGAAAGAGAAAGG - Intergenic
924440360 1:244080772-244080794 CCACCGTGCCGGTCAGAGACAGG - Intergenic
924809244 1:247386778-247386800 CCACTGTGCCCGGCTTAGACTGG + Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063590828 10:7394148-7394170 CCACCATGTCTGGTAGAGACGGG + Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1063920643 10:10928854-10928876 CCCCAGTGCCTAGCAGTGCCTGG + Intergenic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064190321 10:13200362-13200384 CCTCTGTGGCTGGCAGGGACCGG - Intronic
1064193415 10:13226703-13226725 TTACAGTGCCTGGCAGAGCAAGG + Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064294133 10:14062774-14062796 CCACTGTGCCTGGCCAGGACTGG - Intronic
1064577559 10:16761567-16761589 CCACCGTGCCCGGCTGAGAATGG - Intronic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1066253592 10:33656940-33656962 CCACCATGCCTGGCTGAGATTGG + Intergenic
1067570697 10:47368928-47368950 CCACAGGGCCCTGCAGAGAGAGG + Exonic
1067761783 10:49054010-49054032 CCACAGTGCCTTGCATAGGATGG - Intronic
1069415992 10:68201477-68201499 CCACTGTGCCTGGTGGAGAAGGG - Intronic
1069729540 10:70601938-70601960 CCACAGAGCTTGGCAGGGAGTGG - Intronic
1069789926 10:71013021-71013043 CCTCAGCGCCTGGCAGGGAGGGG + Intergenic
1069827530 10:71263234-71263256 ACACAGTTCCTGGCAGAGCTGGG - Intronic
1069842430 10:71348172-71348194 GCACAGGGCCTGGCAGGCACTGG - Intronic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071671447 10:87612735-87612757 CCACTGTGCCCGGCCAAGACTGG - Intergenic
1072038359 10:91584842-91584864 CCCCAGTGTCTTGCAGAGCCGGG - Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1073237158 10:102026944-102026966 CCACAGTACCTGGCATATAGGGG + Intronic
1073493678 10:103872498-103872520 CCACACAGCCTGGCAGGAACAGG + Intergenic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1073771074 10:106736479-106736501 CCAAAGTGCCTGGCAGGTATTGG + Intronic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074508086 10:114088843-114088865 GCACTGTGCCAGGCAGAGTCGGG - Intergenic
1074718271 10:116240753-116240775 ACACAGTGCTTGGCATAGAGTGG + Intronic
1074943042 10:118253793-118253815 CCCCAGTGCATGGCAGCAACGGG - Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1076014037 10:127013591-127013613 CCAGTGAGCCTGGCAGAGGCAGG - Intronic
1076384227 10:130045450-130045472 CCACAGTGCCCCGCAGACAGTGG + Intergenic
1076505520 10:130970548-130970570 CCACAGTGGATGGCAGAGGTGGG - Intergenic
1076767706 10:132645751-132645773 CACCAGGGTCTGGCAGAGACGGG - Intronic
1076875353 10:133213164-133213186 CCAGAGTGCTGGGCAGAGGCAGG - Intronic
1077021522 11:419198-419220 CCACTTTCCCTGCCAGAGACTGG + Intronic
1077024294 11:432444-432466 CCACTGTGCAGAGCAGAGACTGG + Intronic
1077274758 11:1699308-1699330 CCACCGCGCCCAGCAGAGACGGG + Intergenic
1077298686 11:1837616-1837638 CCTCAGGGCCTGGCTGAGTCTGG - Intergenic
1077443941 11:2581507-2581529 TGACAGTGGCTGGCAGAGAGGGG - Intronic
1077563588 11:3281856-3281878 CCACAGAGCCTGGCAAAGGTGGG + Intergenic
1077636435 11:3844677-3844699 CCACTGGGCCTGACAGAGGCAGG + Intergenic
1077704228 11:4468566-4468588 CCACAGTGTTTGGCACAGAAAGG - Intergenic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078066494 11:8082302-8082324 CCACAGTGCCTGGCAGCAGAGGG - Intronic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078463279 11:11531476-11531498 GCACAGAGCCTGGCAGAGAAAGG - Intronic
1078536506 11:12179266-12179288 CTACAGTGCTGGGCAGAGGCAGG - Intronic
1078541469 11:12216919-12216941 GCACAGTGCCCGGCAGAGGGTGG + Intronic
1079363672 11:19791150-19791172 GCACAGTTCCTGGCCGAGAATGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1080104913 11:28501810-28501832 CCACCGCGCCTGGCCGAGCCAGG - Intergenic
1080173536 11:29335057-29335079 CCACAGAGACTGGCAGATACAGG + Intergenic
1080442248 11:32305445-32305467 TCACAGTGCCTGGCAAAGGTAGG + Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1080651306 11:34224735-34224757 ACATAGTCCCTGGCAAAGACTGG + Intronic
1080689957 11:34548339-34548361 CCACTGTGTCTGGCTGAGCCAGG + Intergenic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081740820 11:45438725-45438747 CCACTGCGCCTGGCTGAGTCTGG + Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1082030053 11:47597304-47597326 CCACTGCGCCTGGCTGAGATAGG + Intergenic
1083146857 11:60766458-60766480 GCACAGTGCTTAGCATAGACAGG + Intronic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084371446 11:68747477-68747499 CCACCATGCCTAGTAGAGACAGG - Intronic
1084377000 11:68784387-68784409 CCACCATGCCTAGTAGAGACAGG - Intronic
1084946785 11:72642779-72642801 CCAGAGCCCCAGGCAGAGACCGG + Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085215097 11:74822755-74822777 GCACAGTGCCTGACAGATAATGG + Intronic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085300037 11:75452583-75452605 ACGCAGTGCCTGGCACACACAGG + Intronic
1085404127 11:76251726-76251748 CCCCAGTTCCTGGCAGCTACTGG - Intergenic
1085452292 11:76641912-76641934 CCTCAGGGCCTGGCAGAGCCTGG + Intergenic
1085618182 11:78017703-78017725 CCACAGTGCCCGGCCGAGGGTGG + Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1086053027 11:82616439-82616461 ACACAGAGCAAGGCAGAGACAGG - Intergenic
1086927166 11:92652873-92652895 CCACTGTGCCTGTCTGAGAAGGG - Intronic
1088221966 11:107579010-107579032 CCACAGTCCATGGAAGTGACAGG + Intergenic
1088533148 11:110832192-110832214 ACACAGTGCCCAGCACAGACAGG - Intergenic
1089297611 11:117479576-117479598 CCACAGTGCCTCACAGTGGCGGG + Intronic
1089421860 11:118338098-118338120 CCACTGCACCTGGCTGAGACAGG - Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1089751357 11:120653713-120653735 CCTCAGTGCCTAGCACAGGCTGG - Exonic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090410884 11:126508858-126508880 GCACAGTGCCTGTCATAGAGTGG + Intronic
1091054758 11:132407449-132407471 CGACAGTGCCTGGCACAGGGTGG - Intergenic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1091461693 12:647905-647927 CCACAGAGCCTGGAAGCGGCAGG - Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1091758713 12:3073112-3073134 CCACTGCGCCTGGCCGAGAGTGG + Intergenic
1092074450 12:5661616-5661638 CCACTGTGACAGGCAGAGGCTGG + Intronic
1092351672 12:7761067-7761089 CCACTGTGCCCGGCTGAGAATGG - Intergenic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1093925794 12:24907190-24907212 TGACAGTGCCTGGCAAAGGCAGG - Intronic
1094422228 12:30282808-30282830 GCACAGTGCCTAGCAGAGTAAGG - Intergenic
1094547071 12:31414643-31414665 CCACTGTGCCCGGCCGAGATGGG - Intronic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1095883672 12:47166155-47166177 CCACAGAGCCTGGGAGACAGGGG - Intronic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096168827 12:49449499-49449521 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1096436074 12:51591701-51591723 CCTCAGTGCCGGGCAGAGTTGGG + Intronic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1097231102 12:57511729-57511751 GGACATTGCCTGGCAGTGACTGG + Exonic
1097338274 12:58409036-58409058 ACACAGTGCCTGGTATAGAGTGG - Intergenic
1098227790 12:68342652-68342674 GCACAGTACTTGGAAGAGACTGG - Intergenic
1098231585 12:68376518-68376540 ACACATTGCCTGGCAGAAGCAGG + Intergenic
1098391586 12:69975312-69975334 CCACAGGGCCTGGCAAATTCTGG - Intergenic
1100004605 12:89879562-89879584 ACACAGTACCTGGCAGATAGGGG + Intergenic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100780345 12:98018976-98018998 TCAGAGTCCCAGGCAGAGACAGG + Intergenic
1100858971 12:98784469-98784491 CCACAGTGGCTGGCTCACACAGG + Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101334670 12:103785849-103785871 CCAGAGGGCCTGGCACACACAGG - Intronic
1101598611 12:106189199-106189221 AGACAGTGCCTGGCACAGCCCGG - Intergenic
1101857789 12:108458281-108458303 CAACAGTGCCTGGCCCAGAGTGG + Intergenic
1101877213 12:108603717-108603739 GCACAGTTCCTGGCACACACAGG - Intergenic
1101981092 12:109407372-109407394 GCACAGTGCCTGGCACACATGGG + Intronic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102252191 12:111394868-111394890 CCCCAGAACCTGGCAGAGGCTGG - Intergenic
1102299284 12:111759290-111759312 CCACCGTGCCCAGCAGGGACAGG + Intronic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103506465 12:121444684-121444706 CTGCAGAGGCTGGCAGAGACGGG + Intronic
1103716533 12:122948591-122948613 GCACAGTCCCCAGCAGAGACAGG + Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104156600 12:126139008-126139030 CCATAGTGCATGGCAGATAATGG - Intergenic
1104176143 12:126334586-126334608 CCACAGTGCCGAGCAGTGGCTGG - Intergenic
1104370790 12:128222212-128222234 CCACTGTGCCTGGCAATGCCAGG + Intergenic
1104788619 12:131467993-131468015 CCACTGTGCCTGGCCCAGGCAGG + Intergenic
1104867413 12:131966192-131966214 CCACAGTGCCTGGCCCAGGTTGG - Intronic
1104945667 12:132413948-132413970 CCTCAGCGCCCGGCACAGACAGG - Intergenic
1104969346 12:132524167-132524189 CCACAGTGCCAGGAAGAGCCGGG + Intronic
1105283409 13:18983521-18983543 GCACAGTGCCTGACACAGAGTGG - Intergenic
1105657194 13:22454289-22454311 CCACAGTGCCTTTCAGACTCAGG - Intergenic
1106095456 13:26639552-26639574 TCTCTGTGCCTGGCAGAGGCAGG - Intronic
1106391336 13:29338077-29338099 CCACTGTGCCTGGCCATGACCGG + Intronic
1106729540 13:32525444-32525466 CCACAGTGCCTGGCTGAGGATGG - Intronic
1106798752 13:33234018-33234040 CCACAGTGCCTGGGACAGTGAGG - Intronic
1107114138 13:36728205-36728227 ACACAGTGCCTGGTACAGAGTGG + Intergenic
1107169444 13:37322584-37322606 CCACAGAGACTGGCACAGAGGGG - Intergenic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107831989 13:44382778-44382800 GCACAGTGCCAGGCACAGAGGGG - Intronic
1107848199 13:44541216-44541238 CCAAACTGGCTGGCAGAGCCAGG - Intronic
1107917823 13:45170297-45170319 CCACTGTGCCCAGCTGAGACTGG + Intronic
1107997817 13:45878188-45878210 CCACTGCACCCGGCAGAGACAGG + Intergenic
1108504239 13:51096335-51096357 ACACAGCGCCTGCCTGAGACTGG - Intergenic
1109320767 13:60807100-60807122 CCACAGAGACTGGCAGAGAGAGG + Intergenic
1109584350 13:64378482-64378504 CCACAGTGCCTGGCTGATGTAGG - Intergenic
1110906634 13:80897936-80897958 CGTAAGTGGCTGGCAGAGACAGG + Intergenic
1111091331 13:83452039-83452061 AAACAGTCCCTGGCAGAGGCTGG - Intergenic
1111772929 13:92622189-92622211 ACCCAGAGCCTGGCAGGGACAGG - Intronic
1112037756 13:95513284-95513306 GCACAGTGCCTGCCAGACAGGGG - Intronic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112657659 13:101469392-101469414 CCACAGCGCCTGGCAACAACTGG - Intronic
1113255589 13:108501166-108501188 CCACAGTGCCAGGGAAAGTCCGG - Intergenic
1113523084 13:110954270-110954292 CCCCAGTACCTGGCAGTGTCTGG - Intergenic
1114234295 14:20811327-20811349 CCACCGTGCCTGGCCCTGACTGG - Intergenic
1114891218 14:26926033-26926055 CCAGCGGACCTGGCAGAGACTGG + Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115431670 14:33326177-33326199 CCGCAGTGCAGGACAGAGACAGG + Intronic
1115491249 14:33960324-33960346 CCACCGCGCCCGGCCGAGACAGG - Intronic
1115607652 14:35020743-35020765 GGACAGTGCCTGGCACAGAATGG - Intronic
1115782690 14:36787046-36787068 TCACAGTGTCAGGCAGGGACTGG + Intronic
1116083503 14:40205023-40205045 CCACAGAGCCTGCAGGAGACTGG - Intergenic
1117272463 14:54158882-54158904 CCACAGTGACTGGCATAGAGAGG - Intergenic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1117528479 14:56635727-56635749 ACACAGTCCCTGGCTCAGACTGG - Intronic
1117570124 14:57039789-57039811 GAACAGTGCCTGGAAGAGAGTGG + Intergenic
1117629253 14:57672249-57672271 CCACAGTGACCGGCTGAGTCTGG - Intronic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1117866719 14:60157702-60157724 CCTCAGTGCTTAGCAAAGACTGG + Intronic
1117968092 14:61226202-61226224 ACACAGTGCCTGGCTCAGAGTGG - Intronic
1118348091 14:64954341-64954363 CCCCAGTACCTGGCATAGAAGGG + Intronic
1118600200 14:67466703-67466725 CCACTGTGCCTGGCCCAGGCTGG - Intronic
1118785685 14:69043880-69043902 CCATTGTCCCTGGCAGAGAGTGG + Intergenic
1118901845 14:69992837-69992859 ACACAGTGCCAGGCACAGAGTGG - Intronic
1119634116 14:76260299-76260321 ACACAGTGCATGGCACAGAGTGG - Intergenic
1119643982 14:76335322-76335344 ACACAGTGCCTGGTATATACTGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1119808455 14:77498025-77498047 CCTCAGTGACTGGAAGACACAGG + Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121310329 14:92932294-92932316 CCCCAGGGAGTGGCAGAGACTGG + Intronic
1121346222 14:93137746-93137768 CAACAGTGCCTGGCAATGACTGG - Intergenic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121644023 14:95505400-95505422 CCACCTGGCCTGGCAGAGAGTGG - Intergenic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122007288 14:98716036-98716058 CCACAGTGCCTGCAACAGGCTGG + Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1122524391 14:102370477-102370499 CGAAAGTGCCTGCCAGAGATAGG + Intronic
1122560938 14:102613841-102613863 CCACCGCGCCTGGCTGAGATAGG + Intronic
1122652387 14:103232692-103232714 CCACTGGGCCTGGCACAGGCAGG - Intergenic
1122873287 14:104651126-104651148 CCACTGTGCCCGGCAGATGCTGG - Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123661989 15:22572579-22572601 CCACAGTGCCTGGTTAAGGCAGG + Intergenic
1123698969 15:22900685-22900707 CCACCGTGCCTGGCCGAGCCTGG + Intronic
1124118589 15:26868723-26868745 TCTCAGTGCCTTGCAGAGAGAGG + Exonic
1124262228 15:28202966-28202988 CCACAGTGCCTGGTTAAGGCAGG - Intronic
1124315786 15:28666822-28666844 CCACAGTGCCTGGTTAAGGCAGG + Intergenic
1124439921 15:29678240-29678262 AGACAGTGGCTGGCAGTGACAGG + Intergenic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125731304 15:41894087-41894109 CCACAGGGCGTGGCCCAGACAGG + Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126347727 15:47714879-47714901 CCACAGTGCCTGGCATTTAATGG - Intronic
1126609188 15:50511707-50511729 CCACAGTGCCTGGCCTATTCTGG - Exonic
1126693653 15:51307971-51307993 GCACAGTGCCTGGCACAGTCAGG + Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127390189 15:58499097-58499119 AGACAGTGCCTGCCAGTGACAGG + Intronic
1127542254 15:59952374-59952396 CCACTATGCCTAGTAGAGACGGG - Intergenic
1127716149 15:61651125-61651147 GCACAGTGCCTGGCACCAACAGG + Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127844316 15:62856491-62856513 CTGCACTGCCTGGCAGAGGCCGG - Intergenic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127974185 15:63985084-63985106 GCACAGATCCTGGCACAGACTGG - Intronic
1128159251 15:65412539-65412561 GCACAGTGCCTGACACAGAATGG + Intronic
1128236744 15:66072880-66072902 CCATAGGGCAAGGCAGAGACCGG - Intronic
1128372334 15:67049452-67049474 GCTCAGTGCCTGGCAGGGACCGG + Intergenic
1128593506 15:68924073-68924095 TCACAGTGCCTGGCAGAGTTTGG - Intronic
1128657148 15:69470632-69470654 CCACTGTGCCCGGCCCAGACTGG + Intergenic
1129078834 15:73021708-73021730 CCACAGTGCCTAGAAAAGGCAGG + Intergenic
1129078967 15:73022974-73022996 CCAAGGTCCCTGGCAGAGCCAGG - Intergenic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129481698 15:75831617-75831639 CCACAGTGACTGGAAGACAGAGG - Intergenic
1129539989 15:76341357-76341379 CCACTTAGCCTGGCAGAGAGGGG + Intronic
1129542167 15:76359252-76359274 GCACAGGGTCTGGCAGAGGCAGG + Intronic
1129570342 15:76676110-76676132 CCACTGTGCCCGGCTGAAACTGG + Intronic
1129583802 15:76841357-76841379 CCACTGTGCCTGGCCCTGACTGG - Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1130001865 15:80054792-80054814 CCACCGCGCCTGGCCGAGGCTGG + Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130875858 15:88013712-88013734 CCACAGTGCCTGGCCAAGTCAGG - Intronic
1131002395 15:88949374-88949396 CCACAGTGGCTCTCAGAGACAGG + Intergenic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131117233 15:89802918-89802940 CCAGAGTTCCAGGCAGAGGCGGG + Intronic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131254111 15:90850425-90850447 CCACTGCGCCTGGCTGAGAAAGG + Intergenic
1131619980 15:94057905-94057927 CCACAGTGCGTGGGACACACTGG + Intergenic
1131905058 15:97133971-97133993 CCACTGTGCCTGGCTGTGCCTGG - Intergenic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132502018 16:288670-288692 CCCAAGAGCCTGGCAGAGCCTGG - Intronic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1133038067 16:3045888-3045910 CCACAGCGCCTGCCAGTGCCGGG - Intergenic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133293200 16:4736301-4736323 ACACAGTGCCTGGCACTAACAGG + Intronic
1133300733 16:4780971-4780993 CCACCGTGCCCAGCAGAGACAGG - Intronic
1133366644 16:5215572-5215594 CCCCAGTACCTGGCATAGCCTGG - Intergenic
1133512312 16:6471945-6471967 CCCCAGAGCCAGACAGAGACGGG - Intronic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133616816 16:7484749-7484771 CCACAGTGCCTGGCTGGCATTGG + Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134415941 16:14043444-14043466 CCACAGTGCATGCCAGACACAGG - Intergenic
1134434064 16:14238559-14238581 ACACAGTGACTGGCTGAGAGAGG + Intronic
1134537171 16:15035324-15035346 CCACTGAGCCTGCCACAGACTGG - Intronic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134780921 16:16894977-16894999 GCACAGTGCCTGGCACAGCAAGG + Intergenic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1134860319 16:17554903-17554925 CCCGTGTGCCTGGCAGAGATTGG + Intergenic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135327946 16:21539337-21539359 CCACAGTGCTGGCCAGGGACAGG - Intergenic
1135415406 16:22264918-22264940 CAACAGAGCCTGGAGGAGACAGG - Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135791467 16:25400533-25400555 CCACAGCACCTGGTGGAGACGGG + Intergenic
1136099794 16:27985554-27985576 CCACCGTGCCCGGCCGAGACTGG - Intronic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136338297 16:29625361-29625383 CCACAGTGCTGGCCAGGGACAGG - Intergenic
1136385814 16:29925538-29925560 CCACAGCGCCTGGCAGTTAGGGG + Intronic
1137343751 16:47636287-47636309 CCACAGTGGCTGCCCTAGACAGG - Intronic
1137439812 16:48488773-48488795 CCACTGTGCCTGCCTGAGCCCGG - Intergenic
1138070868 16:53991914-53991936 CTACAGTTCCTGGCAGCAACTGG - Intronic
1138084024 16:54117265-54117287 CCACAGTACCTGACATATACTGG + Exonic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138552815 16:57756661-57756683 CCACAATCCCTGGCAGGGCCTGG + Intronic
1138682689 16:58697532-58697554 CCACAGCGCCTGGCGGGTACTGG - Intergenic
1139185477 16:64801084-64801106 CCACCGCGCCCGGCCGAGACAGG + Intergenic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1141110926 16:81270102-81270124 CCACAGTGCCAGGCTGAGAGAGG + Intronic
1141139628 16:81488897-81488919 TTCCAGTGCCTGCCAGAGACAGG - Intronic
1141603990 16:85142732-85142754 ACCCAGTGCCTAGCAGACACAGG + Intergenic
1141939904 16:87268633-87268655 CCACTGTGCCTGGCCAGGACAGG - Intronic
1142031802 16:87842276-87842298 TCACAGGGCCAGGCAGGGACGGG + Intronic
1142245240 16:88967352-88967374 ACACACTGCCTGGGAGCGACGGG + Intronic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142414114 16:89932142-89932164 CCACAGTAGCTGGCAGAGCAGGG - Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1143017708 17:3899811-3899833 CCACTGCGCCCGGCTGAGACAGG - Intronic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143274383 17:5699471-5699493 GCACAGTGCCTGGCACTGATAGG + Intergenic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143685955 17:8515829-8515851 CCACCGTGCCTGGCCGGGATTGG + Intronic
1143743250 17:8969665-8969687 CCACTGTGCCTGGCTGACATTGG + Intergenic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1144068479 17:11645620-11645642 CTACAGAGCATGGCAGAGGCTGG - Intronic
1144337972 17:14288562-14288584 CCACAGTGCCTGGCTGAACATGG + Intergenic
1144696546 17:17307566-17307588 CCACCGTACCTGGCTGAGGCAGG - Intronic
1144839599 17:18177732-18177754 CCACAGTGTCTCTAAGAGACAGG - Intronic
1145774487 17:27518546-27518568 ACACAGTGCCTTGTAGAGAGGGG - Intronic
1145824071 17:27863368-27863390 CCTCAGTGCCTGGCCCAGACTGG + Intronic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146004991 17:29155446-29155468 CCCCAGGGCCTGGCAGTGAGAGG + Intronic
1146150136 17:30460916-30460938 CCACAGTGCCTGGTAGTGCCAGG - Intronic
1146184960 17:30718767-30718789 GCACAGTGCCTGGCACAAGCAGG - Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146455182 17:33004239-33004261 GCATAGTGCCTGGCACAGAGTGG + Intergenic
1146530843 17:33606644-33606666 GCATAGTGCCTGGCAGATCCTGG + Intronic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1146754954 17:35421825-35421847 CCACCGCGCCTGGCCGAGGCAGG + Intronic
1146943834 17:36861082-36861104 CCACCGTGCCTGGCCGACCCAGG + Intergenic
1147055082 17:37827932-37827954 CCACAGTGAGTGGCAGAGCCAGG + Intergenic
1147114037 17:38285445-38285467 CCACCGTGCCCAGCTGAGACTGG + Intergenic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147652168 17:42068925-42068947 GCCCTGTGCCTCGCAGAGACGGG + Intergenic
1147759193 17:42786678-42786700 CCACCGTGCCTGGCCGAGTATGG + Intronic
1147930356 17:43976890-43976912 CACCAGTGCCTGGCACAGAAGGG + Intronic
1147981486 17:44277236-44277258 GCACAGAGCCTGGCAAAGGCGGG + Intergenic
1147983590 17:44290842-44290864 CCACCGCACCTGGCTGAGACGGG + Intergenic
1147988069 17:44317917-44317939 GCACGGTGCCTGGCACAGGCAGG + Intronic
1148038885 17:44690371-44690393 GCACAGTGCCTAGCAGAGGGTGG - Intergenic
1148121000 17:45211171-45211193 CCACTGTGCCTGGCCTAGAATGG + Intergenic
1148340643 17:46871566-46871588 CCACAGTGCCTGGGACAAGCAGG - Intronic
1148415568 17:47503745-47503767 CCACCGTGCCCAGCTGAGACTGG - Intergenic
1148475884 17:47928235-47928257 CCACAGTGGCCGGCAGGGCCAGG - Exonic
1148493784 17:48039832-48039854 CCACCGTGCCCGGCCGACACTGG - Intergenic
1148496833 17:48058116-48058138 CCACCAGGCCTGGCAGAGATGGG - Intronic
1148639712 17:49177706-49177728 CCACTGTGCCCGGCAGAATCTGG - Intergenic
1148682477 17:49482714-49482736 CCTCAGTGCCAGGCACAGGCTGG + Intergenic
1148739533 17:49884673-49884695 GCACAGTGCCTGGCAGTCAGCGG + Intergenic
1148751624 17:49948703-49948725 CCTCAGTGCCTGGCACAGGCTGG + Intergenic
1148886197 17:50774733-50774755 CCACTGTGCCTGGCAAAGTTAGG - Intergenic
1148963741 17:51416733-51416755 CCACTGTGCCTGGCGGTGAAAGG + Intergenic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149266731 17:54935003-54935025 CCACAGTGCCTGGCTGAACTAGG + Intronic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149551756 17:57545802-57545824 CCCAAGTGCCTGGCAGAGAAGGG + Intronic
1149607642 17:57936134-57936156 CCACAGGGCCTGACAGATTCAGG - Intronic
1149828440 17:59850432-59850454 CAACACTGGCAGGCAGAGACGGG + Intergenic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150018968 17:61591110-61591132 CCGCAGTCCCAGGCTGAGACAGG - Exonic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1152088181 17:78232580-78232602 TGACAGTGCCTGACAGGGACGGG - Intronic
1152185743 17:78855439-78855461 ACATAGTGCCTGGCAGAGGGAGG + Exonic
1152730496 17:81967442-81967464 CCCCAGTGCCTGGGAGTGAGTGG + Intergenic
1152760165 17:82103488-82103510 CCACACTGGCTGGCAGAGGGTGG + Intronic
1152765887 17:82138433-82138455 CCACCGCACCTGGCTGAGACGGG + Intronic
1152919862 17:83060823-83060845 CCACCGTGCCCGGCCGAGTCTGG - Intergenic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153484739 18:5585682-5585704 GCACAGTGCCTAGCAAAGAAAGG - Intronic
1153647781 18:7210776-7210798 CCACTGTGCCAGGCTGAGATGGG - Intergenic
1153655088 18:7275010-7275032 CTACAGTGGCTGAGAGAGACAGG + Intergenic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156332710 18:36139524-36139546 CCACAGAGCCTTGCACAGAATGG - Exonic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157232814 18:45935142-45935164 GAACAGTCCCTGGCACAGACTGG - Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158107853 18:53905524-53905546 CCACAGGGCCAGGGTGAGACTGG - Intergenic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158254817 18:55533897-55533919 CCTCAGTGCCTGGCACAGGGTGG - Intronic
1158590651 18:58776045-58776067 GCACAGTGCCTGGCATGGAGTGG - Intergenic
1159004295 18:62999015-62999037 CAACAGTGCCAGGCAGATAGCGG + Intergenic
1159519165 18:69496016-69496038 CCACAATGCCCTGCAGAGTCAGG - Intronic
1159946180 18:74446372-74446394 CCACAGTGGGAGGCAGAGGCCGG - Intronic
1160114608 18:76065531-76065553 GCACAGTGCCTGGCACAGGGTGG + Intergenic
1160811465 19:1014735-1014757 CCCCAGGGCCTGTCAGAGCCGGG - Intronic
1161123127 19:2541043-2541065 GCACCCGGCCTGGCAGAGACAGG + Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161373822 19:3928652-3928674 CCACCGTGCCTGGCCGTGAATGG - Intergenic
1161413861 19:4133462-4133484 CCACCGCGCCCGGCTGAGACGGG - Intergenic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161797953 19:6398382-6398404 CCACCGCGCCTGGGTGAGACAGG - Intergenic
1161884687 19:6985394-6985416 CCACCGTGCCCGGCTGAGCCAGG - Intergenic
1161920734 19:7263743-7263765 CCACTGTGCCTGGCTGTGCCTGG - Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162098307 19:8324133-8324155 CCAGAGCGCCTGGCAGGGGCTGG - Intronic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162347053 19:10125125-10125147 CCACTGTGCCCAGCAGAAACAGG - Intergenic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162815142 19:13189559-13189581 CCACTGTGCCCAGCAGAGATGGG + Intergenic
1162852218 19:13439696-13439718 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1163038155 19:14583537-14583559 CCACAGTGCCCGGCATGGGCTGG - Intronic
1163039588 19:14592461-14592483 GCACAGTGCCTGGCATGGGCTGG - Intronic
1163166285 19:15500275-15500297 CCACCGTGCCTGGCCTAGGCTGG - Intergenic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163507677 19:17717958-17717980 CCACCGTGCCCGGCAGAGATGGG - Intergenic
1163634053 19:18430308-18430330 CCACAATTTCTGGCAGATACAGG + Intronic
1163984359 19:20931060-20931082 CCACTGCGCCTGGCAGAGATGGG + Intronic
1164030306 19:21397463-21397485 TCACAGTGCAGGGAAGAGACAGG - Intronic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164213118 19:23117367-23117389 TCACAGTGCAGGGAAGAGACAGG - Intronic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164978496 19:32593895-32593917 CCACTGTGCCTGGCAAAGCTAGG - Intergenic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165226063 19:34356031-34356053 CCACTGCGGCCGGCAGAGACAGG - Intergenic
1165347713 19:35259194-35259216 CCTAAGTGACTGGCAGAGCCTGG - Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166226729 19:41400525-41400547 CCACTGTGCCTGGCTGCGCCTGG + Intronic
1166364377 19:42271034-42271056 CCACAGTGCCTGGCCATGCCAGG + Intronic
1166388740 19:42397102-42397124 TGACTGGGCCTGGCAGAGACTGG - Intergenic
1166657041 19:44619981-44620003 CCACTGCGCCTGGCCGACACTGG - Intronic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167044547 19:47042018-47042040 CCACTGTGCCTGGCCTAGAAGGG - Intronic
1167063353 19:47165571-47165593 CCACAGTGTCTGCCAGGGAGTGG - Intronic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167124390 19:47539213-47539235 GCACAGGGCCTGGCACAGAGGGG + Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1167423206 19:49415687-49415709 CTACACTCCCTTGCAGAGACTGG + Intronic
1167836904 19:52080422-52080444 CCCCAGTGCATGGCAGGGGCTGG - Intronic
1168144413 19:54412425-54412447 CCACTGGGCCTGGCCGAGACAGG + Intergenic
1168218841 19:54946076-54946098 CCACCGCGCCCGGCCGAGACAGG + Intronic
1168309705 19:55454342-55454364 CCACAGTGGCTGGCACAGAGTGG + Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168663681 19:58186262-58186284 CTACCGTGCCTGGCAGGGACAGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
925258672 2:2511141-2511163 CCACAGTGCCTGACAGGGTCTGG - Intergenic
925384434 2:3452300-3452322 CCACAGTGCCTTGCACGGCCGGG + Intronic
925432247 2:3805142-3805164 CCACACTGCCTTCTAGAGACTGG - Intronic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926049899 2:9737831-9737853 CCAAAGTGCCTGGTGGGGACTGG - Intergenic
926340129 2:11898514-11898536 CCGCAGTGCCTGGTGCAGACAGG - Intergenic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926748676 2:16181181-16181203 GCCCAGTGCCTGGCATAGAGAGG + Intergenic
927179637 2:20435603-20435625 CCACCGTGACTGGCCGAGAGAGG + Intergenic
927497174 2:23558887-23558909 GAACAGTGCCTGGCAAAGAAGGG - Intronic
927498496 2:23566003-23566025 CCAAAGAGCCTGGCAGAAGCCGG - Intronic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927657287 2:24959959-24959981 CCACAGGGCCTAGCAGATGCAGG + Intronic
927859205 2:26549984-26550006 TCCCAGTGCCTGGCACAGAATGG - Intronic
928009718 2:27595609-27595631 CCACTGTGCCCGGTGGAGACTGG + Intronic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
929693709 2:44096549-44096571 CCACATTGCCTGGCAGAGGTAGG - Intergenic
929831439 2:45349978-45350000 CCTGAATGCCTGGCAGTGACAGG + Intergenic
930029522 2:47049616-47049638 GCAGAGTGCCAGGCAGAGAGTGG - Intronic
930032562 2:47067485-47067507 AGGGAGTGCCTGGCAGAGACAGG + Intronic
930274733 2:49298241-49298263 ACACAGTGCCTGGTATAGAGCGG + Intergenic
930758171 2:55000538-55000560 GCACAGTGCCTTGCTCAGACTGG - Intronic
930855467 2:56011991-56012013 CCCAAGGGCCTGGAAGAGACGGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931288103 2:60849540-60849562 CCCCAGTGCCTGGTAGACAGGGG + Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
932809873 2:74816133-74816155 CCTCAGTGCCAGGCAGAGTGGGG - Intergenic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934664015 2:96157764-96157786 CCACAGGGCCAGGCAGTGTCCGG + Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
936947221 2:117941630-117941652 CCACCCTGCCAGGCAGGGACAGG + Intronic
937047696 2:118860684-118860706 CCACATGGCCAGGCAGAGACGGG - Intergenic
937349445 2:121151093-121151115 GCACAGTACCTGGCAGAGGACGG + Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
937999536 2:127720844-127720866 CCACTGTGCCTGGCCTAGTCAGG + Intronic
938063452 2:128269080-128269102 CCACAGTGCCCTGCAGCGCCTGG + Intronic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
938972569 2:136445946-136445968 CCCCAATGCCTGGCACAGAATGG - Intergenic
939636866 2:144592669-144592691 CCACAGTGCCAGCTTGAGACTGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940464679 2:154013467-154013489 CCACAGTGACTGGCAAGCACAGG - Intronic
940836618 2:158529007-158529029 GCACTGTGTGTGGCAGAGACAGG - Intronic
940885847 2:158988687-158988709 GCACAGAGCCTGGCATAGAGTGG - Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942323470 2:174755746-174755768 CCACTGTACCTGGCAAAGTCTGG - Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943248174 2:185483238-185483260 CCACTGAGCCTGGCAGGGACTGG - Intergenic
944240081 2:197477846-197477868 TCACAGTGACTGGTAAAGACAGG + Intergenic
944483147 2:200177794-200177816 GCACAGTGCCTGGCATATATTGG + Intergenic
944803553 2:203259595-203259617 CCACTGTGCCCGGCTGCGACTGG - Intronic
944902607 2:204231019-204231041 CCACAGTGAATGGCAGAGCCAGG + Intergenic
945498843 2:210543093-210543115 CCACAGTGGCTGGGAGAGGGGGG + Intronic
945814996 2:214593847-214593869 CCACAGAGACTGGGAGAGAGAGG + Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946131553 2:217610693-217610715 ACCCAGTGCCTGGCACAGAGCGG + Intronic
946253956 2:218430046-218430068 GCATAGTGCCAGGCAGAGGCAGG + Intronic
946387808 2:219395896-219395918 CCTCAGTGCCTGGCAGGTAGTGG + Intronic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
947195707 2:227565061-227565083 CCACAGTGCCTTGAAGGAACTGG + Intergenic
947322654 2:228939245-228939267 CCACAGTACACGGCAGAGACAGG + Intronic
947397906 2:229704642-229704664 CCCCAGTCCCTGGCAGCCACTGG - Intronic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948623467 2:239251303-239251325 CCACTGTGCCTGGCTGGGAATGG - Intronic
948662634 2:239516494-239516516 CCACACTCCCTGCCAGAGTCGGG - Intergenic
948776468 2:240291428-240291450 CAACAGTGCGTGGCAGGGGCAGG + Intergenic
948838620 2:240638059-240638081 CCACAGTGGATGGCTGGGACAGG + Intergenic
1169278071 20:4246891-4246913 CCACACTGCCAGGCTGAGTCAGG - Intronic
1169421732 20:5465974-5465996 CCACAGTGGCCGGTAGAGGCTGG + Intergenic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169918361 20:10706397-10706419 TCACAGTGCCTAGCACAGAGTGG - Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170737073 20:19021757-19021779 CCCCAGTGCCTTGCTGAGAGTGG - Intergenic
1171455830 20:25271656-25271678 CCACATGGCCTGGGAGAGCCTGG + Intronic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172008441 20:31832776-31832798 CCACTGTGCCTGGCTGAGGTGGG + Intronic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172514944 20:35526946-35526968 CCACAGTGTCTGGGAGGGATGGG - Intronic
1172647799 20:36482274-36482296 GCACAGGGCCTGGCAGCGTCTGG + Intronic
1172763662 20:37339268-37339290 CCACAGTGCCTGGCCTAGTCTGG + Intergenic
1172985948 20:38989398-38989420 CCACTGTGCCCGGCCGACACAGG + Intronic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1173812127 20:45962373-45962395 GCACAGAGCCTGGCACAGAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174514838 20:51083704-51083726 CCAGTGTGGCTGGCAGAGAGTGG + Intergenic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1174633911 20:51982249-51982271 CCACCGCACCTGGCCGAGACTGG + Intergenic
1174660298 20:52206728-52206750 CCACCATGCCCGGCCGAGACAGG + Intergenic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1174767476 20:53267537-53267559 TCACAGTCCATGGCAGAGAGAGG + Intronic
1175268610 20:57717946-57717968 CCACAGCCCCTAGCAGTGACTGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175802392 20:61808225-61808247 CCTCAGTGACTGGCTGAGACGGG - Intronic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1176145443 20:63563376-63563398 GCACAGTGCCAGGCAGTGGCAGG + Exonic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178173051 21:30063564-30063586 CCAAAGTGTCTGGCAGATAATGG + Intergenic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178907057 21:36645329-36645351 CCACTGTGGCTGGCCGAGACTGG - Intergenic
1179148213 21:38787648-38787670 TCACTGTGCCGGGCAAAGACTGG - Intergenic
1179537700 21:42062998-42063020 CCCCAGAGCCTGGGAGAGGCAGG - Intronic
1179568758 21:42265548-42265570 CACCAGCGGCTGGCAGAGACAGG + Intronic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180059156 21:45375719-45375741 CCCCAGTGATTGGCAGAGATGGG - Intergenic
1180137478 21:45871039-45871061 GCCCAGTGCCCGGGAGAGACAGG + Intronic
1180137523 21:45871178-45871200 GCCCAGTGCCTGGGAGAGACAGG + Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180174727 21:46082078-46082100 ACTCAGAGCCTGGGAGAGACAGG - Intergenic
1180252420 21:46597991-46598013 CCACACTGCCTGGGACAGGCAGG + Intergenic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180605662 22:17057259-17057281 TCACAGTGCCTGCCCCAGACAGG + Intergenic
1180616766 22:17133556-17133578 CCCCAGTGACAGGCAGGGACTGG - Intergenic
1180636736 22:17267831-17267853 CCACTGCGCCTGGCCTAGACTGG - Intergenic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180854680 22:19038451-19038473 CCACTGTGCCTGTCCCAGACTGG + Exonic
1181302283 22:21889326-21889348 CCACCGCACCTGGCAGAGGCGGG + Intergenic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181531263 22:23518850-23518872 CCACCGTGCTGGGCAGTGACAGG + Intergenic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181890085 22:26054801-26054823 CCACAGTCAGTGGCAGAGCCAGG - Intergenic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182114334 22:27746689-27746711 GCACAGTGCCAGGCACAGAGGGG - Intergenic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1182377993 22:29862415-29862437 GCACTGTGCCTGGCAGACATAGG + Intergenic
1182701959 22:32247678-32247700 GCACAGTGACTGGCAGAGGGTGG + Intronic
1182962060 22:34484438-34484460 CAGCAGTGCATGTCAGAGACAGG - Intergenic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183043880 22:35204099-35204121 GCACAATGCCTGGCATAGCCAGG + Intergenic
1183071217 22:35397772-35397794 CCACAGAGCCTGGGAGACAGAGG + Intergenic
1183103922 22:35602456-35602478 CCACAGTCCCAGGCAGAGTCAGG + Intergenic
1183261311 22:36797613-36797635 CAACAGTGTCTCCCAGAGACCGG + Intergenic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183327484 22:37202358-37202380 CAGCAGGGCCTGCCAGAGACAGG + Intergenic
1183647987 22:39137711-39137733 CCTCAGTGCTTTGCAGTGACAGG - Intronic
1183830639 22:40416863-40416885 CCACAGTGCTTGCCCAAGACTGG + Intronic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1184100187 22:42338012-42338034 CCACAGTGACTGGTGGAGAAAGG - Intronic
1184265635 22:43344255-43344277 CCACCGGGCCTGGGAGGGACGGG + Intergenic
1184280642 22:43435527-43435549 CCCCAGTGCCTGGCAAAGGTAGG + Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184343928 22:43901477-43901499 CCACTGCGCCTGGCTGAGAGAGG + Intergenic
1184420949 22:44382629-44382651 CCACTGTGCCAGGCCGGGACGGG - Intergenic
1184468405 22:44682226-44682248 CCACAGTGCCGGGCAGATTATGG + Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1184728450 22:46359384-46359406 CAACAGTGGCTGGCTGAGGCGGG - Intergenic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1185279474 22:49963827-49963849 GCACAGTGCCTGGAAGTGTCAGG - Exonic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1185402130 22:50624676-50624698 GCAAAGTGCCTGAGAGAGACGGG - Intronic
949410812 3:3762140-3762162 CCACAGTGCCTGAAACAGAGTGG - Intronic
949954722 3:9258352-9258374 GCAGAGTGCCAGGCAGAGAGTGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950040512 3:9916659-9916681 CCCCAGAGCCTGGCAGACAGGGG - Intergenic
950121483 3:10484973-10484995 GCACAGTGCCTGGCACTGACAGG + Intronic
950221329 3:11198573-11198595 TCAAAATGCCTGACAGAGACTGG + Intronic
950528610 3:13539541-13539563 GCACAGTACCTGGCACAGAGTGG + Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951768549 3:26228415-26228437 GCACAGTGCCTGTCAAAGTCAGG + Intergenic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
954114122 3:48455148-48455170 CCACTGTGCCTGGCGCAGCCTGG + Intronic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954297503 3:49682388-49682410 CCACATTGCCTGGGAGGGAGAGG - Exonic
954398300 3:50304689-50304711 ACACAGTGCCTTTCAGAAACAGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954702961 3:52461353-52461375 CCACTGAGCTTGGCAGGGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955089292 3:55733332-55733354 CCCCAGTGTCTGGCAGTGACTGG + Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955826694 3:62954793-62954815 CCACTGTGATTGGCTGAGACTGG + Intergenic
956662053 3:71608662-71608684 ACACAGTGCCTGGCACTGAGTGG + Intergenic
956681763 3:71787610-71787632 TCACAGTGCCTGGAACAGACTGG + Intergenic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959096827 3:101965485-101965507 ACCTAATGCCTGGCAGAGACAGG - Intergenic
959648744 3:108731174-108731196 ACACAGTGACCAGCAGAGACTGG + Intergenic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960087296 3:113605036-113605058 CCACTGTGACTGACAGAGAGAGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
960953046 3:123011985-123012007 GCACAGTGCCAGACAGAGCCCGG - Intronic
961359999 3:126360938-126360960 CCACAACTCATGGCAGAGACGGG - Intergenic
961831944 3:129627408-129627430 CCTCAGTGCCTGGCCCAGAGCGG - Intergenic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962325366 3:134427907-134427929 CCACAGTACCTGGCACGGAGTGG - Intergenic
962403086 3:135078215-135078237 CCACTGTGCCTGGCAGGGGGAGG + Intronic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
962905319 3:139796136-139796158 CCTGAGTGGCTGACAGAGACTGG + Intergenic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964546370 3:157838806-157838828 CCACTGTGCCTGGCTGTCACTGG - Intergenic
964589541 3:158344929-158344951 CCACCGTGCCTGGCCTAGATTGG - Intronic
964764913 3:160170366-160170388 CCATAGTCTCTGGCAGAGGCTGG + Intergenic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966579343 3:181542195-181542217 CCACAGTGCCTGGCTGTGGTAGG - Intergenic
966642341 3:182204899-182204921 GCACAGTGCCTAGCAGAGCCAGG + Intergenic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
967357089 3:188583684-188583706 GCACAGTGTCTAGCAGAGATCGG + Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967798857 3:193632192-193632214 CCACCGTGCCTGGCTGTGATAGG - Intronic
968118241 3:196106104-196106126 CCACCGGGCCTGGCCGAGATGGG + Intergenic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
968641054 4:1715153-1715175 TCACAGGGCCTGGCACAGTCAGG + Intergenic
969329361 4:6464308-6464330 ACACAGGGCCTTGCAAAGACAGG - Intronic
969376139 4:6764546-6764568 CCACAGTGTCTGGTAGACAGGGG + Intergenic
970197011 4:13561099-13561121 CCACCGTGCCTGGCCGCCACAGG + Intergenic
970239217 4:13990676-13990698 GCAGAGTGCCTGACAGATACTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970433563 4:16011349-16011371 GCCCAGTGCCTGGCAGAGCCTGG + Intronic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
971029279 4:22619601-22619623 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
972089185 4:35258324-35258346 CCACCGGGCCAGGGAGAGACAGG - Intergenic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972569926 4:40301282-40301304 CCACCGCGCCTGGCCTAGACTGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972770728 4:42194543-42194565 CCACCGTGCCCGGCCTAGACTGG + Intergenic
972800882 4:42474574-42474596 GCACAGAGCCAGGCAGGGACAGG + Intronic
972831071 4:42814322-42814344 CCACAGTCCATTACAGAGACTGG + Intergenic
973712644 4:53644728-53644750 CCAGATGGCCAGGCAGAGACTGG + Intronic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974410311 4:61532786-61532808 ACACAGTGCATGGCAGAGTTTGG - Intronic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
976707258 4:88032374-88032396 CCATCGTGCCTGGCCGATACTGG - Intronic
977301188 4:95269573-95269595 CCACTGTGCCTGGTGAAGACTGG + Intronic
977574426 4:98660750-98660772 CTTCAGTGGCTGCCAGAGACTGG - Intergenic
977751518 4:100614860-100614882 CCACTGTGCCTGGCCGAGGGTGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
979935605 4:126690699-126690721 CCACCTTGCCTGGCCGGGACTGG - Intergenic
980093684 4:128467808-128467830 CCCCAGGGCCTGGCATAGAAAGG - Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
980955740 4:139427597-139427619 CCACCGCACCTGGCCGAGACTGG + Intergenic
981029969 4:140114334-140114356 CAACAGTACCTGGCACAGAGGGG + Intronic
981177035 4:141693440-141693462 CCATAGTGCCTGACACATACGGG + Intronic
981753086 4:148112092-148112114 GCACAGTGCTTGGCATAGATAGG - Intronic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
983748064 4:171226143-171226165 CCAAAGTGCAGGGAAGAGACAGG - Intergenic
984030645 4:174599784-174599806 CCACCGTGCCTGGCCTGGACTGG - Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984500843 4:180556957-180556979 AAACAATGCCTGGGAGAGACAGG + Intergenic
984559225 4:181249294-181249316 GCACAGTGTCTGGCACAGAAGGG - Intergenic
985038332 4:185863263-185863285 CGACATTGCCTGGCACACACAGG - Intronic
986164891 5:5264854-5264876 CCACAGGCCCTGGCTGACACTGG - Intronic
986164999 5:5265469-5265491 CCACAGAGCCTGGGAGACAGGGG + Intronic
987324435 5:16799779-16799801 CCACTGTGCCCGGCTGAGAAAGG + Intronic
987824404 5:23009889-23009911 CCACAGTGCCTGGCTGTAAATGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
988499882 5:31775877-31775899 CCACAGGGCCCGGGAGAGCCAGG - Intronic
988721217 5:33881118-33881140 CCTCAGTGCCTGCCATGGACTGG - Exonic
989101925 5:37831347-37831369 GGACAGTGCCTGGCACAGACAGG + Intronic
989121401 5:38008068-38008090 TCTCAGGGCTTGGCAGAGACTGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989448120 5:41554752-41554774 CCATGGTGTCTGGCAGAGAAGGG + Intergenic
989552830 5:42756301-42756323 CCACAGCGCCCGGCAGAGGCAGG + Intergenic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990412997 5:55559804-55559826 CCACCGCGCCCGGCCGAGACAGG - Intergenic
991008172 5:61852840-61852862 CCAAAATGCCTGGCAGCCACTGG - Intergenic
991411745 5:66352636-66352658 CCACAGAGCCTGACATAAACAGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992213327 5:74502269-74502291 CCACAGTGCCTGACCTAGAGGGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
992464709 5:76992188-76992210 CCTCAGAGCCTGGCAGCGTCAGG + Intergenic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
994144765 5:96382670-96382692 TCACAGTGTCTGACAGAGAGTGG + Intergenic
994373590 5:98993910-98993932 CCACAGTGCCTGGCCCAGTTAGG - Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995627608 5:114096535-114096557 CCATAGCGCCTGACAGAGACAGG - Intergenic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
996547059 5:124691115-124691137 CCACCATACCTGGCTGAGACGGG - Intronic
996741143 5:126800161-126800183 CCTCAGTGCCTGGCAATGTCTGG - Intronic
997291374 5:132737981-132738003 ACACAGAGCCTGGCACAGAGTGG + Intergenic
997381907 5:133444389-133444411 CCACCCTGCCTGGCAGTGCCCGG + Intronic
997596217 5:135109006-135109028 TCAGAGTGCCTGGCAGGGAGAGG + Intronic
997747306 5:136310489-136310511 CCAGGGAGCCTGGCAGAGCCAGG + Intronic
997813905 5:136997869-136997891 CCCCAGTGCTGGGCAGAGTCAGG - Intronic
997831100 5:137150747-137150769 CTACAGAGCCTGGCAGTGACAGG + Intronic
998131662 5:139654470-139654492 GCATAGTGCCTGGCAGGGAGAGG + Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998732798 5:145100001-145100023 TCACAGTGCTAGGCAGAGGCAGG + Intergenic
999099318 5:149009533-149009555 GCTCAGTGCCTGGCACAGACTGG + Intronic
999271248 5:150297535-150297557 CCACACGGCCTGGCGGACACTGG + Exonic
999747757 5:154605260-154605282 CTCCAGTTCCTGGCAGAGGCTGG - Intergenic
999772355 5:154785187-154785209 CCACATTGCCCTTCAGAGACAGG - Intronic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
1000327248 5:160181669-160181691 CCTCAGTGCCTGGTATAGGCTGG + Intergenic
1000332180 5:160214558-160214580 CCACATTGGGTGGCTGAGACAGG - Intronic
1000670106 5:164050976-164050998 GCACAGTGCCTGGCATGGAGTGG + Intergenic
1001025354 5:168219662-168219684 TCCCAGTGGCTGGCTGAGACTGG + Intronic
1001905186 5:175466329-175466351 CCCAAGTGCATGGCAGAGAGAGG - Intergenic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002067891 5:176661364-176661386 CGGCAGTGCCTGGCAGCGACGGG - Intergenic
1002183066 5:177441441-177441463 CCCCTGGGGCTGGCAGAGACAGG - Intronic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1003065763 6:2902803-2902825 CCACTGCGCCCGGCCGAGACTGG + Intronic
1003102219 6:3185462-3185484 CCACAGTGCCCGGCTGCGAAGGG + Intergenic
1003643677 6:7896838-7896860 CCACAGTGCATCCCAGAAACAGG + Intronic
1003790339 6:9539333-9539355 CCACAGTTCATTGCACAGACTGG - Intergenic
1003876345 6:10441054-10441076 GCTCAGTGCCTGGTAGAGGCAGG + Intergenic
1004120540 6:12817444-12817466 CCACAGTATATGGCAGAGCCCGG - Intronic
1004601137 6:17150941-17150963 CCACAGTGCCCGGCCAAGAACGG - Intergenic
1004633464 6:17444169-17444191 GCACAGTGCTAGACAGAGACAGG - Intronic
1004703935 6:18105109-18105131 CCACACTGCATGACACAGACTGG - Intergenic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1006299725 6:33187187-33187209 CCACAGTGGCTTCCAGAGACAGG + Intronic
1006375350 6:33668776-33668798 CCACAGTGCCAGGCACACAGCGG - Intronic
1006392096 6:33764465-33764487 CAACAGTGGCTGGCAGGGGCTGG - Intergenic
1006636417 6:35464522-35464544 CCACCGTGCCCGGCCGAGACAGG + Intronic
1006873305 6:37272963-37272985 TCCCAGTGACTGGCATAGACTGG + Intronic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007286190 6:40749142-40749164 GAACAGTGCCTGGCAGAGTAAGG + Intergenic
1007321993 6:41034173-41034195 CCACAGCACCTGGCAGGGAGAGG + Exonic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007700878 6:43765932-43765954 ACACAGTGAGTGGCAGAGCCAGG + Intergenic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1009801947 6:68549310-68549332 CGCCAGTGACTTGCAGAGACAGG - Intergenic
1009926673 6:70128895-70128917 CCACAGAGCCTGGAAGATAGTGG + Intronic
1010240674 6:73612762-73612784 CCACTGTGCCTGGCCTAGAAAGG - Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011633889 6:89352792-89352814 CCTGAGTGCCTGGCAGGCACCGG + Exonic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1012949457 6:105502804-105502826 ACACAGTGCCTGCCACAGAGTGG - Intergenic
1013318057 6:108960251-108960273 AGACTGTGCTTGGCAGAGACTGG - Intronic
1013945425 6:115716923-115716945 CCACAGGGCATAGCAGTGACAGG - Intergenic
1014652655 6:124059575-124059597 CTACAGTTCCTGGCACAGAGTGG + Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1016832719 6:148449355-148449377 TCACCGTACCTGGCTGAGACTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1019817663 7:3212934-3212956 CCAGAGTGCCTGGCCTTGACTGG - Intergenic
1020084267 7:5302236-5302258 CCACCATACCTGGCTGAGACTGG + Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1021555581 7:21914918-21914940 GCACAGAGCCTGGCAGGCACCGG - Intronic
1021605587 7:22406196-22406218 CCACTGTGCCTGGCCATGACTGG + Intergenic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022820168 7:33951647-33951669 TCACTGTGCCTGGTACAGACTGG + Intronic
1023162224 7:37308649-37308671 GCACAGTACCTGGCACACACTGG + Intronic
1023237039 7:38100234-38100256 CCACTGCACCTGGCCGAGACCGG - Intergenic
1023734281 7:43221023-43221045 CCACAGTGTCTTGCAGAGGTAGG - Intronic
1024295403 7:47837706-47837728 CCACAGTGTCTGGCACACAGTGG + Intronic
1024621652 7:51163419-51163441 GCACAGTGCCTAGAACAGACAGG + Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026289122 7:68990128-68990150 CCACTGCGCCTGGCTGGGACTGG - Intergenic
1026444901 7:70475561-70475583 CCACAGTGCCTCACATAGAGTGG + Intronic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026771386 7:73202747-73202769 GCACAGTGCCTGGCACACATGGG + Intergenic
1026868869 7:73838816-73838838 CTGCTGGGCCTGGCAGAGACGGG + Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027012252 7:74756144-74756166 GCACAGTGCCTGGCACACATGGG + Intronic
1027049969 7:75015777-75015799 CCACCGCGCCTGGCCGAGGCAGG - Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027075788 7:75189910-75189932 GCACAGTGCCTGGCACACATGGG - Intergenic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027176715 7:75908628-75908650 CCACCGTGCCTGGCCCAGCCTGG + Intronic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1028673171 7:93428351-93428373 CCACAGTACCAAGCAGAGCCTGG + Intronic
1028729023 7:94123552-94123574 GCTCAGTGTCTGGAAGAGACTGG + Intergenic
1029022325 7:97377894-97377916 GCACAGTGCCAGGCAGAATCAGG - Intergenic
1029238907 7:99144383-99144405 GCCCAGAGCCTCGCAGAGACAGG - Intergenic
1029260894 7:99302014-99302036 CCACAGTGCCTGGCCCAGGCTGG - Intergenic
1029418682 7:100460300-100460322 CCACAGCGCCTGGCCAAGAGTGG - Intronic
1029522702 7:101074100-101074122 CCACTGTGCCTGGCCTAGAATGG - Intergenic
1029525326 7:101090335-101090357 CCACTGCGCCTGGCAGAGCCTGG - Exonic
1029592775 7:101518321-101518343 TCAGAGTGCCTGGCAGTGTCAGG + Intronic
1029606346 7:101601586-101601608 CCACACAGCCAGGCAGTGACAGG + Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030184741 7:106750587-106750609 CCACAGTGCCTGGCCTTGCCTGG + Intergenic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1031030332 7:116727428-116727450 CCTCAGTGCCTGGCACATTCTGG + Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1031981994 7:128134039-128134061 ACAGAGCCCCTGGCAGAGACAGG - Intergenic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032634689 7:133693739-133693761 CCGTAGTCCCTGGCAGAGAAAGG + Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1033001364 7:137508734-137508756 CCACAGAGCCTGAGAGAGAGGGG - Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034475234 7:151277764-151277786 CCACAGTGCCCAGCACAGAGGGG + Intronic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034603040 7:152281442-152281464 CCACTGTGCCTGGCGTAGATGGG - Intronic
1034889217 7:154824890-154824912 CAACGGTTCCTGTCAGAGACCGG - Intronic
1034913113 7:155014070-155014092 TCACAGTTACTGGCAGAGTCTGG + Intergenic
1034982185 7:155486270-155486292 CCACAGCGCCCGGCCGAGCCTGG - Intronic
1035054120 7:156022601-156022623 CCACCGTGCCCGGCCGAGACTGG + Intergenic
1035103898 7:156425729-156425751 GAACAGTGCCTGGCAAAGAATGG - Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1036760123 8:11502932-11502954 CCACAGTGGCTGGCAGCAGCTGG - Intronic
1037203905 8:16291209-16291231 CAGCAGTCACTGGCAGAGACTGG + Intronic
1037643067 8:20765981-20766003 ACATAGTGCCTGGCACAGAGTGG - Intergenic
1037750882 8:21681586-21681608 GAACAGTGCCTGGCAGAGAGTGG - Intergenic
1037753987 8:21699852-21699874 GCACAGTGCCTGGCATGGAGTGG - Intronic
1038214006 8:25545182-25545204 CCACTGTGCCCAGCTGAGACTGG + Intergenic
1038543845 8:28411041-28411063 CCACTATGCCTAGTAGAGACGGG - Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038650682 8:29400427-29400449 CCACTGTGCCTGGCCGAGGTAGG - Intergenic
1038751387 8:30299234-30299256 CCACTGTGCCTGGCCTAGGCTGG + Intergenic
1038751713 8:30302157-30302179 GAACAGTGCCTGTCACAGACGGG + Intergenic
1038796616 8:30716168-30716190 CTACAGTGCCAGCCAGAGAGAGG + Intronic
1038994135 8:32902781-32902803 CCCCACTGCCTGACAGAGATTGG + Intergenic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039470212 8:37808662-37808684 CCACTGTGCCTGGCTGGGTCTGG - Intronic
1039525050 8:38207238-38207260 CCACTGTGCCTGGCAATGCCTGG + Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1040844351 8:51821536-51821558 TAACAGTGCCTGGCAGATATAGG - Intronic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1042044109 8:64628938-64628960 CCACTGTGCCCGGCAGCGATGGG - Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042734149 8:71968988-71969010 GCAGAGTGCATGGCAGAGAATGG + Intronic
1042870436 8:73393039-73393061 CCATAGTGCCTGGTAGAAGCAGG + Intergenic
1042892734 8:73631066-73631088 CCACTGTGCCTGGCCTAGATTGG - Intronic
1042906716 8:73779285-73779307 CCACTGTGCCCAGCCGAGACAGG - Intronic
1043294125 8:78643182-78643204 CCACTGTGTCTGGCTGAGAATGG + Intergenic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046175761 8:110573021-110573043 CCACCATGCCTGGTAGAGATGGG - Intergenic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047390468 8:124446517-124446539 CCACAGTGCCTGGCATATTTTGG + Intergenic
1047521651 8:125599570-125599592 GCACAGTCCCTGGCAGAGAAGGG - Intergenic
1047673263 8:127171932-127171954 CCCCAATGCATGGCAGAGTCTGG + Intergenic
1047909913 8:129516851-129516873 ACACAGTGGCTGGCAGAGAAGGG - Intergenic
1048051677 8:130823060-130823082 CCAAAGTGCCAGGCAGAGCAGGG - Intronic
1048366826 8:133745606-133745628 GCATGGTGCCTGGCACAGACTGG + Intergenic
1048369548 8:133765745-133765767 CCCCAGATCCTGGCAGAGCCCGG + Intergenic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1048989099 8:139750945-139750967 TCACACTGCCTGGCAGAGGGTGG - Intronic
1049093692 8:140535305-140535327 CCCCAGCGCCTGGCACAGCCTGG + Intronic
1049105771 8:140611613-140611635 CCACTGTGCCTGGCCGTGCCTGG + Intronic
1049108632 8:140629218-140629240 ACACATTGGCTGGCAGAGCCTGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049327730 8:142032303-142032325 CCCCAGTGGCTGGCAGATAAGGG + Intergenic
1049695145 8:143980032-143980054 CCACCGCGCCCGGCTGAGACGGG - Intronic
1049782361 8:144434817-144434839 CCGCAGGGCCTGCCAGAGCCTGG - Exonic
1049846314 8:144803504-144803526 CCACAGGGCCCAGCAGAGAAAGG - Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050536351 9:6634115-6634137 CCACCGCGCCCGGCAGAGGCGGG + Intronic
1051259080 9:15244368-15244390 CCACACTGCCCGCCAGTGACTGG - Intronic
1052746781 9:32449093-32449115 CGACAGGGCCTGGCATAGAGAGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053120079 9:35539694-35539716 CCACAGTGTCTGGCAGGGGCAGG + Intronic
1053288220 9:36863563-36863585 GCACATTGCCAGGCAGAGGCAGG + Intronic
1054913202 9:70473001-70473023 CCACAGTACCTGGTAGTCACAGG - Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1056410761 9:86324325-86324347 CCACAGGGCCTGGCTGAGTGGGG - Intronic
1056708992 9:88975573-88975595 CCACTGTGCCCGGCAGTTACTGG - Intergenic
1056774623 9:89501852-89501874 TCAGGGTGCCTGACAGAGACCGG - Intergenic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057610871 9:96542721-96542743 CCACTGCGCCCGGCAGAGGCCGG - Intronic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057722803 9:97546406-97546428 ACACAGGGCCTGGCAGGGCCTGG - Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1058103694 9:100946037-100946059 TGACAGTGCCTGGCACAGAGTGG - Intergenic
1058638202 9:107057254-107057276 CCACAGGGGCAGGGAGAGACAGG + Intergenic
1058778621 9:108310568-108310590 CCAGAGTGCCTGGCACAGAAGGG + Intergenic
1058906888 9:109489220-109489242 CCACAAGGACTGGCAGAGTCTGG - Intronic
1059027600 9:110652294-110652316 GCACAGTGCCTGGCATAGCTAGG + Intergenic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1059410761 9:114130853-114130875 TCAATGTCCCTGGCAGAGACTGG - Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060049812 9:120370305-120370327 CCACAGCGCCTGGCTGAGGGTGG - Intergenic
1060142916 9:121226089-121226111 CCACTGCGCCCGGCAGAGCCTGG + Intronic
1060188861 9:121579708-121579730 CCAAGGTGTGTGGCAGAGACAGG - Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060456056 9:123799195-123799217 TCACAGTGCCTGGCAAATAGTGG - Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1060489481 9:124071990-124072012 CAACAGTGTCTTGCACAGACTGG + Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060628007 9:125130768-125130790 CCACTGTGCCCGGCCAAGACTGG + Intronic
1060639932 9:125229937-125229959 GCACAGTGTCTGGCAGATAGTGG + Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061017849 9:127992889-127992911 CAACAGTGCCTGGCACGGAGTGG - Intergenic
1061187429 9:129063111-129063133 CCACACTGCCAGGCTGAGGCAGG + Intronic
1061203827 9:129151913-129151935 TCCCAGTGCCCAGCAGAGACTGG + Intergenic
1061206810 9:129168975-129168997 GCACAGTGCCTGGCATATATAGG + Intergenic
1061249197 9:129416590-129416612 CCACCGTGCCAGGCAGTGACAGG - Intergenic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061501168 9:131003188-131003210 CCACCGTGCCCGGCCGAGATGGG - Intergenic
1061619064 9:131799127-131799149 ACATGGTGCCTGGCACAGACGGG + Intergenic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062141330 9:134960749-134960771 CCACAGTGCTGGGCGGAGAAAGG - Intergenic
1062289717 9:135789089-135789111 CCACAGTGCCCGGCAGAGCGAGG - Intronic
1062459404 9:136656621-136656643 CCACTGTGCCTTGCGGAGACTGG + Intergenic
1062532438 9:137007824-137007846 CCCCAGTGCCTGCCAGGGCCTGG - Exonic
1062661690 9:137638874-137638896 CCCCAGAGCCTGGCCGAGGCAGG + Intronic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1186175401 X:6921095-6921117 CCACAGTGCCTGGCCATGAATGG - Intergenic
1186393715 X:9186491-9186513 CCACACTGCGTGGAAGAGAGGGG + Intergenic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187529504 X:20083775-20083797 CCCCAGTGCTTGGCAAAGTCTGG + Intronic
1187706698 X:22016305-22016327 CCACTGCACCCGGCAGAGACTGG - Intergenic
1187871891 X:23771456-23771478 CCACCGTACCCGGCTGAGACAGG - Intergenic
1187927448 X:24262992-24263014 CCACTGTGCCTGGCCTAGCCTGG + Intergenic
1187930147 X:24286352-24286374 CCCCAGTGTCTGGCATAGCCAGG - Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189852716 X:45193064-45193086 CCACTGTGCCTGGCAGGCATTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192423033 X:71050973-71050995 CCACTGTGCCAGGCCGTGACTGG - Intergenic
1193262721 X:79427797-79427819 CCACTGTGCCTGGCCGGGGCTGG + Intergenic
1193978112 X:88148903-88148925 CCACAGTGCCTGTCAGAGCCTGG - Intergenic
1193990850 X:88305249-88305271 CCACCGCGCCTGGCCGAGGCGGG - Intergenic
1195613525 X:106895035-106895057 GCACAGTGCCTGGGATAGAACGG + Intronic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196934967 X:120720467-120720489 GAACAGTGCCTGGCAAAGACGGG + Intergenic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1198065533 X:133092968-133092990 CCACTGTGCCTGGCCTAGCCTGG - Intronic
1198253717 X:134906939-134906961 CCACCGTGCCAGGCCGAGGCAGG - Intronic
1198463550 X:136884900-136884922 CCACTGAGCCTGGCCGAGAGGGG + Intergenic
1198480360 X:137034595-137034617 ACACAGTACCTGGCAGAGAGAGG - Intergenic
1199513216 X:148646523-148646545 CCAGAGGTCCTGGCAGAAACAGG - Intronic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200079538 X:153569139-153569161 CCACAGAAGCTGGCGGAGACGGG + Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1200909326 Y:8516500-8516522 CCCCAGTGCTGGACAGAGACAGG - Intergenic