ID: 972628627

View in Genome Browser
Species Human (GRCh38)
Location 4:40824345-40824367
Sequence CTGTGGAAACAGCTGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972628627_972628639 19 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628639 4:40824387-40824409 TGGGAGTGACAGCTTTATTGAGG 0: 1
1: 0
2: 1
3: 12
4: 178
972628627_972628636 -4 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628636 4:40824364-40824386 ACAGTTTTTCTGGGGGATAGGGG No data
972628627_972628638 0 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628638 4:40824368-40824390 TTTTTCTGGGGGATAGGGGTGGG 0: 1
1: 0
2: 8
3: 94
4: 656
972628627_972628634 -6 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628634 4:40824362-40824384 CCACAGTTTTTCTGGGGGATAGG 0: 1
1: 0
2: 2
3: 23
4: 281
972628627_972628635 -5 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628635 4:40824363-40824385 CACAGTTTTTCTGGGGGATAGGG 0: 1
1: 0
2: 1
3: 15
4: 214
972628627_972628637 -1 Left 972628627 4:40824345-40824367 CCTTTTGCCAGCTGTTTCCACAG 0: 1
1: 0
2: 5
3: 31
4: 277
Right 972628637 4:40824367-40824389 GTTTTTCTGGGGGATAGGGGTGG 0: 1
1: 0
2: 5
3: 68
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972628627 Original CRISPR CTGTGGAAACAGCTGGCAAA AGG (reversed) Intronic
900032172 1:380047-380069 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900052722 1:608233-608255 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900695607 1:4007997-4008019 CTGTGTGATCATCTGGCAAAAGG - Intergenic
900895538 1:5480485-5480507 CCGAGGACACAGCTGGCAAATGG - Intergenic
900951470 1:5860383-5860405 CTGCGGAAGCAGCAGGCTAACGG + Intergenic
901449384 1:9326677-9326699 CTCTGGAAGCAGCTGACCAAGGG - Intronic
903885528 1:26538920-26538942 CAGTGGAATGAGCTGGCAATGGG + Intronic
906399805 1:45496584-45496606 CTGCTGAAACAGCTGGCTGAGGG - Exonic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907029546 1:51157529-51157551 GAGAGGAAACAGCTGGCACAGGG + Intergenic
907350797 1:53829126-53829148 CTTTGGAAACAGCTAGCCTAGGG + Intronic
907427769 1:54391729-54391751 CTGTGCAAACAGCTGTCACCAGG + Intronic
907706982 1:56840835-56840857 CTGAGGCAAAAGCTGGGAAAGGG + Intergenic
908412918 1:63884747-63884769 ATGTGGAAAGTGCTGGTAAATGG + Intronic
908975885 1:69897860-69897882 CTGGGGAAACTTCTGGCAAATGG + Intronic
909229077 1:73062303-73062325 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912853364 1:113146178-113146200 GTGTTCATACAGCTGGCAAACGG + Intergenic
915017301 1:152745966-152745988 GTGTGGTAACAGCGGGCAGAAGG - Intronic
915419273 1:155766504-155766526 CTGGGGAAACGGGTGGCAACTGG + Exonic
918099894 1:181364258-181364280 CTATGGAAAAAGCTGGACAAAGG - Intergenic
921096727 1:211893247-211893269 CTTTGCAAATAGCTTGCAAATGG + Intergenic
922604619 1:226881877-226881899 CTCTGGAAGCACCTGGAAAAAGG - Exonic
922674067 1:227540463-227540485 TTGTGGAAAGAGCTGGCAGGTGG - Intergenic
923787682 1:237083947-237083969 CTGTGGACACACGTGGCATATGG + Intronic
924172701 1:241357800-241357822 CTGTGAAAACCGCAGGCAAACGG - Intergenic
924305566 1:242685196-242685218 ATGTGGAAACAGATGTTAAAGGG + Intergenic
924586580 1:245366092-245366114 CTGTGGTAACAGGGGGCCAAGGG + Intronic
1062996705 10:1872873-1872895 CTGTGGGTACAACTGTCAAAAGG + Intergenic
1063757055 10:9024004-9024026 CTGTGAAACCAGCTAGAAAATGG + Intergenic
1064112358 10:12550127-12550149 CTGTGGTCACTGCTGCCAAAGGG + Intronic
1065552198 10:26879201-26879223 CTCTGGAAACAGTGGGAAAAGGG - Intergenic
1066389522 10:34967590-34967612 GTGTGGAACTAGCTGGCAAGCGG + Intergenic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1067958334 10:50818865-50818887 CAGTGGATCCAGATGGCAAAGGG - Intronic
1070611988 10:77939687-77939709 CTGGAGAAACAGCTGCCAGATGG + Intergenic
1070702884 10:78616262-78616284 CTGTTGAAGCAGCTGGCATGGGG - Intergenic
1072808254 10:98439341-98439363 CTGTGAAAACAGCTGGGAAGAGG + Intronic
1073707490 10:106001523-106001545 CTATGGAAAAAGCTTGCATATGG + Intergenic
1074688927 10:115985970-115985992 CAGTAGAAAGAGGTGGCAAAAGG + Intergenic
1075087296 10:119422160-119422182 CCCTGGGAACAGCTGGCAGAGGG + Intronic
1075239299 10:120763676-120763698 CTGTGAAAATAGAAGGCAAAAGG + Intergenic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1077414591 11:2418810-2418832 TTGTGGCAACAGCTGGCATATGG + Intronic
1078331859 11:10428967-10428989 CTATGGAAAGAGCTGTCAAAAGG + Intronic
1079445830 11:20555515-20555537 CTGTGAAAGCAGCTGGGAATGGG - Intergenic
1080816536 11:35763143-35763165 ATGTGGGAAATGCTGGCAAAGGG + Intronic
1081759916 11:45569990-45570012 CTGAGAGACCAGCTGGCAAATGG + Intergenic
1082755647 11:57073589-57073611 CTTGGGAAACAGGTGGCCAAGGG - Intergenic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085390226 11:76178552-76178574 CTCTGGAAGGAGCTTGCAAAGGG - Intergenic
1085564121 11:77497497-77497519 CTGTGAAAGCAGTTGGTAAAAGG - Intergenic
1086402157 11:86469748-86469770 CTGGGGACTCAGCTGGGAAATGG + Intronic
1086835353 11:91614355-91614377 CTGTTGAAACAGATGCCAAATGG - Intergenic
1087072119 11:94091367-94091389 CAGTGGAGAAAGCTGGGAAACGG + Intronic
1087262522 11:96026642-96026664 CTGAGCAAACAGATGCCAAAAGG - Intronic
1087434234 11:98092418-98092440 CTTAGGGAACAGCTGTCAAATGG + Intergenic
1087732764 11:101797341-101797363 CTAAAGAAACAGCTGTCAAATGG - Intronic
1090271424 11:125388832-125388854 CTGTGGGAGCAGGTGGCTAATGG - Intronic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1096580622 12:52582511-52582533 GATTGGAAACAGCTGGCAAAGGG + Intergenic
1097188733 12:57209523-57209545 CTGTGGCCACTACTGGCAAAAGG - Intronic
1097953282 12:65456630-65456652 CTGTGGAAAAAGAAGCCAAAAGG - Intronic
1106101641 13:26698520-26698542 CTGAAAAATCAGCTGGCAAAAGG - Intergenic
1106177316 13:27342454-27342476 CTGTGGACACAGCTGGTCACAGG + Intergenic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107284660 13:38777805-38777827 CTGTGGGAAAAACTGGAAAAGGG - Intronic
1108254731 13:48599010-48599032 TTGTGGAAAGAGCAGGCAATTGG - Intergenic
1109953049 13:69527624-69527646 CTGTTGAAACAGCTGGACACAGG + Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1111084404 13:83355470-83355492 CTTTGCAAACAAATGGCAAATGG - Intergenic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1113913918 13:113859977-113859999 CTTTGGGAACAGCTGGGGAAGGG - Intronic
1115134847 14:30095947-30095969 CAGTGAAAGCAGCTGGGAAAGGG + Intronic
1115229167 14:31139602-31139624 CAGTGGAAAAAGCTGAGAAAAGG - Intronic
1116595853 14:46844277-46844299 CTGTTAAAATGGCTGGCAAAAGG + Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118315175 14:64721731-64721753 GTGAGGAAACTGCTGGGAAAGGG + Intronic
1118677571 14:68204317-68204339 ATGGGGAAATAGCTGGCCAATGG + Intronic
1121775299 14:96586786-96586808 CTGTGCACACAGCTATCAAATGG + Intergenic
1122926877 14:104907335-104907357 CTGAAGAAACAACTTGCAAATGG + Intergenic
1123889995 15:24768145-24768167 CTGAAAAATCAGCTGGCAAAAGG + Intergenic
1126825020 15:52540163-52540185 CTGTGAAAGCAGCTGAGAAAAGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127836721 15:62796454-62796476 CTGTGTTTACAGTTGGCAAAGGG - Intronic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1129645597 15:77428334-77428356 TTGTAGAAAGAGCAGGCAAATGG + Intronic
1129797508 15:78389286-78389308 AAGTGGAAACAGCAGACAAAGGG - Intergenic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1131008583 15:88998816-88998838 CTGAAAAAACAGCTGACAAAAGG - Intergenic
1132022181 15:98372209-98372231 CGGTGGAAACAGCTTGCCATTGG - Intergenic
1132272431 15:100538178-100538200 CTGTGAAAACAGCTGGGAGCAGG - Intronic
1133459554 16:5975535-5975557 CTGTGAAAACAGCTTATAAAGGG - Intergenic
1134070135 16:11255677-11255699 CAGTGGACACAGCTAGAAAATGG + Intronic
1134492637 16:14706914-14706936 ATGTGTAATCAGGTGGCAAATGG - Intergenic
1134498018 16:14746036-14746058 ATGTGTAATCAGGTGGCAAATGG - Intronic
1134582550 16:15383044-15383066 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1135313872 16:21427108-21427130 ATGTGTAATCAGGTGGCAAATGG + Intronic
1135366796 16:21859388-21859410 ATGTGTAATCAGGTGGCAAATGG + Intronic
1135445019 16:22511770-22511792 ATGTGTAATCAGGTGGCAAATGG - Intronic
1136193740 16:28636309-28636331 ATGTGTAATCAGGTGGCAAATGG - Intergenic
1136310538 16:29405811-29405833 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1136323984 16:29507595-29507617 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1136438669 16:30247578-30247600 ATGTGTAATCAGGTGGCAAATGG + Intronic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1138903688 16:61304619-61304641 CTGTGGGAACATATGGCCAATGG - Intergenic
1139858220 16:69998197-69998219 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1140340438 16:74153891-74153913 CTATGGAAACAGGTGGCAAAAGG - Intergenic
1140808356 16:78553822-78553844 TGGTGGTCACAGCTGGCAAAGGG + Intronic
1141382089 16:83585778-83585800 TCGTGGAAAGAGCTGGGAAATGG + Intronic
1143754628 17:9057294-9057316 CTGTACAAACAACTGGCAATTGG + Intronic
1144288178 17:13799796-13799818 CTGAGGCAAGAGATGGCAAAGGG - Intergenic
1145312999 17:21710625-21710647 CTGTGGCAGCACCTGGCACAGGG + Intergenic
1146520282 17:33520883-33520905 CTGTGGAACCAGCAGGCTAGGGG + Intronic
1146789928 17:35745435-35745457 CTGGGGTAACAGCTGGCTTAGGG + Exonic
1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG + Intergenic
1147041475 17:37722687-37722709 CTGAGGAATCAACTGGCAAGGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148757883 17:49984074-49984096 CTGTGGAAGCTCCTGGCATAGGG + Intergenic
1152106074 17:78329795-78329817 CTGTGGTCAGAGCTGGCAGAGGG - Intergenic
1153484493 18:5582952-5582974 CTGGGGAAACAGCTACCATAGGG + Intronic
1154119667 18:11641469-11641491 CTGTGTAATCAGGTGGCAAATGG + Intergenic
1155595727 18:27483678-27483700 TAGAGGAAACAGCTAGCAAAAGG - Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1161534551 19:4811035-4811057 ATGTGGAGACAGCTGGGAATGGG + Intergenic
1162779060 19:12997109-12997131 CTGTGGACACACTTGGCACATGG - Intronic
1163311064 19:16514836-16514858 CTGTGGCAAAAGCTGGTACAGGG + Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167494384 19:49809163-49809185 CTGTGGATACAACTGGCTGAGGG + Exonic
1168154917 19:54467985-54468007 CAGTTCATACAGCTGGCAAAGGG - Intronic
1168286349 19:55336337-55336359 ATGTGGATACATGTGGCAAAAGG - Intergenic
926212028 2:10878436-10878458 CTGTGGAAGGTGCTGGCAGAGGG + Intergenic
926578327 2:14607394-14607416 ATGTGGGGAGAGCTGGCAAAAGG + Intergenic
927241805 2:20925744-20925766 CTGTGGACATAGCTGGCCATAGG - Intergenic
928650817 2:33401722-33401744 AAGTGGAAACAGCTGGAAACTGG - Intergenic
929092128 2:38229273-38229295 CTTTGGAAAAAACTGCCAAATGG - Intergenic
929849400 2:45570237-45570259 CTTTGGAAAGCTCTGGCAAAAGG + Intronic
931322844 2:61188710-61188732 CTGTGAAAACACATGCCAAAAGG + Exonic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932972978 2:76568345-76568367 CTGTGGAAACATAAGGGAAAAGG - Intergenic
934953159 2:98593003-98593025 CTGTGCCAACAGTAGGCAAACGG + Intronic
937966261 2:127514035-127514057 CTCAGGAAAGAGCAGGCAAACGG - Intronic
938306325 2:130258503-130258525 CTGTGGAAACACTTAACAAATGG - Intergenic
940670909 2:156666645-156666667 CTGTAGAAACAGCAGACATATGG - Intergenic
942087565 2:172457718-172457740 TTGTGGTAACAGCTGGGGAAAGG + Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169820557 20:9704993-9705015 CTGGGGAAACATTTGGCAAGAGG + Intronic
1169955312 20:11096427-11096449 ATGTGAAAGCAGCTGGCACATGG + Intergenic
1170052927 20:12166503-12166525 CTGCAGAAACTGCTGGCCAATGG - Intergenic
1170326385 20:15158650-15158672 CTTTGCAAACAGGTGACAAAGGG - Intronic
1170535451 20:17336534-17336556 CTGAGCAAACATCAGGCAAACGG + Intronic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1171310973 20:24144295-24144317 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1172936601 20:38624932-38624954 CTGTGGACACAGCAGTGAAAAGG - Intronic
1173952607 20:47005350-47005372 CTGTGGATACAGCTGTCATCAGG + Intronic
1174744578 20:53048701-53048723 CTTTGGAAACAGTCAGCAAATGG + Intronic
1176198376 20:63848234-63848256 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1176887896 21:14277858-14277880 TTGTAGAATCAGCTGGCAGATGG + Intergenic
1177522139 21:22239448-22239470 CTGTGAAAACAGCTGGCAGGGGG + Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1179930376 21:44567571-44567593 CTGTGCAAACCACTAGCAAATGG + Intronic
1180004381 21:45013315-45013337 CTGTGCAAACAGCCAGCAGAAGG + Intergenic
1180913904 22:19472176-19472198 CTGTGGGAAGAGCTGGCAGGAGG + Intronic
1183077752 22:35437460-35437482 CTGAGGAAACAGCTGAGAGATGG + Intergenic
1183268387 22:36845198-36845220 CCCTGGAAATAGGTGGCAAATGG - Intergenic
1183865222 22:40699003-40699025 CTGTGGGAACTTCTGGAAAAAGG + Intergenic
1184683682 22:46086324-46086346 CTATGGAAGCAGCTTGCAAATGG + Intronic
1184794767 22:46725555-46725577 CTGTGGGAACATCTTGCAAAGGG + Intronic
1184808513 22:46812332-46812354 CTGTGGGCACAGCAGGCACAAGG + Intronic
1184946055 22:47804944-47804966 CTCTGCATCCAGCTGGCAAATGG - Intergenic
1185391392 22:50563187-50563209 CTGGGGACACAGCAGGCAAACGG - Intergenic
950012588 3:9733530-9733552 CTGTGGAAACAGCTCCCCATGGG + Intronic
950359989 3:12443370-12443392 AGGAAGAAACAGCTGGCAAAGGG + Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
950940604 3:16886574-16886596 CTGCGCAAACAGATGACAAAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951554422 3:23906325-23906347 ATGTGGAAAGAACTAGCAAAAGG + Intronic
955386462 3:58484998-58485020 CTGGTGAAACTGGTGGCAAAAGG + Intergenic
956788698 3:72663680-72663702 CTGGGGAAGCAGCTGGCATAAGG + Intergenic
956855509 3:73271022-73271044 CCAAGGAAACAGCTGCCAAATGG + Intergenic
957165240 3:76663977-76663999 CTGTGGAGAAAGGGGGCAAAAGG + Intronic
959330323 3:104996738-104996760 CTGTGTAAAGAGGGGGCAAATGG - Intergenic
959436725 3:106324257-106324279 CTGTGGAAACAGAGTTCAAAGGG + Intergenic
959809052 3:110593994-110594016 CTGTGAAAACAGCTGGGAGTAGG + Intergenic
961620256 3:128218291-128218313 CTCCGGAAACAGCTGGTAACAGG + Intronic
961662537 3:128477332-128477354 CTGTGGCAACAGCTGGCAAGAGG + Intergenic
962250484 3:133833186-133833208 CTGTGGAATCACCTGTCACATGG - Intronic
963252705 3:143117782-143117804 CTGTGGGGGCACCTGGCAAATGG + Intergenic
963690507 3:148495014-148495036 CTGTGGATACAACAGGGAAAGGG + Intergenic
964480584 3:157134627-157134649 CTGTGTCAACCACTGGCAAATGG + Intergenic
964527904 3:157634811-157634833 GTTGGGAGACAGCTGGCAAATGG + Intronic
966274346 3:178146726-178146748 GTGTGGAAACAGGTTGGAAAGGG - Intergenic
966853055 3:184176314-184176336 CAGTGGAATAAGCAGGCAAAGGG - Intronic
968159202 3:196411434-196411456 CTGTGGAAATAAATAGCAAATGG + Intronic
968214347 3:196875675-196875697 CAATGGAAATATCTGGCAAAAGG - Intronic
968900700 4:3430501-3430523 CTGTGGAACCAGGAGGTAAACGG - Exonic
969110571 4:4841594-4841616 CTCTGGACACACCTGGGAAAGGG + Intergenic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
970552562 4:17197313-17197335 ATGTGGCAATGGCTGGCAAATGG - Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
972712425 4:41610714-41610736 CTGAGGTCACAGCTGGCAAGGGG + Intronic
972855441 4:43100171-43100193 CTTTCGACACAGCTGACAAATGG - Intergenic
973623844 4:52751735-52751757 CAGTGGACACAGGTGGCCAATGG - Intergenic
975079248 4:70255528-70255550 ATGTGGAAACAGCTCCAAAATGG + Intergenic
975600198 4:76091303-76091325 CTTTGGAAGAAGCTGCCAAATGG + Intronic
975943271 4:79673956-79673978 ATGTGGAAAGAGCAGGCATAAGG - Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
978363277 4:107953831-107953853 CTGTGGAAAAAGCTGGCAGGGGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979002736 4:115245952-115245974 ATATGGAAATATCTGGCAAATGG - Intergenic
982921177 4:161276996-161277018 TTGGGGAAGCGGCTGGCAAAAGG - Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
987244625 5:16036458-16036480 CTTTGGAAAAAGCTGGCATAGGG + Intergenic
987544473 5:19295138-19295160 ATGAGGAAACAGCTGGTACATGG - Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989517696 5:42362698-42362720 CTGTGGAAACCCCTGGTAAAGGG - Intergenic
989774459 5:45186671-45186693 CTAGGGAAAGAGCTGGAAAATGG - Intergenic
992495712 5:77291148-77291170 CTGTGGGAATAGCTGGCCAGAGG + Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
992924232 5:81564883-81564905 CTTTGGCAGCAGCTGGCAAGCGG - Intronic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994639642 5:102391230-102391252 CTTTGGAAATGGCTGGCAAGGGG - Intronic
996712688 5:126559261-126559283 CTGTGGGAACAGCTGGCCAGAGG - Exonic
996798436 5:127376387-127376409 CTGAGAAGACAGCTGGCAGATGG + Intronic
998654940 5:144168156-144168178 CTGTGAGAACAGTTGGCAACAGG + Intronic
1000581086 5:163035898-163035920 CTGTGGAAACAGCTGGGAAGGGG + Intergenic
1002741648 5:181438821-181438843 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1002867758 6:1138020-1138042 CTTTGGAAACACCCAGCAAAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006940867 6:37751564-37751586 CTGTGGAGTCAGATGACAAAGGG - Intergenic
1007079539 6:39089400-39089422 ATTTGGAGACAGCTAGCAAACGG + Intergenic
1007383006 6:41502813-41502835 CTCTGGACACTGCTGGCCAAGGG + Intergenic
1008097840 6:47358106-47358128 CTATGGAACCAGCTTGCAGAGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011330995 6:86206398-86206420 CTCTGCAGAAAGCTGGCAAAGGG - Intergenic
1011869525 6:91875249-91875271 CTGAGGAAACAATTGGCAACAGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1013845437 6:114445091-114445113 CTGAGTAATAAGCTGGCAAAAGG - Intergenic
1015180646 6:130358501-130358523 CTGTGGACACAGCAGTCAGATGG - Intronic
1015738106 6:136423229-136423251 CTGAGGATTCAGCTGGTAAATGG - Intronic
1017074604 6:150606243-150606265 CTCTGCAGACAGCTGCCAAAAGG - Intronic
1017813880 6:158003022-158003044 GTGTGGAAAGTGCTGGGAAAGGG + Intronic
1019246788 6:170714586-170714608 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1020912027 7:14142814-14142836 CTGTAAAAACAGTTGACAAATGG - Intergenic
1021682325 7:23146354-23146376 CTATGAAGACAGCTGGCAGATGG - Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031790087 7:126092130-126092152 CTGTGAATACAGCTGGGAAGGGG - Intergenic
1032664546 7:134022701-134022723 CTGTTAAAACAGCTGCCAAAAGG - Intronic
1033144533 7:138860074-138860096 ATGTGGAAACAGCTGCCATCGGG - Intronic
1035501354 8:93375-93397 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
1036673241 8:10806971-10806993 CTCTGCAAACAGCTTCCAAATGG + Intronic
1038622605 8:29158052-29158074 CGGAGGAAACAGCTAGTAAAAGG - Intronic
1038680020 8:29658208-29658230 CAGTGCAAACAGCTGGGAATTGG + Intergenic
1039398110 8:37244663-37244685 CTGTGGAATCACATGGTAAAGGG + Intergenic
1039821925 8:41142195-41142217 CTGTGGTGACAGCTGGCCAGTGG - Intergenic
1040604428 8:48916474-48916496 ATGTAGAAACATCTGGCAAGGGG - Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1042848579 8:73192700-73192722 CAGTGGAAAGAGCTTGCAAGTGG - Intergenic
1043378207 8:79673633-79673655 CTGAGGAAACAGAGGCCAAAGGG - Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045052749 8:98341886-98341908 CTCTTACAACAGCTGGCAAATGG + Intergenic
1045186054 8:99839314-99839336 CTGTGAAAACACTTGGTAAATGG - Intronic
1045187594 8:99854834-99854856 CTGTCTATATAGCTGGCAAAGGG + Intronic
1046440898 8:114252977-114252999 CTGTGGAACCACCTGCCACATGG + Intergenic
1048239731 8:132729656-132729678 CTGTGGACAAAGCTGCCAAAAGG + Intronic
1048253247 8:132884798-132884820 CTGTGGAAACAAATGCCACATGG + Intronic
1048562151 8:135551772-135551794 CTGTGGATAGAGCTGCCATATGG + Intronic
1049632474 8:143666029-143666051 CTTTGGACACACCTGGCAACTGG - Intergenic
1050508553 9:6371209-6371231 TTGTGGAAGCAGCTGGGAAGGGG + Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1053661825 9:40289574-40289596 CTGTTTAAACAGCTGGCATTTGG - Intronic
1054373951 9:64435810-64435832 CTGTTTAAACAGCTGGCATTTGG - Intergenic
1054522784 9:66086710-66086732 CTGTTTAAACAGCTGGCATTTGG + Intergenic
1055097859 9:72432879-72432901 TTGTGAAAGCAGCTGGCACATGG - Intergenic
1055796987 9:79985472-79985494 CTATGGAAACAGGTGTTAAAGGG - Intergenic
1056111594 9:83401668-83401690 CTGTTGAAACAGCTGTTAAGAGG - Intronic
1056735735 9:89208168-89208190 CTGTGGAAACCTCTGTCACAAGG - Intergenic
1057270974 9:93651367-93651389 CAGTGGAAACAGGAGGCAAAGGG - Intronic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1059132115 9:111764137-111764159 GTGTGGAAACAGTGGACAAAAGG - Intronic
1059435088 9:114271223-114271245 CTATGGATCCAGCTGGTAAAGGG - Intronic
1059632560 9:116140371-116140393 CTGTGGAAGCTGCTGGCCAGTGG + Intergenic
1060025908 9:120171417-120171439 CAGTGGAGACGGCTGGCAGATGG - Intergenic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1203607560 Un_KI270748v1:70037-70059 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1186429317 X:9490908-9490930 CAGAAGAAACAGCTGGCAAAAGG - Intronic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1187774622 X:22742439-22742461 CTGGGCAGACAGCTGCCAAAGGG - Intergenic
1187884677 X:23878367-23878389 CTGTGGCAACAGCTGTCACCAGG + Intronic
1189195194 X:39146887-39146909 CCTTGGACACTGCTGGCAAATGG - Intergenic
1189788767 X:44583627-44583649 CCGTGAAAGCAGCTGGGAAAGGG + Intergenic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1193893136 X:87076719-87076741 CCGTGGAAAGAACTGGCAGAAGG + Intergenic
1195424469 X:104712823-104712845 ATATGAAAACAGCTGTCAAAGGG - Intronic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1196173697 X:112617257-112617279 CTGTGAAAGCAGCTGGGAAGAGG + Intergenic
1196990942 X:121328076-121328098 CACTGGATACAGCTGGAAAAGGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199999371 X:153049758-153049780 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic
1201390831 Y:13495738-13495760 TTGTGGAAACAGTTAGGAAAAGG - Intergenic
1201504981 Y:14688332-14688354 CTGTGGACAGAGAAGGCAAAGGG + Intronic