ID: 972629328

View in Genome Browser
Species Human (GRCh38)
Location 4:40829673-40829695
Sequence CCATGGGTGTGTAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972629323_972629328 -9 Left 972629323 4:40829659-40829681 CCATCTGTGGGAGTCCATGGGTG 0: 1
1: 0
2: 0
3: 17
4: 205
Right 972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 277
972629316_972629328 15 Left 972629316 4:40829635-40829657 CCTCCTCCTGAAAAGCAAGAGAC 0: 1
1: 0
2: 0
3: 24
4: 187
Right 972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 277
972629317_972629328 12 Left 972629317 4:40829638-40829660 CCTCCTGAAAAGCAAGAGACTCC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 277
972629318_972629328 9 Left 972629318 4:40829641-40829663 CCTGAAAAGCAAGAGACTCCATC 0: 1
1: 0
2: 1
3: 21
4: 151
Right 972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972629328 Original CRISPR CCATGGGTGTGTAGGGCAGA GGG Intronic
900282253 1:1878268-1878290 CCATGGGAGTGTCAGGCAGAGGG + Intronic
900366378 1:2313520-2313542 CCAGGGGTGTGGAGGGTCGAGGG + Intergenic
900421520 1:2557892-2557914 ACAGGGGTGTCTGGGGCAGAAGG - Intronic
900787689 1:4658976-4658998 CCATTTGTGTGTGGGTCAGAGGG - Intronic
900898901 1:5503739-5503761 CCAGGGGTGACTAGGGCAGGTGG - Intergenic
900947110 1:5837210-5837232 GCAAGGGTGTGAAGGGCTGAGGG + Intergenic
901206425 1:7499551-7499573 CCATGAGTGTGTAGAGAGGATGG + Intronic
901676730 1:10889713-10889735 CCAGCGGGGTGTGGGGCAGACGG + Intergenic
902115702 1:14119216-14119238 CCATGGGTCTGTAGGGGAGCAGG + Intergenic
903515940 1:23911183-23911205 CCTTGGCTGTGGATGGCAGATGG - Intronic
903632452 1:24786430-24786452 ACAGGGGTGTGAAGGGAAGAGGG + Intronic
903811242 1:26036103-26036125 CCTTGGTAGTGCAGGGCAGACGG - Exonic
904808763 1:33149956-33149978 CCATGTTTGTGTTGGGCAGGTGG + Intronic
905351616 1:37350651-37350673 CCAGGCATGTGTGGGGCAGAAGG - Intergenic
906526619 1:46497045-46497067 CCCTGGGTGTCAATGGCAGAGGG - Intergenic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
908142803 1:61204658-61204680 CCAAGGGTGGGGGGGGCAGAAGG - Intronic
909741648 1:79037026-79037048 CCAAGGTTGTGCAGGGCAGTGGG - Intergenic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910560076 1:88580915-88580937 TCATGAGTGTGTAGAACAGAAGG + Intergenic
910631658 1:89361943-89361965 CTTTCGGTGAGTAGGGCAGATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
913142819 1:115958299-115958321 CAATGGCTGTTTAGGGCAGAGGG - Intergenic
915357149 1:155262175-155262197 GCAGGGGCGTGGAGGGCAGAGGG - Exonic
915527031 1:156482259-156482281 CCCTGGGTTTGTATGACAGAAGG + Intronic
916852213 1:168714968-168714990 CCATGGCTGTGTAGAGCTTATGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
919765432 1:201124360-201124382 CGATGGGTGTGTGGTTCAGAGGG - Intronic
919940466 1:202282582-202282604 CCATGGATGAGCAGGGCAGGAGG + Intronic
920891045 1:209985927-209985949 CCAAGGCTGTGCAGGGCAGCAGG + Intronic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
922069244 1:222174694-222174716 CCAAGGCTGTGCAGGGCAGCGGG + Intergenic
922740352 1:228010898-228010920 CCATGAGTGTGTAGGAGAGTGGG - Intronic
923046908 1:230362297-230362319 CCACGGGTGTGCAGGGCACGAGG + Intronic
924783975 1:247177481-247177503 CCATGGGTGGCTGGGGCTGAGGG - Intergenic
1066555481 10:36608164-36608186 CCAGGGGTGTGTGGGGAAGGAGG - Intergenic
1067157456 10:43794127-43794149 CCAGGGATGTCTGGGGCAGAGGG - Intergenic
1067946488 10:50692417-50692439 CCTTGGGTGTCTGGGGGAGAAGG - Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068157970 10:53224961-53224983 CCTTGGGAGGCTAGGGCAGAAGG + Intergenic
1068369110 10:56091008-56091030 CCAAGGCTGTGCAGGGCAGTGGG - Intergenic
1070145757 10:73772402-73772424 CCATGGGTCCGTAGCGGAGAGGG + Exonic
1070881801 10:79857418-79857440 CCTTGGGTGTCTGGGGGAGAAGG - Intergenic
1072255175 10:93614206-93614228 GCAGGGGTGTATAGGGCAGCTGG + Intronic
1074719077 10:116249048-116249070 CCAAGGTTGTGTGGGGCAAAGGG - Intronic
1076013563 10:127009825-127009847 CCAAGGATGCGTGGGGCAGAGGG - Intronic
1076669450 10:132111533-132111555 CCATGCGGGTGTGGGGCAGGAGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077138625 11:1013756-1013778 CCAGGGCGGTGTTGGGCAGATGG + Intronic
1077176412 11:1193181-1193203 CACTGGGTGTGTGGGGCCGAAGG + Intronic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1081160517 11:39743073-39743095 CCATAGATGTCTAGGGCAGGGGG - Intergenic
1085726642 11:78960599-78960621 CCAAGGGTGTTCTGGGCAGAGGG - Intronic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1089125123 11:116171487-116171509 GCATGTGTGTGTTGGGGAGAGGG + Intergenic
1090429690 11:126635479-126635501 CCATGGGAGAGTTGGACAGAAGG + Intronic
1091642930 12:2251221-2251243 TCATGGGGGTGAAGGGCAAAGGG + Intronic
1092588965 12:9932797-9932819 ACTTGGGTGGGTAGGGCAGGAGG - Intergenic
1094002181 12:25707268-25707290 CCAAGGGTGTGCAGGGCAGCAGG - Intergenic
1094003048 12:25717029-25717051 GGATGGGTGTGTAGGGGAAATGG + Intergenic
1094156887 12:27346743-27346765 CCATAGGTGTGTAGTTGAGATGG + Intronic
1094348835 12:29500240-29500262 GCTTGGCTGTGAAGGGCAGACGG + Intergenic
1095942510 12:47736273-47736295 CCATGGGGCTGAAGTGCAGAGGG + Intronic
1096768500 12:53914881-53914903 CTATGCGTGTGTGGGGCAGGGGG - Intergenic
1097136842 12:56864271-56864293 CCAAGGTTGTGCAGGGCAGCAGG - Intergenic
1098434055 12:70450451-70450473 CCATGGTTGTGCAGGGCAGCAGG - Intergenic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1103003555 12:117404567-117404589 CCATGGCTGAGGATGGCAGAAGG + Intronic
1103216139 12:119202768-119202790 CCCTGGGTGATTAGGGCAGGTGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1107414135 13:40185490-40185512 CCATGGGTGGATAGGGCTGGAGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1112438721 13:99409818-99409840 CCTGGGGTGTTTAGGGCAGGTGG - Intergenic
1112830289 13:103441127-103441149 CCATGGGAGTTTGGGTCAGAGGG + Intergenic
1114821822 14:26029714-26029736 CAATGGGTGACTAGGGCATATGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118233951 14:63982992-63983014 TCATGGTTGTGTAGGGCTTAGGG - Intronic
1118594009 14:67422124-67422146 CCCTGGGTGTATAGGCCAGATGG - Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1124404598 15:29382385-29382407 CCAAGTGTGTATAGGGCAGAAGG - Intronic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125029798 15:35064786-35064808 CCATGGGTGTGTGTGCCAGGAGG + Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1126406418 15:48327432-48327454 CCATGGGAGGTTTGGGCAGAAGG + Intergenic
1127137845 15:55943414-55943436 CCAAGGTTGTGTAGGGCAGCAGG - Intronic
1127282756 15:57505723-57505745 CCATGGAAGTGTGGGGCAAACGG + Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1128181832 15:65611446-65611468 CCATGGGTCAGTGGGGCAGAAGG - Intronic
1129200014 15:73993110-73993132 GCATGGGAGTGTAAGGAAGAAGG + Intronic
1129530097 15:76258668-76258690 CCATGGGTGTGGATGGCAGTGGG - Intronic
1129812817 15:78524406-78524428 CCAAGGCTGTGTAGGGCAGCAGG + Intronic
1130274497 15:82469375-82469397 CAATGGGTGGGTAGTGCAGTGGG + Intergenic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1130589139 15:85201342-85201364 CAATGGGTGGGTAGTGCAGTGGG + Intergenic
1131198888 15:90379682-90379704 CCAAGGCTGTGCAGGGCAGCAGG + Intergenic
1134345660 16:13388988-13389010 CTATGCGTGTATAGGACAGAGGG - Intergenic
1134899849 16:17927596-17927618 CCATCAGTCTGGAGGGCAGAGGG + Intergenic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1139001804 16:62519756-62519778 CCCTGGGTGACTAGGGCAGGTGG + Intergenic
1139591466 16:67935582-67935604 CCAGGGCTGTGAAGGGCAGACGG + Exonic
1139955662 16:70691822-70691844 CCAGCGGTGTGGAGGGCACAGGG + Intronic
1140224762 16:73068314-73068336 AGATAGATGTGTAGGGCAGATGG + Intergenic
1141201521 16:81902061-81902083 CCAAGGGTGTCCAGGGCAAATGG + Intronic
1141880798 16:86857556-86857578 CCATGGGTGTCTCTGGCTGAGGG - Intergenic
1141961895 16:87414387-87414409 ACAAGGGTGTGTCGGGCAGATGG - Intronic
1142129752 16:88427309-88427331 TCAGGGGTGAGTGGGGCAGAGGG - Intergenic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143357080 17:6338319-6338341 CCATGGGTTTGTCGGGCTGAGGG - Intergenic
1144459699 17:15448542-15448564 CCAGGGGTGTCTGCGGCAGAAGG - Intronic
1144767035 17:17738489-17738511 CCAAGGCCGTGTAGGGCAGCAGG - Intronic
1145290531 17:21542125-21542147 TCATGTGTGTGTATGGGAGAAGG - Intronic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1147037854 17:37695152-37695174 CCAAGGCTGTGCAGGGCAGCAGG - Intronic
1147978124 17:44259455-44259477 CGAGGGGTGTGGAGGGCTGAGGG + Intronic
1149893036 17:60406957-60406979 TCCTAGGTGTGTATGGCAGAAGG - Intronic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1156250988 18:35352502-35352524 CCAACGCTGTGTAGGGCAGCAGG - Intergenic
1156409004 18:36810153-36810175 CCAGGGGTGCTTGGGGCAGAAGG - Intronic
1157406292 18:47424875-47424897 CCCTTGGTGTGTGGGGCAGAAGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160792190 19:927945-927967 TAAAGGGTGTCTAGGGCAGAGGG + Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162831713 19:13288718-13288740 CCAGGGGTCTGTAGTCCAGAAGG - Intronic
1162913392 19:13861930-13861952 CCGGGGGTGTGTAGGGGGGAGGG + Intergenic
1163389523 19:17021906-17021928 CCCTGGGGATTTAGGGCAGAAGG + Intronic
1163579673 19:18130864-18130886 CCATGGGGGTTTAGGGCTGGAGG + Intronic
1163786852 19:19279196-19279218 CCAGGGGTATGTGGGGCAGCGGG - Exonic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1164699983 19:30278362-30278384 CCATGGGCGATTAGGGCAGGAGG + Intronic
925045304 2:768688-768710 TCAGGGGTGGGAAGGGCAGAAGG + Intergenic
925122124 2:1427466-1427488 CCATGAGTGTGTGGGGGTGAGGG + Intronic
926060450 2:9801558-9801580 ACATGGGGATCTAGGGCAGAGGG + Intergenic
926820753 2:16849101-16849123 CCATGTGGGTGTTGGGCAGGTGG - Intergenic
929204459 2:39275239-39275261 CACTGGGTGGGTAAGGCAGAAGG + Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
930028979 2:47046959-47046981 CCGTGGGTGACTAGGGAAGAAGG - Intronic
930523474 2:52497468-52497490 CCAAAGTTGTCTAGGGCAGAGGG - Intergenic
932633830 2:73370567-73370589 CCATGGGTGTTCATGGGAGATGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935225426 2:101048094-101048116 CCCTGTGTGTGTGGGGCACATGG - Intronic
935330132 2:101970989-101971011 CCATGAGTGTGTATGGGGGATGG + Intergenic
936165406 2:110115854-110115876 CGATGGGTGTGTCGGGCAGGAGG - Exonic
940205596 2:151198167-151198189 CCCTGGCAGTGTAAGGCAGACGG - Intergenic
941261779 2:163306819-163306841 CCAAGGTTGTGTAAGGCAGCAGG - Intergenic
946039175 2:216769303-216769325 TCATGGGTGTTTGGGGGAGAGGG - Intergenic
947863055 2:233376154-233376176 CCTTTGGTGTGTAGTGGAGATGG + Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948167975 2:235877943-235877965 CCATAGGTGTGCAGGGTGGAGGG - Intronic
948504060 2:238415916-238415938 TCATGGGTGGGGAGGGTAGAGGG + Intergenic
949036305 2:241817074-241817096 CCTTGGGTGCCTGGGGCAGAGGG + Exonic
1168863088 20:1060197-1060219 GCATGGGTATGTAGACCAGAAGG + Intergenic
1168863199 20:1061027-1061049 TCATGGGTCTGTAGGTCAGCTGG + Intergenic
1169415998 20:5416746-5416768 CCATAGATGGGAAGGGCAGAAGG - Intergenic
1169514361 20:6299776-6299798 GCATGGGTTTGTGGGGAAGAAGG + Intergenic
1169554354 20:6733952-6733974 TCATGGGTCTGAAGGGCAGCTGG + Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172615575 20:36281461-36281483 CAATGGGTGTGTGGCCCAGAAGG + Intergenic
1173644536 20:44625459-44625481 CCATGGGGCTGTGGGGCACAGGG + Intronic
1173908084 20:46643185-46643207 CCATGGGTGGGAAGGGGGGAAGG + Intronic
1176363179 21:6015924-6015946 CCAAGTGTGTGTATGGCAGCTGG - Intergenic
1177835768 21:26184748-26184770 CCAAGGCTGTGCAGGGCAGTGGG + Intergenic
1178511305 21:33207197-33207219 CCATGGGAGGGAAGGGCAGGTGG - Intergenic
1178901805 21:36604839-36604861 TCATCGGTGTGAAGGGGAGAGGG - Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179760339 21:43522621-43522643 CCAAGTGTGTGTATGGCAGCTGG + Intergenic
1179916342 21:44480512-44480534 CCATGGGTGGGGTTGGCAGATGG + Intergenic
1180580032 22:16825625-16825647 CCATGGGTGCGAAGAGAAGAGGG - Intergenic
1181144442 22:20834365-20834387 CCATGGATGAGTTGGGGAGAAGG - Intronic
1181608140 22:23992881-23992903 ACATGGGAGGGTAAGGCAGAAGG - Intergenic
1181945233 22:26511825-26511847 CCAGGAGTGTTTAGGACAGAAGG + Intronic
1182280513 22:29215453-29215475 CCATGGGTGTCCAGGGCAGTGGG + Intronic
1183501487 22:38182036-38182058 CCATGTTTGTGCGGGGCAGAAGG + Intronic
1184441417 22:44518839-44518861 CCATGGGGTTGTGGGGCAGAGGG + Intergenic
1184464788 22:44662487-44662509 CCAGGGGTGTGTAAGGAAGATGG - Intergenic
1184695206 22:46135135-46135157 TCACTGGTGTGGAGGGCAGAGGG + Intergenic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
950776062 3:15351593-15351615 CCAAGGCTGTGCAGGGCAGTGGG - Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
953883665 3:46704151-46704173 CCCTGGGTGTCTAGGGGACACGG - Intronic
953883697 3:46704257-46704279 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883750 3:46704447-46704469 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883801 3:46704612-46704634 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883810 3:46704639-46704661 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883833 3:46704721-46704743 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883842 3:46704749-46704771 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883867 3:46704831-46704853 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883876 3:46704858-46704880 CCCTGGGTGTCTAGGGGACATGG - Intronic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
958829312 3:99068249-99068271 CCTTGGGTGATTAGGGCAGGTGG - Intergenic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
962923752 3:139973533-139973555 ACAGGGGTGTGTGGGGTAGAGGG + Intronic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
963296565 3:143553048-143553070 CCTTGGGTGTGTTTGGCAGCAGG - Intronic
964154109 3:153564164-153564186 CCAAGGTTGTGCAGGGCAGTGGG - Intergenic
966413977 3:179670372-179670394 CCATGGGGGTGAGCGGCAGAAGG - Intronic
967805928 3:193714753-193714775 CCAAGGTTGTGCAGGGCAGCAGG - Intergenic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969477788 4:7431253-7431275 CAAGGGGTGGGTAGGGAAGAGGG + Intronic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
970317004 4:14838806-14838828 CCAAGGGTGAGCAGGACAGAGGG + Intergenic
970500972 4:16676880-16676902 GCATGGGAGAGTAGGGCAAAGGG + Intronic
971328494 4:25663555-25663577 CCAAATGTATGTAGGGCAGAAGG + Intronic
971965875 4:33555164-33555186 CCAGGGGTGTGTAGTGGGGATGG - Intergenic
972323646 4:37994916-37994938 CCATGGGTGATTAGAGCTGAGGG + Intronic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
973131572 4:46654195-46654217 CCAAGGCTGTGCAGGGCAGTGGG + Intergenic
975981233 4:80161688-80161710 CCATGGGTGTGTATGGGAAATGG - Intergenic
978391172 4:108226855-108226877 TCATGGATGTGGAGGGCTGACGG + Intergenic
981010707 4:139922056-139922078 CCAGGTCTGTGGAGGGCAGAGGG + Intronic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
986018012 5:3774989-3775011 GGATGGGTGTGTTGGGTAGATGG - Intergenic
987143412 5:14967740-14967762 CCATGGGTGAGTGGCTCAGAGGG - Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990706197 5:58532336-58532358 CCAAGGCTGTGTAGGGCAGTGGG - Intergenic
991638916 5:68734093-68734115 CCACGGATGTGAAGGGCCGACGG - Intergenic
992813398 5:80411858-80411880 CCATGAGTGGCTAGGGTAGATGG - Intronic
993589186 5:89773078-89773100 GCATGTGTGTGAAGGGAAGAAGG + Intergenic
993946625 5:94123173-94123195 CCAAGGCTGTGCAGGGCAGCGGG + Intergenic
995117702 5:108500452-108500474 TCAAGGCTGTGTAGGGCAGTGGG - Intergenic
995374099 5:111453921-111453943 CCTGGGGTGTGTAGGTCAGATGG + Intronic
995535508 5:113131732-113131754 ACATGGGTTTGGAAGGCAGAGGG - Intronic
997454658 5:134007653-134007675 CCAGGGATGAGTATGGCAGAGGG + Intergenic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
997820209 5:137058767-137058789 CCATGGATGTCTGGGGAAGAGGG + Intronic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1002281746 5:178134376-178134398 CCATGGTAGTGTTGGGCAAAAGG + Intronic
1004588363 6:17025272-17025294 CCAAGGTGGTGTAGGGCAGCAGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008437744 6:51496010-51496032 CCTGGGGTGACTAGGGCAGAGGG + Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1008969181 6:57346779-57346801 CCAGGGATGTGGAGGGCAAATGG + Intronic
1009158159 6:60248597-60248619 CCAGGGATGTGGAGGGCAAATGG + Intergenic
1010761794 6:79732651-79732673 CCCTGGGTGATTAGGGCAGGTGG - Intergenic
1013630732 6:111983572-111983594 TCATGGCTGTGTTGGTCAGATGG + Intergenic
1015582670 6:134743297-134743319 ACATGTGTGTTTAGGGCAGTCGG - Intergenic
1016870619 6:148812833-148812855 TCATGGGTGTGAATGGCAGGAGG + Intronic
1016907836 6:149169148-149169170 CCAGGGGGGATTAGGGCAGATGG + Intergenic
1017234267 6:152103405-152103427 ACCTGGGGGTGTTGGGCAGAGGG - Intronic
1018562543 6:165117572-165117594 CCATGTGTGTGTATGGCATGTGG - Intergenic
1019645873 7:2128723-2128745 CCCAGGGTGAGAAGGGCAGAGGG - Intronic
1021333044 7:19362809-19362831 CCATGCCTGTGAAGGACAGAAGG - Intergenic
1022418636 7:30199467-30199489 CCGTAGGAGTGTAGGCCAGAAGG - Intergenic
1023984724 7:45088104-45088126 CCATGTGTGGGTAGGGCCAAGGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1027677742 7:81180830-81180852 CCAAGGGTGCGTAGGGCATCAGG - Intronic
1029444214 7:100603819-100603841 CCATGTGAGTGCAGAGCAGAGGG - Intronic
1032330476 7:130974747-130974769 TCATGGCTGTGCAGGGCAGCTGG - Intergenic
1032471457 7:132182078-132182100 CAATGTGAGTGTAGGGCTGATGG - Exonic
1032851462 7:135799059-135799081 GCATGGGTGTGGTGGGCACAAGG - Intergenic
1034429356 7:151033536-151033558 CCATGGGTGTGCTGGTCAGCAGG + Intronic
1035813863 8:2517275-2517297 CCATGGGTGTGTCGAGGTGATGG - Intergenic
1035818754 8:2568796-2568818 CCATGGTTGTCTATGGCATATGG + Intergenic
1036631115 8:10515934-10515956 CCTTGGATGTGATGGGCAGAGGG + Intergenic
1037882975 8:22581822-22581844 CCAAGAGTGTGCAGGGCACAGGG + Intronic
1038485172 8:27930010-27930032 CCATGGGATTGTAGGGCATTTGG - Intronic
1039468715 8:37800923-37800945 CCATGGGAATGTGGGGGAGATGG - Intronic
1042079144 8:65030888-65030910 GCATGGCTGTGTAGAGCACATGG + Intergenic
1042514338 8:69643993-69644015 CCGGGGGTGTGTGGGGCAGGCGG + Intronic
1043333997 8:79151015-79151037 CCATGGCAGCGTAGGGCAGCAGG - Intergenic
1044665439 8:94629944-94629966 CCATGGGCTTCTAGAGCAGAAGG + Intergenic
1044771582 8:95641194-95641216 CCACAGCTGTGGAGGGCAGAGGG - Intergenic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1046134070 8:110003934-110003956 CCAAGGCTGTGTAGGGCTGCAGG + Intergenic
1046470249 8:114663045-114663067 CCATTGGTGAGTATGTCAGACGG - Intergenic
1046819908 8:118622609-118622631 GCATGGGGGTGTAGGGGAGGAGG + Intergenic
1048087656 8:131201574-131201596 CCAAGGCTGTGCAGGGCAGAAGG - Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049979647 9:892429-892451 GCCTGGGTGTGTAGAGCAGAGGG - Intronic
1050948664 9:11559930-11559952 GCATGGATGTGCAGGGCAGGAGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1055147972 9:72959005-72959027 CCAAGGTAGTGTAGGGCAGCAGG + Intronic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1057983139 9:99682087-99682109 CCAAGGTTGTGTAGGGCACTGGG + Intergenic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1060829933 9:126706968-126706990 CCATGTGTGTGTAAGTGAGACGG - Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061498554 9:130989679-130989701 CCATGGGAGAGGAGGGCAGGGGG - Intergenic
1061518549 9:131103849-131103871 CCCAGGGTGTGTAGGACATAGGG - Intronic
1185822589 X:3219556-3219578 CCTAGGGTGTCCAGGGCAGATGG - Intergenic
1186150889 X:6673359-6673381 CTATGCATGTGTAGGGGAGAAGG - Intergenic
1191802119 X:65093009-65093031 CCAAAGCTGTGCAGGGCAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193547280 X:82845806-82845828 CCAAGGCTGTGCAGGGCAGTGGG - Intergenic
1195715970 X:107819124-107819146 CCAAGGCTGTGCAGGGCAGCAGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1199109164 X:143910004-143910026 CCAAGGTTGTGTAAGGCAGCAGG + Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic