ID: 972630635

View in Genome Browser
Species Human (GRCh38)
Location 4:40838754-40838776
Sequence CCACCATGCCTGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1293
Summary {0: 1, 1: 4, 2: 39, 3: 189, 4: 1060}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972630629_972630635 8 Left 972630629 4:40838723-40838745 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630632_972630635 4 Left 972630632 4:40838727-40838749 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630623_972630635 21 Left 972630623 4:40838710-40838732 CCGCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630624_972630635 18 Left 972630624 4:40838713-40838735 CCCACCTCAGCCTCCCAAAGTGC 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630631_972630635 5 Left 972630631 4:40838726-40838748 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630627_972630635 14 Left 972630627 4:40838717-40838739 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060
972630625_972630635 17 Left 972630625 4:40838714-40838736 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG 0: 1
1: 4
2: 39
3: 189
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972630635 Original CRISPR CCACCATGCCTGGCAAAAGC AGG Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
900205788 1:1431400-1431422 ACACCATGCTGGGCAAAAGTTGG - Intergenic
900345290 1:2207583-2207605 ACACCATGCCTGGCAGGAGCTGG + Intronic
901024550 1:6272195-6272217 GCACCATGCCTGGACATAGCAGG + Intronic
901527296 1:9831681-9831703 CCACCACGCCTGGCCCAAGGAGG - Intergenic
901551606 1:9999257-9999279 CCACCGAGCCTGGCAAGAGTGGG - Intronic
901707833 1:11089668-11089690 CCACTGTGCCTGGCCAGAGCTGG - Intronic
901793744 1:11668547-11668569 CCACCACACCTGGCTAATGCAGG + Intronic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
901882993 1:12204885-12204907 CCACCTTGCCTGGCCAGACCAGG - Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902176274 1:14653328-14653350 CCACCATACCTGGCACCTGCAGG - Intronic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902686865 1:18083203-18083225 GCACAATGCCTGGCAATAGTAGG + Intergenic
902832564 1:19026670-19026692 CCACCATGCCTGGCCTAAGTGGG + Intergenic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903040142 1:20523318-20523340 CCACCATGCCTGGCCTCAGCTGG + Intergenic
903060162 1:20663726-20663748 CCCCCAGGACTGTCAAAAGCTGG + Intergenic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
903307725 1:22425060-22425082 CCACCATGCCTGGCCCATGAGGG - Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903498131 1:23785338-23785360 CCACCATGCCCGGCAAATTTTGG - Intronic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904544634 1:31259394-31259416 CCACCGCGTCTGGCAAAACCAGG + Intergenic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
904717048 1:32476286-32476308 CCACCATGCCTGGTCATAGGGGG + Intronic
904844662 1:33401037-33401059 CCACCATGCCTGGCCCAAGATGG - Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905019846 1:34801612-34801634 CCACCATGCCTGGCTAGTGAGGG + Intronic
905089428 1:35416849-35416871 CCACCATGCCTGGCCTCAGTTGG + Intronic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
905866627 1:41380450-41380472 AGAACAGGCCTGGCAAAAGCAGG + Intronic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
906406483 1:45546460-45546482 CCACCGTGCCCGGCCAAGGCTGG + Intergenic
906432458 1:45766080-45766102 CCACCATGCCCAGCCAAAGCAGG - Intergenic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908286657 1:62611855-62611877 CCACCATGCCTGGCCAGATAAGG - Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
908645005 1:66268380-66268402 CCACCATGCCTGGCCGAAGAGGG - Intronic
909215233 1:72878301-72878323 CCAGCATGGCTAGAAAAAGCAGG + Intergenic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
910414917 1:86987359-86987381 CCACCATGCCTGGCCCAACTAGG + Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911291855 1:96066000-96066022 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
911330208 1:96518345-96518367 CCACCATGCCTGGCCCAGGTTGG - Intergenic
911852776 1:102839654-102839676 CCAGATTGCTTGGCAAAAGCAGG + Intergenic
912488375 1:110047088-110047110 GCACAATGCCTGGGAAGAGCTGG - Intronic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
913178051 1:116292962-116292984 CCACCATGTCTGGCCTAAGATGG + Intergenic
913270401 1:117087578-117087600 CCACCATGCCTGGCCATATTAGG + Intronic
914407786 1:147393305-147393327 CCACCGTGCCCGGCCAAGGCAGG + Intergenic
914408344 1:147400257-147400279 CCACCCTGGCTGGGAAAGGCAGG + Intergenic
914413691 1:147457362-147457384 CCACCATGCCTGGCCTGAGATGG - Intergenic
915062867 1:153200991-153201013 CCACCGCGCCTAGCAAAAGCAGG + Intergenic
915139560 1:153758818-153758840 CCACCATGCCTGGCCAGGCCTGG - Intronic
915211214 1:154310998-154311020 CCACCGTGCCCGGCCAAAGATGG + Intergenic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
916408416 1:164520811-164520833 CCACCGTGCCTGGCCAGAGAAGG - Intergenic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917692554 1:177484156-177484178 CCACCATGCCTGTCCGATGCTGG - Intergenic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918328377 1:183432179-183432201 CCACCAGACCTGACAAAAGTGGG - Intergenic
918481927 1:184987685-184987707 CCACCATGCCTGGAACATGAAGG + Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919585043 1:199427229-199427251 CCACCACGCCTGGCCACAGTCGG - Intergenic
919768938 1:201144909-201144931 CCACAATGCCTGGCCATTGCCGG + Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919902774 1:202056505-202056527 CCACCATACCTGGCTAATGTTGG + Intergenic
920050232 1:203160146-203160168 CCACTCTGCCAGGAAAAAGCAGG - Intronic
920246364 1:204590511-204590533 GCACAATGTATGGCAAAAGCAGG + Intergenic
920371948 1:205484716-205484738 CCACCATGCCTGGTCATAGCTGG - Intergenic
920507248 1:206525280-206525302 CCAACCTGCCTGGCAGAAGTTGG - Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920584589 1:207145386-207145408 CCACCATGCCTGGCCATACTTGG + Intergenic
921012238 1:211153366-211153388 CCACCACGCCCAGCCAAAGCAGG + Intergenic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921405717 1:214777046-214777068 CCACCATCACTGGGCAAAGCTGG - Intergenic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922295027 1:224242618-224242640 CCACCATGCCTGGCCAATTTTGG + Intronic
922407638 1:225332705-225332727 CCACCATGCCCAGCCAAAGCAGG - Intronic
922905962 1:229173980-229174002 CCATCGTGCCTGGCTGAAGCTGG - Intergenic
922954896 1:229590924-229590946 CCACCATGCGTGGCCTCAGCTGG + Intergenic
923160634 1:231311783-231311805 ACACCATGTGTGGCAACAGCTGG + Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
924113775 1:240725987-240726009 CCACCACCCCTGGCCAATGCAGG + Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064007704 10:11711700-11711722 CCATCACGCCTGGCCTAAGCTGG + Intergenic
1064078164 10:12286913-12286935 CCACCATGCCTGACCATAGGTGG + Intergenic
1064266728 10:13831293-13831315 CCACCATACCTGGCCAATCCTGG - Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064358192 10:14638901-14638923 CCACCGTGCCTGGACAAAGTAGG - Intronic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064728709 10:18307307-18307329 CCACCACGCCTGGCTAATGTTGG - Intronic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065153365 10:22845165-22845187 CATCCATGCCTGGCCAATGCAGG - Intergenic
1065216134 10:23450628-23450650 CCACTATGCCTGGCTACATCTGG + Intergenic
1065349986 10:24786762-24786784 ACACCATGCCTGGCCAAGGCAGG + Intergenic
1065561868 10:26971803-26971825 ACACCAAGCCAGGTAAAAGCTGG - Intergenic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066085032 10:31967994-31968016 CCACCATGCCCGGCTGAGGCTGG - Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066546335 10:36504231-36504253 CCACCATGCCTGGCTGTAGAAGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067813003 10:49445298-49445320 TCACCATTCCTGGCAAATGCGGG + Intergenic
1067826633 10:49578767-49578789 CCACCATGCCCAGCCAGAGCAGG - Intergenic
1068879161 10:62030416-62030438 CCACCACGCCCGGCCAATGCAGG + Intronic
1069389921 10:67923837-67923859 AAATCATTCCTGGCAAAAGCAGG + Intronic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069689375 10:70339831-70339853 CCACCATGCCTGGCCGATGTTGG - Intronic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1069910971 10:71759020-71759042 CCACCATGCCAGGCAAATTTTGG + Intronic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070169938 10:73925354-73925376 CCACCATGGCTGGCCTAAGAAGG + Intergenic
1070196456 10:74161665-74161687 CAACCATTCCTGGCAGAATCAGG + Intronic
1070240208 10:74673029-74673051 CCAGCCTTCCTGACAAAAGCTGG + Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071590361 10:86866649-86866671 CCACCATGCCCGGCCAACTCAGG + Intronic
1071699176 10:87910709-87910731 CCACCATGCCTGGCCACTGTGGG + Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072157282 10:92735441-92735463 CCACCATGCCTGGCAGATTTTGG + Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1073086859 10:100896600-100896622 CCACCGCACCTGGCCAAAGCTGG + Intergenic
1073153144 10:101325534-101325556 ACACCAGGCCTGGCCAGAGCAGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074372203 10:112909099-112909121 CCACCACACCTGGCAAGAGAGGG + Intergenic
1074602691 10:114931337-114931359 CCAGCATGGCTAGAAAAAGCAGG + Intergenic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075368200 10:121912031-121912053 CCACCATGCCCGGCCAAGCCCGG + Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1076718486 10:132381161-132381183 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077483883 11:2830122-2830144 CCACCCTGGCTGGGAACAGCAGG + Intronic
1077560655 11:3258280-3258302 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077566551 11:3304108-3304130 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078255510 11:9655315-9655337 ACACCATGCCTGGCCTAAGCAGG + Intergenic
1078341297 11:10499501-10499523 CCATCATGTCTGGCCAAACCTGG + Intronic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1078936314 11:15953957-15953979 ACACCACACATGGCAAAAGCAGG + Intergenic
1079324280 11:19478192-19478214 CCACCATGCCTGCCAAAAGGAGG - Intronic
1079607865 11:22392240-22392262 CCAGCATGGCTAGAAAAAGCAGG + Intergenic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080103777 11:28490224-28490246 CCACCATCCCTGGCAATGCCAGG - Intergenic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080591220 11:33724513-33724535 GCACAATGCCTGGCCAAAGATGG + Intronic
1080936440 11:36868816-36868838 CCACCATGCCCAGCCTAAGCAGG - Intergenic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083549459 11:63575500-63575522 CCTCCATGCCTGGCAGGACCAGG - Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084627627 11:70320722-70320744 CCACCATGCCTGGCCTTAGATGG + Intronic
1084635776 11:70391527-70391549 CCACCACGCCTGGCTATGGCCGG + Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1085758068 11:79218001-79218023 CCACCATGCCTGGCCAGGGTAGG + Intronic
1086073946 11:82830338-82830360 CCACCGTGCCTGGCCAGCGCAGG - Intronic
1086293372 11:85336565-85336587 CCACCATGACTGGCATCAGCAGG + Intronic
1086497917 11:87422793-87422815 CCACCATAGCTGGGAAAGGCAGG + Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087104423 11:94395930-94395952 CCACCATGCCCGGCCATTGCTGG - Intronic
1087251340 11:95903825-95903847 CCACCATGCCTGGCCTAATGAGG - Intronic
1087327347 11:96740009-96740031 CCACCATGCCCAGCTAAGGCTGG - Intergenic
1087783306 11:102325065-102325087 CCAACAGATCTGGCAAAAGCAGG + Exonic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1090199694 11:124845449-124845471 CCACCAGTACTGGCAAAAGGGGG + Intergenic
1091083006 11:132690225-132690247 TCACCATGCCTGGCCAAGCCAGG + Intronic
1091500655 12:1014326-1014348 CCATCATGCCTGGCTAATGTTGG + Intronic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092808646 12:12251217-12251239 CCACCGTGCCCAGCCAAAGCCGG + Intronic
1092886031 12:12925107-12925129 CCACCGTGCCCGGCTAGAGCAGG + Intergenic
1092944999 12:13444668-13444690 CCACCATGCCTAGCCTAGGCTGG + Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093963583 12:25302070-25302092 CCACCATGCCTAGCCAATCCTGG - Intergenic
1094019485 12:25898878-25898900 CCACCATGCCTGGCACACTTAGG + Intergenic
1094357199 12:29590497-29590519 CCACCATGCCTGGCCACACGTGG - Intronic
1094653647 12:32400306-32400328 CCACCACGGCTGCCCAAAGCAGG - Intronic
1095107536 12:38253336-38253358 CCACCATGCCTGGTCAATGCAGG + Intergenic
1096257383 12:50071796-50071818 CCACCATACCTGGCTAGAGAAGG + Intronic
1096809481 12:54160442-54160464 GCACCATGCCTGCCTATAGCAGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097366682 12:58722486-58722508 CCAGCATGGCTAGAAAAAGCAGG - Intronic
1098231585 12:68376518-68376540 ACACATTGCCTGGCAGAAGCAGG + Intergenic
1098283436 12:68884430-68884452 GCAGCATGCCTGGCAAGGGCAGG + Intronic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099619389 12:84981879-84981901 GCAGAATGCCTGGCAAAAGCAGG + Intergenic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1100255302 12:92877262-92877284 CCACCATTCCTGGCCTAACCTGG + Intronic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100597261 12:96082319-96082341 CCACCATGCCTGGCCAATTTTGG - Intergenic
1100602304 12:96122405-96122427 CCACCTTGCCTGGCCAATGTTGG + Intergenic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1100828187 12:98494177-98494199 CCACCTTGCCTGGCCAAGGTTGG - Intronic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101345189 12:103879863-103879885 GCACCACGCATGGCACAAGCAGG + Intergenic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1102008876 12:109606099-109606121 CCACCCTGCAGGGCAACAGCTGG - Intergenic
1102017778 12:109659407-109659429 CCACCATGCCCGGCAGAACTGGG - Intergenic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102158501 12:110749292-110749314 CCATCATGCCTGGCTAATGTTGG + Intergenic
1102217117 12:111169447-111169469 CCACCATGCCCCAGAAAAGCAGG + Intronic
1102246067 12:111356781-111356803 CCACCACACCCGGCAAAAGCAGG - Intergenic
1102251503 12:111390495-111390517 CCACCACACCTGGCAAGTGCAGG + Intergenic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1103047987 12:117754348-117754370 CCACCATGCCTGGCCGAGGAAGG - Intronic
1103374172 12:120442270-120442292 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103867786 12:124066854-124066876 CCACCATGCCCGGCGCAAGATGG + Intronic
1103955384 12:124573587-124573609 CCACCATGCCCAGCAACAGTAGG - Intergenic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104531877 12:129579681-129579703 CCAGCATGGCTAGAAAAAGCAGG - Intronic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104855768 12:131901917-131901939 CGACCTTGCTTGGAAAAAGCAGG - Intronic
1105385076 13:19922200-19922222 CCACCAGGCCTGGCCACAGGTGG + Intergenic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1106642909 13:31604682-31604704 CCACCGCGCCTGGCCAAGGCTGG - Intergenic
1106685562 13:32055328-32055350 CCACCATGCCTGGCCTAAGATGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1106852906 13:33814466-33814488 CCACCAGTCCAGGCAGAAGCAGG - Intergenic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1107556957 13:41524699-41524721 CCACCATGCCTGGTAAATTATGG - Intergenic
1107606294 13:42060634-42060656 ACACTATGCCTGGCCATAGCAGG - Intronic
1108079497 13:46720097-46720119 CCACCGTGCCTGGCCAAGGTAGG - Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108597134 13:51959354-51959376 CCACCATGCCTGGCTAGATAGGG - Intronic
1108724111 13:53162298-53162320 CCACCATGCCTGGCCCCAGTAGG + Intergenic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1111003856 13:82223040-82223062 CCACCATGCCCGGCCAATGTAGG - Intergenic
1111626467 13:90794246-90794268 CCACCATGCCTGGCCAGACAGGG + Intergenic
1111991841 13:95124402-95124424 CCACCATGCCTGGCAGCAGTGGG - Intronic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1112478321 13:99752330-99752352 GCACCATGTCTGGCACATGCAGG - Intronic
1112590117 13:100755611-100755633 CCACCATGCCTGGCCATATTCGG - Intergenic
1113018576 13:105856609-105856631 CCACCACGCCTGGCACAGGCCGG + Intergenic
1113080817 13:106518050-106518072 CCACCACGCCTGGCAACATAAGG - Intronic
1113339455 13:109407963-109407985 CCACCATGCCCGGCTAAGGTAGG + Intergenic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1115058928 14:29167773-29167795 CCACCATGCCTGTCCAAGGCTGG - Intergenic
1116116683 14:40661441-40661463 CCACCCTGCCTGCAAGAAGCAGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117415316 14:55490202-55490224 CCACCATGCCTGGCCATCTCAGG + Intergenic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1118264476 14:64281283-64281305 GAACCATGCCTGGCAACATCAGG - Intronic
1118407646 14:65442455-65442477 CCACCACGCCTGGCCAAGGGTGG + Intronic
1118658804 14:67984222-67984244 CCACCATGCCTGGCCAGGGCTGG + Intronic
1119349860 14:73955238-73955260 CCACCGCGCCCGGCAGAAGCTGG + Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1120231862 14:81848898-81848920 CCAGCATGGCTAGAAAAAGCAGG - Intergenic
1120501327 14:85300647-85300669 CCACCATGCCTGGCCAGATATGG - Intergenic
1120955373 14:90077406-90077428 CCACCATGCCCGGCCAATCCTGG + Intronic
1121067352 14:90980882-90980904 CCACCACGCCTGGCAATATAAGG - Intronic
1121189235 14:92010241-92010263 CCACCACGCCTGGTGAAAGAAGG - Intronic
1121275200 14:92662644-92662666 CCACCAAGCCTAGCAAACCCAGG - Intronic
1121326664 14:93024179-93024201 CCTCCAGGCCTGGCAACAGGAGG - Intronic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121402810 14:93695737-93695759 CCACCATGCCTGGCTGATGTTGG - Intronic
1121436725 14:93925535-93925557 CCACCCTGACTGGTACAAGCAGG - Intronic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122449595 14:101794520-101794542 CCACCATGCCTGGCTACTGTTGG + Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1123099549 14:105787230-105787252 CCACCATGCCTGTCCTATGCTGG + Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1123917163 15:25043058-25043080 CCACCATGCCTGGCATCATTAGG + Intergenic
1123965242 15:25449471-25449493 CCACCATGCCCAGCCAAGGCAGG - Intergenic
1124042307 15:26116788-26116810 CCACCACGCCTGACCAAAGATGG - Intergenic
1124548805 15:30657997-30658019 CCACCATGCCTGGCCACACATGG + Intronic
1125133271 15:36309921-36309943 CCACCATGCCTGGCTAATCTTGG + Intergenic
1125342297 15:38686890-38686912 CCACCATGCCTGGTAAAACATGG - Intergenic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125898565 15:43324327-43324349 CCACCATGCCTGGCCTAGGTGGG - Exonic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126167185 15:45663476-45663498 CCACCATGCTCAGCCAAAGCAGG - Intronic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126770372 15:52049898-52049920 CCACCACGCCTGGCAAATTAAGG + Intronic
1127087737 15:55440336-55440358 CCACCACGCCTGGCCAATGATGG + Intronic
1127241402 15:57119243-57119265 CCACCATGACTGGCTAATGGTGG + Intronic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1127473797 15:59313647-59313669 CCACCATTCCTGCCAAATGAAGG + Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127857084 15:62961863-62961885 GCACGATGCCTGGCACAAGACGG + Intergenic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128352966 15:66903716-66903738 CCACCACGCCCGGCCAAGGCTGG + Intergenic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128479397 15:68024260-68024282 CCACCATGCCTGGCCAGTGGTGG - Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1129099703 15:73248751-73248773 CCACAATGCCCGGCAAAAGAAGG + Intronic
1129111042 15:73337316-73337338 CCTCCATGCTTAGCACAAGCAGG + Intronic
1129245661 15:74277344-74277366 CCACTATGCCTGGGCAGAGCAGG + Intronic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129695609 15:77739156-77739178 CCAGGATGCCTGCCAACAGCTGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131167889 15:90155788-90155810 CCACCGCGCCTGGCCAGAGCTGG + Intergenic
1131178913 15:90227332-90227354 CCACCATGCCTGGCCACTGAGGG + Intronic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131538315 15:93255489-93255511 CCACGATGCCTGGCCGAAGTAGG + Intergenic
1131670922 15:94618830-94618852 CCACCATGCTGGGCCGAAGCTGG + Intergenic
1131988165 15:98065899-98065921 ACACCATGCCTTCCCAAAGCAGG + Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132323102 15:100941833-100941855 CCAGGCTGCCTGGCACAAGCTGG + Intronic
1132489285 16:216845-216867 CCACCACGCCTGGCTAACTCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132596593 16:753851-753873 CCACCGTGCCCGGCTAAAGGTGG - Intronic
1132737438 16:1393900-1393922 CCACCAGGCCTGGCCCACGCCGG + Intronic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1132855219 16:2041893-2041915 CCACCACGCCTGGCCACACCCGG + Intronic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133730277 16:8572721-8572743 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134239564 16:12495433-12495455 CCACCATGCCTGGCGTCATCTGG + Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134536425 16:15030255-15030277 CCACCATGCCCGGCCAATTCAGG - Intronic
1134590701 16:15450756-15450778 CCACCACGCCCGGCCATAGCTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135645313 16:24156560-24156582 TCACCATGCCCGGCCAAAGTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135780536 16:25296050-25296072 CCACCATGTCTGGCCATAGTCGG + Intergenic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136011461 16:27366170-27366192 CCATCATGCCTGGCGCAAGGAGG - Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136379718 16:29887597-29887619 CCACCATGCCCGGCCAAGGTGGG + Intronic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136496372 16:30647542-30647564 CCACCCTGCCCTGCAGAAGCAGG + Intergenic
1136570733 16:31094961-31094983 CCATCATGCCTGGCAGCCGCTGG - Intronic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139398800 16:66663351-66663373 CCACCATGCCTGGCTAATCTTGG - Intronic
1139414762 16:66799513-66799535 CCACCGTGCCTGGCCTAAGAGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139448031 16:67010351-67010373 CCACCATGCCTGGCCACTGTGGG + Intergenic
1139488161 16:67271043-67271065 CCACCGAGCCTGGCCAAGGCTGG + Exonic
1139659527 16:68411332-68411354 CCACACTGCCTGGCCAGAGCTGG + Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139849037 16:69939761-69939783 CCACCATGCCTGCCTGCAGCAGG - Intronic
1139859644 16:70010531-70010553 CCACCATGCCCGGCCAATTCAGG + Intergenic
1140485192 16:75288029-75288051 CCACCAGGCCTGTCTGAAGCAGG + Intergenic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1140960383 16:79906433-79906455 CCACCATGCCTGGCCACATGTGG - Intergenic
1141510377 16:84507979-84508001 CCACCATGCCCGGCCTAAGAGGG + Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141664064 16:85456837-85456859 CCACCGTCCCTGGCAATGGCGGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141859222 16:86705101-86705123 CCACCGCGCCTGGCCACAGCAGG - Intergenic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1142874976 17:2846561-2846583 CCACCATGCCTGGCCAACTTTGG + Intronic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1143222398 17:5273545-5273567 CCACCACGCCCAGCCAAAGCTGG - Intergenic
1143233092 17:5374309-5374331 CCACCATGCCCAGCCAAAGATGG + Intronic
1143346920 17:6256581-6256603 CCACCGTGCCCGGCCAAAGTTGG - Intergenic
1143533354 17:7519505-7519527 CCACCATGCCTGGCCAACTTAGG + Intergenic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1144144285 17:12382250-12382272 CCACCACGCCTGGCTAAACTGGG - Intergenic
1144456564 17:15423560-15423582 CCACCACGCCCGGTCAAAGCAGG - Intergenic
1144536745 17:16097371-16097393 CCACCATGCCCAGCAAGGGCTGG + Intronic
1144547043 17:16206671-16206693 TCACCATGCCTGGCAAATTATGG + Intronic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145193314 17:20866838-20866860 CAACCCCTCCTGGCAAAAGCTGG + Intronic
1145872859 17:28290036-28290058 CCACCATGCCTGGCCACAGATGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145954282 17:28843733-28843755 TCACCATGCCTGGTAAAATTTGG + Intronic
1146100802 17:29979819-29979841 GCACAATGCCTGGCATGAGCTGG + Intronic
1146184960 17:30718767-30718789 GCACAGTGCCTGGCACAAGCAGG - Intergenic
1146268719 17:31470532-31470554 CCCACAGGCCTGGCAGAAGCAGG + Intronic
1146314963 17:31799655-31799677 CCACCATGCCTGGCTTGTGCAGG - Intergenic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147013254 17:37469192-37469214 CCACCACGCCCGGCAATAGTTGG + Intronic
1147047601 17:37766140-37766162 CCACCATGCCCGGCCAATGTTGG - Intergenic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147784546 17:42969837-42969859 CCACCACGCCTGGCCCAAGAAGG - Intronic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1147983369 17:44289015-44289037 CCACCATGCCCGGCTAAATTTGG + Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148340643 17:46871566-46871588 CCACAGTGCCTGGGACAAGCAGG - Intronic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148849065 17:50545746-50545768 CCACCGTGCCTGGCCAGAGAAGG - Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150526401 17:65927183-65927205 GCACCTTACATGGCAAAAGCAGG - Intronic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150750890 17:67861601-67861623 CCACCATGCCCAGCCATAGCTGG + Intronic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1151323977 17:73367789-73367811 CCACCATGCCTGGCCCCTGCCGG + Intronic
1151405990 17:73886683-73886705 CCATCATGCATGACAAGAGCTGG - Intergenic
1151483081 17:74381703-74381725 CCACCGTGCCTGGACGAAGCTGG - Intergenic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1151716219 17:75832469-75832491 CCAGCATGCCAGGCAACAGGCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151903181 17:77031022-77031044 CCACCATGCCTGGCTTCAGAAGG - Intergenic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1151941131 17:77292644-77292666 CCACCATGCCTGGCCAATTTTGG + Intronic
1152112150 17:78362838-78362860 GCCCTGTGCCTGGCAAAAGCAGG - Intergenic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152746915 17:82044749-82044771 CCACCACGCCCGGCCAAACCCGG + Intergenic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1152962804 18:89730-89752 CCACCATGCCCGGCTAATGGAGG - Intergenic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153832815 18:8938241-8938263 CCACCATGCCTGGCCACAGGTGG - Intergenic
1153888065 18:9485222-9485244 CCACCATGCCTGGCAACTGTGGG + Intronic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1155202204 18:23527094-23527116 CCACCATGCCTGGCCTCAGTAGG - Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1155474567 18:26225403-26225425 GCACTATGCCTAGCAAAAACGGG - Intergenic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155973430 18:32102916-32102938 CCACCATGCCTGGCCAATTTGGG + Intronic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1156703193 18:39848971-39848993 CCTCCATGCCTGGCCAAACAGGG - Intergenic
1157064482 18:44331642-44331664 CCAGCATGGCTGGAAAAAACAGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157251765 18:46101737-46101759 CCACCATGCCCAGCTAAAGATGG - Intronic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157954933 18:52086206-52086228 CAACCATGCATTGCAAAAGTAGG - Intergenic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158361018 18:56673544-56673566 CCACCATGCCTGGCCCAGGAGGG - Intronic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1158588753 18:58762563-58762585 CCACCATGGCTGCCCATAGCAGG + Intergenic
1158596450 18:58820747-58820769 CCACCATGCCTGACAAATTTTGG + Intergenic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1160175394 18:76590065-76590087 CCACCATTGCTCGGAAAAGCAGG + Intergenic
1160205313 18:76826644-76826666 CCACCATGCCTGGCTAACTTTGG - Intronic
1160445919 18:78926609-78926631 CCACCGTGCCTGGCAATTTCCGG - Intergenic
1160713850 19:566060-566082 CCACCACGCCCGGCAACAGGAGG + Intergenic
1160743371 19:698187-698209 CCACCATGTCTGGCCCAAGTTGG + Intergenic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160893166 19:1390185-1390207 CCACCACGCCCGGCTAATGCAGG + Intronic
1160997576 19:1890588-1890610 CCACCATGCCTGGCAATTGTTGG + Intergenic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161192107 19:2963514-2963536 CCACCGTGCCTGGCCAGAGTGGG - Intergenic
1161244534 19:3242060-3242082 CCACCATGCCCGGCCCAAGGTGG + Intronic
1161538826 19:4837142-4837164 CCACCACGCCCGGCTAAGGCTGG - Intergenic
1161566012 19:5003202-5003224 CCACCATGCCCGGCCCAAGCAGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161675739 19:5647557-5647579 CCACCATGCCAAGTAAGAGCAGG + Intronic
1161676567 19:5653748-5653770 CCACCATGCCTGGCCGGGGCAGG + Intronic
1162025318 19:7890500-7890522 CCACCGTGCCCGGCTGAAGCAGG - Intronic
1162057660 19:8074341-8074363 CCACCATGACAGACAAAAGGAGG + Intronic
1162076540 19:8191620-8191642 CCACCATGCCTGGCCATTCCTGG - Intronic
1162117564 19:8440410-8440432 CCACCAGGCCTGGCCCATGCTGG - Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162285215 19:9733565-9733587 CCACCACGCCTGGCTAGAGATGG - Intergenic
1162317224 19:9946903-9946925 CCACCGCGCCTGGCCAGAGCTGG - Intergenic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162521783 19:11185130-11185152 CCACCATGCCCGGCAAGCCCAGG - Intronic
1162597142 19:11638416-11638438 CCATCATGCCTGGCTAATGTTGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1162997191 19:14343613-14343635 CCACCATGCCTGGCCTCAGATGG - Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163043967 19:14625265-14625287 CCACCATGCCCAGCTAATGCTGG + Intronic
1163166285 19:15500275-15500297 CCACCGTGCCTGGCCTAGGCTGG - Intergenic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163423940 19:17230636-17230658 CCACCACGCCTGGCTACAGAAGG + Intergenic
1163432694 19:17277724-17277746 CCACCACGCCTGGCTAGAGGGGG - Intronic
1164115869 19:22217989-22218011 CCACCATGCCCGGCCAATGATGG + Intergenic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164632386 19:29770073-29770095 CCACCATGCCCGGCCTAAGAAGG + Intergenic
1164682514 19:30145128-30145150 CCACCCTGGCTGGCAAGAGCAGG + Intergenic
1164795656 19:31025528-31025550 CCACCGTGCCTGGCCACAGATGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165047346 19:33115780-33115802 CCACCGCGCCTGGCTAAAGTGGG + Intronic
1165103611 19:33455806-33455828 TTACCATGCCTGGCAATATCAGG + Intronic
1165178441 19:33947263-33947285 CCCTCATGCCTGGTACAAGCTGG + Intergenic
1166372278 19:42308834-42308856 CCACCATGCCTGGCCTCATCTGG + Exonic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166643284 19:44512653-44512675 CCAACAGTCCCGGCAAAAGCAGG - Intronic
1166682231 19:44776256-44776278 CCACCATGCCTGGTCAGACCAGG - Intergenic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167354998 19:48998257-48998279 CCACCAGGCCTTGCACATGCTGG - Intronic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1168235096 19:55057934-55057956 CCAGCATGCCTGGCTAACTCTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168528196 19:57105619-57105641 CCACCATGCCAGGCTAATGTTGG + Intergenic
1168612372 19:57811563-57811585 CCACCATGCCCGGCTAATGAAGG - Intronic
1168614321 19:57825573-57825595 CCACCGTGCCCGGCAATGGCTGG + Intronic
925043725 2:754802-754824 CCTGCATGCCAGGCTAAAGCAGG + Intergenic
926024288 2:9527033-9527055 CCAACATGCCCGGCCAAAGACGG - Intronic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
926274219 2:11391304-11391326 CCACCACGCCTGGCCCAAGATGG + Intergenic
926624317 2:15077967-15077989 CCACCACGCCTGGCCCAAGAAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928230756 2:29496981-29497003 CCACCATGCCTGGCCTCATCAGG - Intronic
928262014 2:29776642-29776664 CCACCATGCCCAGCAAAATCAGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928757155 2:34541184-34541206 CCACCCTGCCTGACAAACCCCGG + Intergenic
928865972 2:35918257-35918279 CCAACATGGCTGGAAAAAGCAGG - Intergenic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929104976 2:38355982-38356004 CCACCATGCCTGGCCACATTTGG + Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
929470882 2:42191770-42191792 CCACCACGCCCGGCAAAACTAGG - Intronic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
929825905 2:45309610-45309632 CCACCATTCCTGGCCAGGGCTGG + Intergenic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930028918 2:47046502-47046524 CCACCATGCCTGCCAAGATGGGG + Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930687777 2:54327416-54327438 CCACCATGCCCGGCATACCCAGG + Intergenic
931232819 2:60388822-60388844 CCACCATGCCCGGCAAATTTTGG - Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932898200 2:75665439-75665461 CCACCATGCCCGGCCAAATCTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
933811356 2:86034708-86034730 CCACCAGGGCTGGCACATGCTGG - Intronic
934299253 2:91767372-91767394 CAACTATGCCTGGTACAAGCTGG + Intergenic
934624798 2:95836856-95836878 CCAGCATCCTTGGCACAAGCTGG + Intergenic
934660645 2:96141840-96141862 CCACCATGCCTGGCCCAGGATGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
934775162 2:96932648-96932670 CCACCATGCCCGGCCCATGCTGG - Intronic
934808777 2:97264558-97264580 CCAGCATCCTTGGCACAAGCTGG - Intergenic
934828728 2:97492604-97492626 CCAGCATCCTTGGCACAAGCTGG + Intergenic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935408071 2:102730335-102730357 CCACCATGCCTGGCCACCTCTGG + Intronic
935456101 2:103269212-103269234 GCATAATGCCTGGCAAAGGCAGG + Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936247745 2:110843305-110843327 CCACCATGCCTGGCCAATGTAGG + Intronic
936350831 2:111711342-111711364 CAACTATGTCTGGAAAAAGCTGG - Intergenic
936474848 2:112831193-112831215 CCCCCATCCCTAGGAAAAGCTGG - Intronic
936540388 2:113345144-113345166 CCACCATGCCTGGCCTAATTAGG + Intergenic
936824603 2:116566032-116566054 CCACCATGCCTTGCCAAAGAAGG + Intergenic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937228047 2:120381056-120381078 TCACCAGTCCTGGGAAAAGCGGG + Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
937843816 2:126555222-126555244 CCACCATCCCTTGCATTAGCTGG - Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938501683 2:131833957-131833979 CCGCCAAGCGTGGCAAAGGCAGG + Intergenic
938898577 2:135777597-135777619 CCACCATGCCTGGCCTGAGGTGG - Intronic
939177065 2:138760961-138760983 CAAACATCCCTGGCAAGAGCAGG + Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939251058 2:139682119-139682141 CCACCATGCCTGGCCACATAGGG - Intergenic
939392301 2:141584090-141584112 CCACCATGCCTGGCTAACGTTGG - Intronic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
940842330 2:158598478-158598500 CCACCACGCCCGGCAATAACAGG - Intronic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
944099731 2:196010433-196010455 CCACCATCCCTGACAAAAAGAGG + Intronic
944151431 2:196562754-196562776 CCACCAACCCTGGCCAAAGCTGG - Intronic
944785816 2:203069015-203069037 CCACCATGCCTGGCCACTGGTGG + Intronic
944799625 2:203226871-203226893 CCACCATGCCTGGCCAATGAAGG + Intergenic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
946095888 2:217273785-217273807 GCACAATGCCTGGCACAAGTGGG + Intergenic
946234434 2:218314521-218314543 CCACCATGCCTGGCTATACTTGG + Intronic
946265122 2:218534199-218534221 CCACCATGCCCGGCCTAATCTGG - Intronic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947808826 2:232987303-232987325 ACACCGTGCCTGGCCAGAGCAGG + Intronic
947842849 2:233219545-233219567 CCACTATGCCTGGCCCAAGATGG - Intronic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948032756 2:234832997-234833019 CCACCACGCCTGGCAATAAAGGG - Intergenic
948733811 2:239985029-239985051 CCTCCATGCCTGCCAGAAGACGG + Intronic
949012903 2:241691770-241691792 CCACCATGCCTGGCCAGGGATGG - Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169330772 20:4714384-4714406 CCACCATGCCTGGCCCCTGCTGG - Intergenic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1169861096 20:10153450-10153472 CCACCATGCCTGGCCTGAGGCGG - Intergenic
1170676427 20:18485630-18485652 CCACCATCCCTGGCAAACCCAGG - Intergenic
1170687600 20:18583547-18583569 CCACCATGCCCTGCTAAGGCAGG - Intronic
1170739034 20:19037285-19037307 CCACTATGCCTGGCCAGAGTTGG - Intergenic
1171371878 20:24667678-24667700 CCATCACGCCTGGCAGGAGCAGG + Intergenic
1171432236 20:25090369-25090391 CCCCCATGGCAGACAAAAGCAGG + Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171942900 20:31348648-31348670 CCACCATGGCTGGAATATGCTGG - Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172492843 20:35354680-35354702 CCACCATGCCCAGCCAAAGGAGG + Intronic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1173871647 20:46345765-46345787 CCACCATGCCTGGCTTCTGCAGG - Intergenic
1173978336 20:47204168-47204190 CCACCATGCCTGGCCAATGTGGG + Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174237332 20:49104696-49104718 TCACCATGCCTGGCCTAAGATGG - Intergenic
1174256285 20:49257997-49258019 CCACCGTGCCTGGCCAGAGATGG + Intronic
1174272210 20:49377877-49377899 CAACCCTGCCTGGGGAAAGCAGG - Intronic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1174830109 20:53804622-53804644 CCACCATGCCTGGCCTTATCAGG + Intergenic
1175249240 20:57598805-57598827 CCACCAGGACTGGAAAAATCTGG + Intergenic
1175253184 20:57622054-57622076 CCCCCTTGGCTGCCAAAAGCTGG - Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177429566 21:20974344-20974366 CCACCATGACTGAGAAAAGGGGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178699411 21:34820360-34820382 CCACCATGCCTGGCTGGAGGAGG - Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179430346 21:41316985-41317007 CCGCCACGCTTAGCAAAAGCGGG + Intronic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180221414 21:46360803-46360825 CCACCACGCCTGGCCATAGTTGG + Intronic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1180678975 22:17609976-17609998 CCACCATGCCTGGCCTCAGAGGG - Intronic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1180872982 22:19157746-19157768 CCAGCATGCCTGGCTTCAGCTGG + Intergenic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1181579826 22:23821988-23822010 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1181617955 22:24067831-24067853 GCACCATGCCTGGCACTAGCAGG + Intronic
1181802964 22:25359138-25359160 CCACCATGCCTGGCCAGGCCAGG - Intronic
1182350395 22:29695987-29696009 CCTCCATGCCAGGCAACAGAGGG + Exonic
1182608879 22:31529881-31529903 CCACCATACCCGGCCAAAGGTGG - Intronic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183621056 22:38972978-38973000 CCACCGTGGCTGGCCAAAGGTGG - Intronic
1183859367 22:40658320-40658342 CCACCGCGCCCGGCCAAAGCTGG + Intergenic
1183891691 22:40935086-40935108 CCACCATGCCCGGCCAAGCCCGG - Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184216553 22:43071202-43071224 CCACCGTGCTTGGCAACGGCAGG + Intronic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184285238 22:43466892-43466914 CCACCATGCCTGGCCAGACAGGG - Intronic
1184334150 22:43843596-43843618 CCACCATGCCTAGCCAATGAGGG + Intronic
1184361146 22:44019505-44019527 CCACCGTGCCCGGCTGAAGCTGG + Intronic
1184437072 22:44485610-44485632 CCATCGTGCCTGGCCAGAGCTGG + Intergenic
1184563982 22:45280340-45280362 CCACCGTGCCTGGCCTCAGCAGG - Intergenic
1184578870 22:45398540-45398562 CCACCATGCCCGGCCGATGCAGG - Intronic
1184647291 22:45903264-45903286 CCTCCATGCCTTCCAAAGGCTGG - Intergenic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1185155371 22:49190562-49190584 CCACCATGCCCGGCCAAACTGGG + Intergenic
1185355734 22:50368808-50368830 CCACCACACCTGGCTAATGCTGG + Intronic
949976609 3:9466735-9466757 CCACCATGCCCAGCCTAAGCTGG - Intronic
950524573 3:13516498-13516520 CCACCAGGGATGGCAGAAGCAGG - Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951215590 3:20021895-20021917 CCACCATGCCTGGCCTCAGTTGG - Intergenic
951528996 3:23681429-23681451 CCAGCTTGGCTGGAAAAAGCTGG + Intergenic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952481886 3:33770109-33770131 CCACCATGCCCGGCCACATCTGG + Intergenic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
954007716 3:47605482-47605504 CCACCATGCCCGGCCACATCTGG - Intronic
954087320 3:48255774-48255796 CCACCATGCCTGGCCAGAGACGG + Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954473696 3:50723058-50723080 CCACCATGCCTGGCCTCAGATGG + Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954977437 3:54709635-54709657 CCACCATGCCTGGCAAGTGATGG - Intronic
955940478 3:64142596-64142618 CCACCACGCCTGGCCCATGCAGG + Intronic
956130295 3:66046902-66046924 CCAGCATACCTGGCCACAGCTGG + Intergenic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956636254 3:71368412-71368434 CCACCATGCCTGGCCTTAGTTGG + Intronic
956756939 3:72398044-72398066 CCACCATGCCCGGCCATAGGAGG - Intronic
956845449 3:73178226-73178248 CCACCATTCTTGGCAAGAGTAGG + Intergenic
957137506 3:76308089-76308111 CCACCATGCCCAGCCAAAGTAGG - Intronic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958006887 3:87823672-87823694 CCACCATGCCCGGCCAAGGCTGG + Intergenic
958104400 3:89053830-89053852 CCACCATGCCTGGAAAAGTGGGG + Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959732310 3:109618601-109618623 CCACCACGCCTGGCATCAGTAGG - Intergenic
960110666 3:113841577-113841599 CCACCGTGCCTGGCTGAAGTAGG + Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961016307 3:123470896-123470918 CCACCATGCCTGGCTAATCTTGG + Intergenic
961204386 3:125069241-125069263 CCACCATGCTTGGTAAAACAAGG + Intergenic
961540531 3:127596364-127596386 CCACCATGCCTGGCCATCCCAGG + Intronic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
961982907 3:131100307-131100329 CCATCATGCCTGGCCCAAGTAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962370942 3:134820256-134820278 CCTCCATGTCTGGGAAAAGCAGG + Intronic
962932765 3:140052939-140052961 CCCCCATGCAGGGCAGAAGCAGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964218031 3:154310493-154310515 CCACCATGCCCGGCCTAAGTGGG - Intronic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965869786 3:173252128-173252150 GCACATTACCTGGCAAAAGCAGG + Intergenic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966669055 3:182506451-182506473 CCACCATGCCTAGCCTAAGTAGG + Intergenic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967356695 3:188579815-188579837 CCATCATGCCTGGCTAATCCTGG - Intronic
967931332 3:194692662-194692684 CCACCATGCCTGGCAAGGCTGGG + Intergenic
968126216 3:196162447-196162469 CCAACATGCCTGGCTAATTCTGG - Intergenic
968179390 3:196580495-196580517 CCACCATGCCTGGCGAGACGGGG + Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
968773815 4:2526707-2526729 CCACCACGCCTGGCGAAATGTGG - Intronic
968907787 4:3462670-3462692 CCCCCATCCCAGGCAAGAGCAGG - Intergenic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
969682793 4:8652507-8652529 ACACCAAGGCTGGCAGAAGCTGG - Intergenic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972563733 4:40251048-40251070 CCACCACGCCCGGCCGAAGCTGG - Intergenic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
973946448 4:55961475-55961497 CCACCGTGCCCGGCCAAAGATGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
973999091 4:56492837-56492859 CCACTATGCCAGGCTAAAGAAGG - Intronic
974861659 4:67529476-67529498 CCACCACGCCTGGCAAATTTTGG + Intronic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976945937 4:90767938-90767960 CCACCATGCCTGACCAAACAAGG + Intronic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978529164 4:109697071-109697093 CCACCATGCCCGGCCAACTCAGG + Intronic
978600287 4:110420064-110420086 CCACTATGCCTGGCAAACTTTGG + Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
978964399 4:114724168-114724190 CCACCACGCCTGGCCGGAGCAGG + Intergenic
979059710 4:116042661-116042683 CCACCATGCCCAGCCAAAGCTGG + Intergenic
979292227 4:118990895-118990917 CCACCATGCCCGGCCTAAGCTGG + Intronic
980001102 4:127488991-127489013 CCAAAATGCCTGGAAAAATCAGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980997765 4:139797043-139797065 TCAACATGCCTGGCCAGAGCAGG + Intronic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
982227635 4:153180900-153180922 GGACAATGCCTGGCACAAGCAGG - Intronic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982465114 4:155720974-155720996 TCACCTTGCCTAGCCAAAGCAGG - Intronic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982860986 4:160448753-160448775 CCACCAAGCATGGCAAAAGCAGG + Intergenic
983214901 4:164993598-164993620 CCACCATGCCCGGCCAGAGATGG + Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
984786277 4:183570285-183570307 CCACCATGCAGGTCACAAGCAGG + Intergenic
984890344 4:184486473-184486495 CCACCACGCCTGGCCGAGGCAGG - Intergenic
985510713 5:311970-311992 CCACCATGCCTGGCCAACTATGG + Intronic
986000261 5:3625482-3625504 CCAGCATGCCTGTTAATAGCAGG + Intergenic
986002658 5:3642451-3642473 TCACCAGGCCTGGCACAGGCGGG - Intergenic
986044139 5:4021527-4021549 ACACCATGCCAGGCAAAACGTGG - Intergenic
986219661 5:5756497-5756519 CCTCCATGCCTGGCCAAACACGG + Intergenic
986370341 5:7073972-7073994 CCACCATGCCCGGCCAGGGCTGG - Intergenic
986379471 5:7169135-7169157 CCACTATACAGGGCAAAAGCAGG - Intergenic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
986893944 5:12342450-12342472 CCACCATGCCTGGAATAATTAGG + Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988402893 5:30784726-30784748 CCACCATGCCTGGCCCACGGAGG - Intergenic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988572070 5:32377465-32377487 CCACCGTGCCCGGCAAAATGTGG + Intronic
988596044 5:32591983-32592005 CCACCATGCCTTGCCAAAGTTGG + Intronic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
988806078 5:34741969-34741991 GCACGATGCCTGGCAAAAGTAGG + Intronic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989632793 5:43504023-43504045 CCACCATGCCTAGCGAATCCAGG - Intronic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990303599 5:54473360-54473382 CCACCACGCCTGGCCACACCTGG + Intergenic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
990716698 5:58645547-58645569 ACACGATGCCTGGCAAAGGGTGG - Intronic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992315349 5:75546952-75546974 CCACCACGCCTGGCCACAGATGG + Intronic
992418097 5:76572348-76572370 CCACCACGCCTGGCTAATGTTGG + Intronic
992418288 5:76574454-76574476 CCACCACGCCTGGCTAATGTTGG + Intronic
992657442 5:78924165-78924187 GCACCAGGCCTGGCATAAGCAGG - Intronic
993678276 5:90844518-90844540 TCACTATGCCTGGGAAAATCAGG - Intronic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
994688200 5:102983156-102983178 CCACCATGCCTGGCCTTACCGGG - Intronic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995517034 5:112964476-112964498 CCACCATGGCTGGCCAAGGCTGG - Intergenic
995972052 5:117984359-117984381 CCACCATGCCTGGCCATATATGG + Intergenic
996743910 5:126828845-126828867 CCACCATGCCCGGCCAAGGTTGG + Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997315899 5:132935481-132935503 CCACCATGTCTGGCCACACCCGG - Intronic
997487536 5:134244029-134244051 CCACCATGCCTGGCTCCACCAGG + Intergenic
997613545 5:135231387-135231409 CCACCCTGCCTGGCCTACGCTGG - Intronic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
999218903 5:149958957-149958979 CCACCATGCCCGGCCAAATTTGG + Intergenic
1000638754 5:163675873-163675895 CCACCATGCCTGGCCCCAGATGG - Intergenic
1000819165 5:165961802-165961824 CCACCATGCAAGTCAAAAGATGG + Intergenic
1001872623 5:175170011-175170033 CCACCACGCCCGGCCAAAGAAGG + Intergenic
1001935685 5:175702075-175702097 CCCCCATGCCGTGCATAAGCTGG - Intergenic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002351073 5:178584160-178584182 TCACCATGCCTGGCTAAATTTGG + Intronic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1002922427 6:1581947-1581969 CCACCGTGCCTGGCCAACGTGGG - Intergenic
1002981398 6:2142222-2142244 CAACAATACCTGGCAAAAGCGGG + Intronic
1003190741 6:3872148-3872170 GCACCAAACATGGCAAAAGCAGG + Intergenic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1003944511 6:11061836-11061858 CCACCATGCCCAGCCAAAGAAGG - Intergenic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004277752 6:14253471-14253493 TCACCATGCCTGGCAAGGTCAGG - Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004392396 6:15220719-15220741 CCACCATGCCTGGCGAAGCTGGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004701059 6:18079894-18079916 CCACCATGCCTGGCCTAAGGAGG + Intergenic
1004727707 6:18326973-18326995 CCACCGCGCCAGGCCAAAGCGGG + Intergenic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1005934127 6:30506999-30507021 CCACCGTGCCCGGCCAAGGCAGG + Intergenic
1006142538 6:31938938-31938960 CCACCATGCCCGGCCACACCTGG + Intronic
1006257228 6:32841488-32841510 CCACCATGCCTGGGAGGAGTCGG - Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006300081 6:33189311-33189333 CACCCATACCTGGGAAAAGCTGG + Exonic
1006463367 6:34176861-34176883 ACATCATGCCTGGCAAGGGCAGG + Intergenic
1006567997 6:34975848-34975870 TCACCATGCCTGGTCAAAGGAGG - Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006681961 6:35803725-35803747 CCACCATGCCTGGCTATGCCTGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007337396 6:41163338-41163360 CCACCCTGGCTGGCACCAGCAGG - Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007511799 6:42379835-42379857 ACAACATGCCTGGCACAGGCTGG - Intronic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1007587386 6:42999846-42999868 CCACCATGCCTGGCCATTGGTGG + Intronic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1008901994 6:56630933-56630955 CCACCATGCCTGGCTAACTTTGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010039944 6:71369394-71369416 CCACCACGCCCGGCCAAAGGTGG + Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690385 6:89861695-89861717 CCACCACATCTGGCCAAAGCTGG + Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011695190 6:89906158-89906180 CCACCGTGCCCGGCCAAAGTTGG + Intergenic
1011720914 6:90155855-90155877 GAACAATGCCTGGCACAAGCAGG + Intronic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1013012040 6:106129627-106129649 CCACCAATTCTGGCAAGAGCTGG + Intergenic
1013100985 6:106986638-106986660 CCACCATGCCTGGCCACACTTGG - Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013388122 6:109653212-109653234 ACAACACGCCTGGCAAAAGTAGG + Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1013779578 6:113715165-113715187 CCACCACGCCTGGCTTAACCAGG - Intergenic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016324859 6:142889183-142889205 CCACCATGCATGGCCACATCAGG - Intronic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017193051 6:151673593-151673615 CCACCATGCCTGGCTTAATTTGG - Intronic
1017262430 6:152402593-152402615 CTCCCATGCCTGCCAAATGCAGG + Intronic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1017999599 6:159567409-159567431 CCACCATGCCTGGCTGTACCAGG + Intergenic
1018193062 6:161327833-161327855 CCACCATGCCTGGCTAACTTTGG + Intergenic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019082484 6:169444507-169444529 CCACCAGGGCTGGCCAGAGCCGG + Intergenic
1019393058 7:800532-800554 CCACCATGCCCGGCAAGGCCAGG + Intergenic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1019969324 7:4527504-4527526 CCACCGTGCCTGTCAAGTGCAGG - Intergenic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020072966 7:5239612-5239634 CCACCATGCCCGGCCACACCTGG - Intergenic
1020185410 7:5955459-5955481 CCACCACGCCTGGCCAACCCTGG - Intronic
1020266954 7:6567180-6567202 CCACCATGCCTGGCCATGCCTGG - Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1020297504 7:6769290-6769312 CCACCACGCCTGGCCAACCCTGG + Intronic
1020809352 7:12832722-12832744 CCACCTTGCATGGCACAAGAGGG - Intergenic
1021054995 7:16036130-16036152 CCACCGTGCCTGCCCAAGGCAGG - Intergenic
1021063226 7:16140298-16140320 CCACCATGCCAGGCAATGCCAGG + Intronic
1021674815 7:23069459-23069481 CCACCGCGCCTGGCCATAGCTGG - Intergenic
1021941198 7:25680424-25680446 CCACCACGCCTGGCCACACCTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022252204 7:28619547-28619569 CCACCATGCCTAGCTCAAGAAGG - Intronic
1023011056 7:35925101-35925123 CCACTGTGCCTGGCCAGAGCTGG - Intergenic
1023060715 7:36323313-36323335 CCACCATGCCTGGCCTCAGAGGG - Intergenic
1023781002 7:43655361-43655383 CCAACATGCCCGGCAATATCTGG - Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1024334432 7:48191693-48191715 CCACCGTGCCCGGCCAAAGAGGG + Intronic
1024608478 7:51042647-51042669 CCACCATGCCAGGCCAAACGTGG + Intronic
1024954372 7:54900861-54900883 CCAGCAAGCCTAGCAAAAGATGG - Intergenic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026781135 7:73268262-73268284 CCACCATGCCTGGCTAACTTTGG + Intergenic
1026944636 7:74307776-74307798 CCACCGTGCCCGGCAACAGTAGG + Intronic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027021988 7:74821704-74821726 CCACCATGCCTGGCTAACTTTGG + Intronic
1027066033 7:75124213-75124235 CCACCATGCCTGGCTAACTTTGG - Intronic
1027112262 7:75449652-75449674 CTACCATGCCCGGCAACAGTAGG + Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027284495 7:76634194-76634216 CTACCATGCCCGGCAACAGTAGG + Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027686130 7:81280496-81280518 CCAGCATGGCTGGAAAAAGGAGG + Intergenic
1029203945 7:98857410-98857432 CCATCGTGCCTGGCAAAACGTGG - Intronic
1029292889 7:99516128-99516150 CCACCACGCCTGGCCACATCTGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029383069 7:100225893-100225915 CCACCGCGCCTGGCCAAGGCAGG + Intronic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029631385 7:101752980-101753002 CCACCATGCCTGGCCCAGGGTGG + Intergenic
1029808620 7:103022987-103023009 CCACCGTGCCTGGCTAATGGTGG - Intronic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032561373 7:132897004-132897026 CTACCATCACTGGTAAAAGCAGG + Intronic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1032786053 7:135200524-135200546 GCACCACGCCTCGCATAAGCTGG + Intronic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034624799 7:152484405-152484427 CCACCATGCCCGGCCTAAGAAGG + Intergenic
1034865942 7:154642303-154642325 CCACCATGCCAGGCCAAAGTGGG - Intronic
1034884127 7:154784664-154784686 CCACCATGCCCGTCACAATCAGG + Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035422053 7:158737977-158737999 CCACCATGACTGGCCTAATCAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036399484 8:8395511-8395533 CCACCATGCCTGGCCATGTCTGG - Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1036721894 8:11183516-11183538 CCACCATGCTGGGCTCAAGCTGG + Intronic
1037327638 8:17709719-17709741 CCACCACGCCTGGCAAATTAAGG - Intronic
1037680997 8:21097287-21097309 CCACCATGCTGGGCAACACCTGG - Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1037836088 8:22215589-22215611 TCACAGTGCCTGGCAAAAGGGGG + Intergenic
1037902927 8:22698292-22698314 CCACAAGGCCTGGCCAAGGCAGG - Intergenic
1038508230 8:28105092-28105114 CCACCATGTCTGGCCAAGCCTGG - Intronic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039339104 8:36627224-36627246 CCACCATGCCTGGAAACAGCTGG + Intergenic
1039758876 8:40552542-40552564 ACACAATGCCTGGCACAAGTAGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039911637 8:41831358-41831380 CCACCATGCCCGGCAAACATGGG - Intronic
1039925439 8:41927497-41927519 CCACCATGCCTGGCCATGTCTGG - Intergenic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040349819 8:46553383-46553405 CCACCATGCCTGGCTCCAGTTGG - Intergenic
1040367947 8:46738865-46738887 CCACCATGCCTGGCCTCAGTTGG + Intergenic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040464708 8:47683837-47683859 CCACCATGCCCGGCCAAATTGGG - Intronic
1040732746 8:50469689-50469711 CCACCATGCCTGCAATAAGGAGG - Intronic
1040767359 8:50928983-50929005 CCACCGCGCCTGGCCAAGGCTGG + Intergenic
1042125423 8:65533489-65533511 CCACCATGGCCTGCAAAAGGAGG + Intergenic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042381355 8:68118066-68118088 CCACCACGCCCGGCCAAAGATGG - Intronic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044659642 8:94582484-94582506 CCACCACGCCTGGCCACACCTGG + Intergenic
1045023593 8:98064815-98064837 CCACCCCGCCTGGCAGGAGCCGG + Intronic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045230756 8:100304247-100304269 TCACCATGCCTGACAAAAGTTGG + Intronic
1045270976 8:100661291-100661313 CCACTGCGCCCGGCAAAAGCAGG + Intronic
1045500580 8:102741537-102741559 CCACCATGCCCAGCTAAAGGAGG - Intergenic
1045517810 8:102876178-102876200 CCACCACACCTGGCAAAATTAGG + Intronic
1045520793 8:102901259-102901281 CCACCATGCCTGGCCATGTCTGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045939778 8:107726348-107726370 CCACCGTGCCCGGCAAGAGTTGG - Intergenic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1046621554 8:116533909-116533931 CCACCATGCCCGGCTAATGTAGG + Intergenic
1047424681 8:124734438-124734460 CCACCATGCCCGGCCACACCTGG - Intergenic
1048292591 8:133191995-133192017 TCACCATGCCTGGCCCTAGCAGG - Intronic
1048854272 8:138673360-138673382 CCACCATGCCTGGCTAACTTTGG + Intronic
1048854296 8:138673494-138673516 CCACCATGCCCGGCCCCAGCCGG + Intronic
1049523185 8:143105434-143105456 CCACCATGCCTGGCCAGGCCAGG + Intergenic
1049685157 8:143936419-143936441 CCCCCAGGCCTGGAAAAGGCTGG + Intronic
1049689371 8:143952007-143952029 CCACCAAGCCCGGCAAACCCGGG + Intronic
1049949289 9:628789-628811 CCACCATGCCCGGCCCAAGATGG - Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050452420 9:5797360-5797382 CCACCACGCCCGGCCAAAGCTGG - Intronic
1050557907 9:6806205-6806227 CCACCATGCCTGGCCAATTTGGG - Intronic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051400431 9:16675777-16675799 CCACCGAGCCCGGCCAAAGCTGG - Intronic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051617339 9:19018820-19018842 CCACCATGCCCGGCATAAGAAGG - Intronic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1051669416 9:19494913-19494935 CCACCATGCCCGGCCAATGTGGG + Intergenic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052805584 9:33010430-33010452 CCACCACGCCTGGCGAACGCAGG - Intronic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053290903 9:36879142-36879164 TCACCAAGCCTGGCAGCAGCTGG - Intronic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053624153 9:39851734-39851756 CCACCACGCCTGGCCATTGCAGG + Intergenic
1053880713 9:42591494-42591516 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054219744 9:62398964-62398986 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054230971 9:62510209-62510231 CCACCACGCCTGGCCATTGCAGG + Intergenic
1054745962 9:68853966-68853988 CCAGCTTGCCTGGCACAAGCCGG - Intronic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1055892753 9:81141056-81141078 CCACCATGCCTGGCCATGCCTGG - Intergenic
1056011020 9:82330534-82330556 ACAGCATGCTTGGCAAAAGAAGG + Intergenic
1056532115 9:87497491-87497513 GCACCGTGCCCGGCACAAGCTGG + Intronic
1056557364 9:87700786-87700808 CCACCATGCCTGGCCAATTTTGG + Intronic
1056568177 9:87793244-87793266 TCCTCATGACTGGCAAAAGCAGG - Intergenic
1056632062 9:88302127-88302149 CCACCATGCCTGGCCACTGTGGG - Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057945931 9:99328219-99328241 CCACCATGCCCAGCAAATGTTGG + Intergenic
1058255662 9:102759651-102759673 CCACCATGCCTGGCCCAATGTGG - Intergenic
1058389399 9:104477898-104477920 CCACCATACCTGGCATAGGTAGG - Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1059059734 9:111022761-111022783 CCACCGCGCCCGGCAATAGCAGG - Intronic
1059536256 9:115083890-115083912 CCACCATGCCCGGCCAAATGAGG + Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060526763 9:124325303-124325325 CCACCATGCCGGGCCTAAGAGGG - Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060732135 9:126045486-126045508 CCACCGTGCCTGGCCACAGATGG - Intergenic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1060846080 9:126838704-126838726 ACCCGAGGCCTGGCAAAAGCAGG - Intergenic
1061154604 9:128850171-128850193 CCACCATGCCTGGCCAGCCCAGG + Intronic
1061331809 9:129899363-129899385 CCACCATGCCCGGCCAGATCTGG + Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061407678 9:130401608-130401630 CCACCATGCCTGGCCTAACATGG + Intronic
1061571556 9:131480881-131480903 CCACCACTCCTGGCCAAAGTTGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061990619 9:134156817-134156839 CCAGCATGCCTGGCAGAACAGGG - Intronic
1062072343 9:134563388-134563410 CCACCATGCCTGGCTACACTGGG + Intergenic
1062420010 9:136476111-136476133 GCACCATGCCTGGGCACAGCTGG + Exonic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1062735335 9:138134388-138134410 CCACCATGCCCGGCTAATGGAGG + Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1187294939 X:17989860-17989882 CCACCATGCCTGGCTTATGGTGG + Intergenic
1187503888 X:19863348-19863370 CCACCACGCCCAGCTAAAGCAGG + Intronic
1187521128 X:20015002-20015024 CCACCATGCCTCGCTACAGATGG + Intronic
1188223937 X:27574119-27574141 CCACCATGCCTGGCTTCAGTGGG + Intergenic
1188249145 X:27870510-27870532 CCACCATGCCCGGCAACATAGGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188968073 X:36579503-36579525 CAACCATGCCTGTCAAAATACGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189895469 X:45651224-45651246 CCACCACGCCTGGCCCAAGTAGG - Intergenic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1189986273 X:46556254-46556276 CCACCATGCCTGGCCTGAGATGG - Intergenic
1190131712 X:47754116-47754138 TCCCCCTGCCTGGAAAAAGCAGG - Intergenic
1190168323 X:48091730-48091752 CCACCATGCCTGGCCCAAGATGG - Intergenic
1190168920 X:48095955-48095977 CCACCATGCCTGGCCCAAGATGG + Intergenic
1190169402 X:48099981-48100003 CCACCATGCCCAGCCAATGCTGG + Intergenic
1190176131 X:48151431-48151453 CCACCATGCCTGTCTAATGTTGG - Intergenic
1190312733 X:49128534-49128556 CCACCATGCCCAGCCAAGGCAGG - Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1190866492 X:54389219-54389241 CCACCATGCCTGGCTAGGGGTGG - Intergenic
1191247568 X:58240018-58240040 CCACCATGCCCGGCAAACTCAGG + Intergenic
1191744236 X:64468207-64468229 CCACCATGCTTGGCCAAGGATGG - Intergenic
1192235163 X:69290935-69290957 CCACCTTGCCTGGAAAATTCTGG - Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192431577 X:71115994-71116016 CCACCATGCCTGGCCCACTCTGG + Intergenic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1193387187 X:80885651-80885673 CCACCATGCCTGGCAATCTGAGG + Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1195067751 X:101252900-101252922 TCACCAGGCCTGGCCACAGCTGG + Intronic
1195850458 X:109276934-109276956 CCAGCATGGCTAGAAAAAGCAGG + Intergenic
1196076590 X:111584856-111584878 CCACCGTGCCGGGCAAATGAAGG - Intergenic
1196344649 X:114639464-114639486 CCTCCATGCTTGGAAAATGCAGG + Intronic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197193064 X:123670329-123670351 CCACCATGCCCAGCCAAGGCAGG - Intronic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197296370 X:124723884-124723906 CAACCATGCCCGGCCGAAGCTGG + Intronic
1197385406 X:125795575-125795597 CCAGCATGGCTAGAAAAAGCAGG + Intergenic
1197762477 X:130037603-130037625 CCACCATGCCTGCCAGCGGCAGG - Intronic
1197834238 X:130677797-130677819 CCATCATGCCTGGCAAAACTGGG - Intronic
1197974808 X:132155467-132155489 CCACCATGCCTGGCCAATTTAGG + Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198402966 X:136285363-136285385 CCACCACGCCTGGCCAAGGATGG - Intergenic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198532403 X:137559573-137559595 CCACCATGCCTGGCCCACCCTGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1199965060 X:152812836-152812858 TCACCACGCCTGGCTAAAGAAGG - Intergenic
1200284921 X:154811388-154811410 CCACCGTGCCTGACTAAAGATGG - Intronic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic