ID: 972632780

View in Genome Browser
Species Human (GRCh38)
Location 4:40856792-40856814
Sequence GCCTCACTCCTTCTTCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 293}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972632778_972632780 -9 Left 972632778 4:40856778-40856800 CCCATTTCATACAAGCCTCACTC 0: 1
1: 0
2: 1
3: 13
4: 145
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632779_972632780 -10 Left 972632779 4:40856779-40856801 CCATTTCATACAAGCCTCACTCC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632772_972632780 7 Left 972632772 4:40856762-40856784 CCAAGGACGCCTCCCCCCCATTT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632773_972632780 -2 Left 972632773 4:40856771-40856793 CCTCCCCCCCATTTCATACAAGC 0: 1
1: 0
2: 1
3: 6
4: 153
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632775_972632780 -6 Left 972632775 4:40856775-40856797 CCCCCCATTTCATACAAGCCTCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632774_972632780 -5 Left 972632774 4:40856774-40856796 CCCCCCCATTTCATACAAGCCTC 0: 1
1: 0
2: 2
3: 18
4: 226
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632776_972632780 -7 Left 972632776 4:40856776-40856798 CCCCCATTTCATACAAGCCTCAC 0: 1
1: 0
2: 0
3: 16
4: 169
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293
972632777_972632780 -8 Left 972632777 4:40856777-40856799 CCCCATTTCATACAAGCCTCACT 0: 1
1: 0
2: 2
3: 10
4: 176
Right 972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG 0: 1
1: 0
2: 2
3: 41
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972632780 Original CRISPR GCCTCACTCCTTCTTCCCAC CGG Intronic
900218773 1:1495963-1495985 GCCCCACTCCTTCTGCCCCAGGG - Exonic
900645474 1:3706866-3706888 GCCTCACCCCTGCTGCCCCCTGG - Intronic
900922114 1:5679518-5679540 ACCTCACTCTTGCTTCCCCCAGG + Intergenic
902258471 1:15206331-15206353 CCCTCCTTCCTTCTTCCCAGAGG - Intronic
902375330 1:16027637-16027659 GCCTCATCCCTTCTACCCTCAGG - Intronic
902380293 1:16049434-16049456 GCCTCATCCCTTCTACCCTCAGG - Intronic
903661816 1:24983106-24983128 GGCTCACCCCTTCTTTCCTCTGG - Intergenic
904617560 1:31758144-31758166 GCCTCCCTCCTGCATGCCACAGG + Intronic
905100714 1:35519727-35519749 TGCTCTCTCTTTCTTCCCACAGG + Intronic
905878980 1:41451226-41451248 GCCTCACTCCACATTTCCACTGG + Intergenic
907484485 1:54767757-54767779 TCCTCACAGCTTCTTACCACAGG - Intergenic
907966012 1:59330602-59330624 ACCTCCCTACTTCTACCCACTGG + Intronic
909487397 1:76189115-76189137 GTCTTACTCCTTCTTCCCATAGG + Intronic
909706067 1:78586182-78586204 GCCGCCCTCCCTCTACCCACCGG + Intergenic
911046019 1:93629006-93629028 GCCTCCCTCCTTCTTTCGAATGG - Intronic
911231347 1:95364783-95364805 GCCCCACTCCTCCTGCCCTCTGG - Intergenic
913075161 1:115336065-115336087 GCCTCATTCCTTGCTCCCACTGG + Intronic
913477435 1:119251906-119251928 TCCTTACTAGTTCTTCCCACAGG + Intergenic
914358883 1:146913044-146913066 CCCTCCCTCCTTCTTTCCAAAGG + Intergenic
915431416 1:155869730-155869752 TTCTCTCTCCCTCTTCCCACTGG + Intronic
915902338 1:159855804-159855826 ACCTCACTCCTGCCTGCCACCGG - Intronic
915962665 1:160280042-160280064 GCCTCTTGCCTTCTGCCCACTGG - Intronic
915983403 1:160438270-160438292 CCCTCCCTCCTTCTGCCCAGAGG + Intergenic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
917160288 1:172049770-172049792 TTCTCTCTCTTTCTTCCCACTGG - Intronic
918399446 1:184148654-184148676 GCCTTTCTCCTTCTACACACGGG + Intergenic
921099825 1:211919242-211919264 GCCTCATTTCTTCTTCCTTCTGG - Intergenic
921151905 1:212409448-212409470 GCCTCATTCCCTCTCACCACAGG - Intronic
921159505 1:212463149-212463171 GCCTCACTAGCTCTTGCCACTGG + Intergenic
921407752 1:214799578-214799600 GCAGCACTGGTTCTTCCCACTGG - Intergenic
1064244473 10:13657735-13657757 GCTTCAGTCCCACTTCCCACTGG - Intronic
1064296659 10:14084870-14084892 TCCTCACTCCTTCTGCCTCCTGG + Intronic
1065894859 10:30154376-30154398 GCTTCACTCCACCTTCCCTCAGG - Intergenic
1067706120 10:48607554-48607576 TCCCCACTCCATCCTCCCACAGG - Intronic
1068391053 10:56397298-56397320 CCCTCCTTCCTTCATCCCACTGG - Intergenic
1068743592 10:60502683-60502705 CCCTCCCTCCTTCTTCCTACAGG - Intronic
1070457457 10:76631514-76631536 GCCTCCCTCCTTCACCCCACAGG + Intergenic
1071062695 10:81591459-81591481 GCTGCACTCCTGCTTCCCACAGG - Intergenic
1072801690 10:98396769-98396791 GCCTCTCTACTTCTTCCCTAGGG + Intronic
1072823305 10:98580134-98580156 GCCTTACTCCTTTTTCTCTCTGG + Intronic
1074122847 10:110505941-110505963 GCCTCTGACCTTCTTCACACGGG - Intronic
1076249831 10:128977180-128977202 GGCTCTCTCCTTCTCCCCACAGG - Intergenic
1076570822 10:131431916-131431938 TCCGCACTCCTTCTTGCCTCTGG - Intergenic
1076655784 10:132022494-132022516 GCCTCACTGCTGCTGCCCATGGG - Intergenic
1077305612 11:1867498-1867520 GGCTCACTCCTTTATCCAACAGG - Intronic
1077391846 11:2303936-2303958 ACCTCCCTCCTCCTTCCCTCAGG + Intronic
1079097315 11:17519177-17519199 GCCTCACTCCCTGTTCCCCGGGG - Intronic
1079994237 11:27278836-27278858 GCCTCGCTCTTTTTTCCCTCAGG + Intergenic
1080270073 11:30441774-30441796 GCCTCAGCACTTGTTCCCACTGG - Intronic
1080458430 11:32434919-32434941 GCCTCACTCCTTCATCAAACAGG - Exonic
1081630845 11:44688566-44688588 CCCTCTCTCCTTCTTCCCTCTGG - Intergenic
1081631861 11:44694762-44694784 CCCTCAGTCCTTGTCCCCACTGG + Intergenic
1081936752 11:46909688-46909710 GCCTCTCTCCTTTTATCCACTGG + Intronic
1084116172 11:67044364-67044386 GCCCCACTCCTCCCTTCCACCGG - Intronic
1084918266 11:72447908-72447930 GCCACTCTGCTTCTTCCAACTGG + Intergenic
1085047555 11:73362411-73362433 TCCTCACTCCGTCTTCTCGCAGG + Exonic
1086928501 11:92667107-92667129 GCATCACTCCTTCATCTTACAGG - Intronic
1087620503 11:100536140-100536162 CCATCACTCCTTGTGCCCACAGG + Intergenic
1089055992 11:115585341-115585363 CCCTCACTCCTTTTTCTCACTGG - Intergenic
1090923107 11:131224681-131224703 GCTTCTGTCCATCTTCCCACTGG - Intergenic
1094201772 12:27802275-27802297 GCTTCACTCCTCCTTTTCACTGG - Exonic
1094396011 12:30006522-30006544 GCATCTCTCCGTCTTCCCCCTGG + Intergenic
1095691906 12:45099262-45099284 GCCTAACTTCTACTGCCCACTGG + Intergenic
1095958234 12:47818809-47818831 TCCTCACTCCTTCTCCCCGCTGG - Intronic
1096259828 12:50083505-50083527 GCCTCATTCCTGCTTCCCTCTGG - Exonic
1096519267 12:52174925-52174947 GCCTTGCTCCTCCTTCCCACAGG - Intronic
1096667432 12:53175320-53175342 CCCTAACTCCCTCTTCCCTCAGG - Intronic
1097022144 12:56027960-56027982 GCCTCATTCCCTCCTCCCACTGG - Intronic
1098358068 12:69629727-69629749 GCCTCACTGCTCCTTCCATCTGG + Intergenic
1099612917 12:84897759-84897781 ACCCCACTCCTTCATCCCATAGG - Intronic
1100743861 12:97624170-97624192 GCCACACTCACTCTCCCCACAGG + Intergenic
1101412321 12:104479881-104479903 ACCTCTCTCCCTCTTCCCACTGG - Intronic
1103202516 12:119099778-119099800 GCCTCAGTTCTTCTTCACATAGG + Intronic
1103221780 12:119252392-119252414 TCCTCACTCCCTCTTGCCATAGG - Intergenic
1103293903 12:119869950-119869972 GTCTGACTCCATCTTCCAACTGG + Intronic
1103946748 12:124531476-124531498 TCCTCCCTCCTTCTCCCCACAGG - Intronic
1104230172 12:126877014-126877036 GCCTCACTCCTGCTTTAGACTGG + Intergenic
1106603536 13:31207811-31207833 TCCTCACTACTTCTCTCCACTGG + Intronic
1106778468 13:33031751-33031773 CCCTCACTCCTGCTCCCCACTGG - Intronic
1106917045 13:34526934-34526956 CCCTCACTACTCCTTCCCACAGG - Intergenic
1107290248 13:38844149-38844171 GTCTCCCTCCTTCTTTCTACAGG + Intronic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1108701598 13:52948676-52948698 ACCTCACTGAGTCTTCCCACTGG - Intergenic
1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG + Intergenic
1110753113 13:79138696-79138718 ACCTTACTCCTTCTCCCCAGAGG - Intergenic
1111694637 13:91607845-91607867 ACCTCACTACTTCTTCCACCTGG - Intronic
1112422056 13:99261227-99261249 GCCTCACACCCTCTTCTCCCTGG - Intronic
1112509529 13:99997489-99997511 TTCGCACTCCTTCCTCCCACCGG + Intergenic
1115727860 14:36236836-36236858 CCCTCACTCCCCCTCCCCACAGG - Intergenic
1116458396 14:45144569-45144591 TTCTCACTCTTTCTTTCCACAGG + Intronic
1118316920 14:64731223-64731245 GCCACAGTCCCTCTTCCCAGCGG - Intronic
1118820690 14:69343723-69343745 GCCTCCCCCACTCTTCCCACAGG - Intronic
1118852149 14:69592197-69592219 CCCTCACTCCCTCTTCCAGCAGG - Intergenic
1120025088 14:79574577-79574599 GCCTCAGTTCTTCTACCCATGGG + Intronic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1122255612 14:100473530-100473552 GGAGCACTCCTTCTTCCCAGAGG - Intronic
1122277756 14:100603943-100603965 CTCTCACTCCTGCCTCCCACAGG + Intergenic
1122303829 14:100748787-100748809 TCCTCAGACCTTCTTCTCACTGG - Intergenic
1122778426 14:104133353-104133375 GCCTCCTTCCCTCTTCCCCCAGG - Intergenic
1122818031 14:104323645-104323667 GCCTCACCCCTCCTGCCCATGGG + Intergenic
1122918493 14:104869716-104869738 GGCTCACCCCTTCTGCCCAGTGG + Intronic
1123107539 14:105849713-105849735 TCCTCACTCCATCCTCCCCCAGG + Intergenic
1123882846 15:24691454-24691476 CCCTGTCTCCTTCTTACCACTGG + Intergenic
1124024757 15:25955071-25955093 GCTTCCCTGCTTCTTCACACAGG - Intergenic
1124658183 15:31525147-31525169 GCCTCTCTCCCTCCTGCCACAGG - Intronic
1128640317 15:69331195-69331217 GCCTCCTTCCTTCTCGCCACTGG + Intronic
1128641611 15:69342597-69342619 GCCTCCCTCCATCGTCCCCCAGG + Intronic
1128921713 15:71616614-71616636 CCCTTACTACTTCTACCCACTGG - Intronic
1129230032 15:74192017-74192039 GGCTCACCCCATCTTCCCATGGG - Intronic
1129364920 15:75048363-75048385 GCCTCTCTCCACCTCCCCACAGG - Intronic
1129924368 15:79349752-79349774 GCCGCACTCATCCTTCCCTCAGG + Intronic
1132690764 16:1180908-1180930 GGCTCACCCCGTCTTCCCGCAGG + Intronic
1133559011 16:6932582-6932604 GCCTCACTTCCTCATCCCACGGG + Intronic
1133690956 16:8214315-8214337 GCGTCACTCTTTCATCCCAAAGG - Intergenic
1133853201 16:9525298-9525320 GGCTCACTCCTTCCTCCCTCAGG + Intergenic
1135668422 16:24354811-24354833 GCCTCTCTCCTTCTCTCCGCAGG + Exonic
1136044143 16:27602186-27602208 GCCTCAATCCTTCTACCTGCAGG + Intronic
1136564948 16:31064232-31064254 GCCTGACACCTTCTCCCCACTGG + Exonic
1138207693 16:55136863-55136885 ACTTCACTCCCTCCTCCCACAGG - Intergenic
1138535830 16:57659841-57659863 GGCTCACTGCTTCTTCCTAAAGG - Intronic
1139701671 16:68711576-68711598 GCCTCTGTTCTGCTTCCCACTGG + Intronic
1141090671 16:81128328-81128350 TCCTCAATCCTCCATCCCACTGG + Intergenic
1141151885 16:81570099-81570121 GCCTCACCCCTTCTGCAGACGGG + Intronic
1141812457 16:86384680-86384702 GTCTCATTCCATCTTCCCAGCGG + Intergenic
1147364115 17:39949287-39949309 TCCTTGTTCCTTCTTCCCACTGG + Intergenic
1147610797 17:41800934-41800956 ACCTCACTCCTTCCTCCCATAGG - Intergenic
1147799025 17:43069100-43069122 GCCTCACTCCATACTGCCACAGG + Intronic
1148192416 17:45688888-45688910 GCCTCACTTTTCCTTCCCTCAGG + Intergenic
1148243094 17:46012789-46012811 GCCTCCTTCCCTCTTCCCTCTGG - Intronic
1149961853 17:61118379-61118401 GCACCACTCCTTCTCTCCACTGG - Intronic
1150617734 17:66785110-66785132 GCCTCTCTCTGTCCTCCCACTGG + Intronic
1150904639 17:69325070-69325092 GGCTCAAGCCTTCCTCCCACTGG - Intronic
1151366761 17:73622671-73622693 GCCTCACCCCCTCCTCCCATGGG + Intronic
1151508090 17:74542385-74542407 GCCTCACTCCTCCCTCCACCTGG + Intronic
1151950213 17:77349123-77349145 GTCTCACTCTGTCTCCCCACAGG + Intronic
1153242845 18:3046359-3046381 GCCTCACACATTCTTCAGACTGG - Intergenic
1153409984 18:4782597-4782619 GCCTCACCCCTTCATCCCTGAGG + Intergenic
1155016103 18:21841339-21841361 GTCTCACTCCCTCTTCACCCAGG - Intronic
1155608805 18:27639080-27639102 GCCTCAGTCCTTCTTCACTGTGG - Intergenic
1158883212 18:61800941-61800963 GCCTCACCCCATCTTGGCACTGG - Intergenic
1159057630 18:63481886-63481908 ACCTTACTCCTTCTCCCCTCAGG - Intronic
1160342848 18:78104296-78104318 GCCTCGGGCCTCCTTCCCACTGG + Intergenic
1161413674 19:4132235-4132257 GCCTCAAGCCATCCTCCCACCGG + Intergenic
1161643691 19:5439472-5439494 CCCTCCCTCCCTCTTCCAACAGG + Intergenic
1162145078 19:8608588-8608610 ACCTCACCCCTTTCTCCCACTGG + Intronic
1162876410 19:13624014-13624036 GCCACCCTTCTTCTTTCCACTGG - Intergenic
1162947700 19:14053853-14053875 GCTTCACTCCTTCCTCCTCCAGG + Exonic
1163148301 19:15397099-15397121 GCCTCACTCAATCTACCCACAGG + Intronic
1163547885 19:17950262-17950284 TCCTCACCCCCTGTTCCCACAGG - Intergenic
1165661383 19:37583475-37583497 GTCTCAAGCCTTCTTTCCACAGG + Intronic
1166043898 19:40218294-40218316 GCCTCCCGCCCTCTCCCCACCGG - Exonic
1166321521 19:42022056-42022078 GTCTCACTCCCTCTCCCCACAGG - Exonic
1166345216 19:42161495-42161517 TCCTCACTCCTCCTTCCTACAGG - Intronic
1166566541 19:43769032-43769054 GACTCCCCACTTCTTCCCACAGG - Exonic
1166650425 19:44570252-44570274 GCCTCCCTGCTGCTTCCCAAGGG + Intergenic
1166831831 19:45643851-45643873 GGCTCACTCCTTCTGACCTCAGG - Intronic
925067690 2:941258-941280 ACATCAATCCTGCTTCCCACCGG + Intergenic
926353888 2:12022211-12022233 GCCTGATTCCTGCTGCCCACAGG + Intergenic
926819909 2:16840639-16840661 GCGTGAATCCTTCTTCCCCCAGG + Intergenic
927881304 2:26692005-26692027 GCCACACTCCTTCCTCCCTTGGG - Intergenic
931838946 2:66128677-66128699 GCCACAGTCATTCTTCCCAGTGG - Intergenic
934681491 2:96286999-96287021 GCCTCACCTTTTCATCCCACTGG + Exonic
935469428 2:103439342-103439364 CCCTTCCTCCTTCTTCCCCCAGG + Intergenic
937215834 2:120313045-120313067 GCCTCTCTCCATCTCCCAACCGG - Intergenic
937299107 2:120827871-120827893 TCCTCACTCCTTCCTCCCTCCGG - Intronic
941716592 2:168769959-168769981 TCCTCACTCCTTTTACTCACTGG + Exonic
942080858 2:172398425-172398447 CTCTCCCTCCTTCTTCCCCCAGG + Intergenic
943190434 2:184671364-184671386 CTCTCTCTACTTCTTCCCACTGG - Intronic
943758552 2:191584507-191584529 GCCTCTTTCCTTCTCCCAACTGG + Intergenic
944096351 2:195973103-195973125 CCCTTGCTCCTTCTTGCCACTGG - Intronic
944873546 2:203938369-203938391 ACCTCATTCCTTCCTGCCACAGG - Intronic
946885662 2:224220009-224220031 GACTCATTCATTCATCCCACAGG + Intergenic
947370968 2:229445218-229445240 GCCACACTGCCTCCTCCCACAGG + Intronic
947712587 2:232324549-232324571 ACCTCACCCCTTCCTCACACAGG - Intronic
947831777 2:233146508-233146530 GCCCCAATCCCTCTTTCCACAGG - Intronic
948551420 2:238775437-238775459 GCCTCACAACTTATTCCGACTGG - Intergenic
1169021222 20:2332533-2332555 GCCTCCCTCCTTCCTCCCTTGGG - Intronic
1170165328 20:13356051-13356073 ATCTCACTCTTTATTCCCACTGG + Intergenic
1173477019 20:43367029-43367051 GCCCCACTCCTTCCTCCCTCTGG - Intergenic
1173949400 20:46978485-46978507 TCCACACTCCCTCTTGCCACAGG - Intronic
1174851111 20:53996151-53996173 GCCATACTTCTTCTGCCCACAGG + Intronic
1175175568 20:57109801-57109823 GCCTCTCTCCTTCTTGATACGGG - Intergenic
1175275035 20:57762578-57762600 GCCTGACTCCTTCCTCCCTCTGG + Intergenic
1175364144 20:58439716-58439738 GGCTCCTTCCTTCTCCCCACAGG - Intronic
1175587925 20:60160349-60160371 CCCTCACACATTCTTCCCAAGGG + Intergenic
1175674977 20:60938482-60938504 GACTCAATCCTCCTTCCCAGTGG - Intergenic
1175724867 20:61310825-61310847 TCCTAGCTCCCTCTTCCCACAGG + Intronic
1176073249 20:63237509-63237531 GCCTCCCTTCTTCTTCTCACTGG + Intronic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1178237713 21:30862122-30862144 GCTTAACTTCATCTTCCCACAGG - Intergenic
1178388790 21:32181495-32181517 GCCTCATTTCTCCTTCTCACTGG - Intergenic
1179105985 21:38400920-38400942 CCCTCAATCCCACTTCCCACTGG + Intronic
1179191915 21:39130292-39130314 GCCCCAGTCATTCTACCCACTGG + Intergenic
1179407414 21:41137156-41137178 GCCTCATTCTTTCTGCACACTGG + Intergenic
1179472337 21:41620074-41620096 CCCTCTCTCCTCCTTCCCTCTGG - Intergenic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1182287845 22:29258791-29258813 GCCTCTCTCCTTCTTCCCTCCGG + Intronic
1182357836 22:29730232-29730254 GCCTCAGTTCTTCCTTCCACAGG + Exonic
1183051317 22:35264013-35264035 ACCTCTCTCCTCCTTCACACTGG - Intronic
1183358150 22:37370310-37370332 GGCGTGCTCCTTCTTCCCACGGG + Exonic
1183795118 22:40111087-40111109 TCCTGACTCCCTCTTCTCACAGG - Intronic
1184681314 22:46073738-46073760 GCCTCATGCCTCCCTCCCACTGG + Intronic
1184760436 22:46540818-46540840 GCCTAACTCCTTGTTCTAACTGG + Intergenic
1184825644 22:46949002-46949024 GCTCCACTCCTGCTTCCCACAGG - Intronic
1184935393 22:47716852-47716874 GCCTTCCTCCTTCTGCACACGGG - Intergenic
1184957780 22:47903186-47903208 GCCTCACAACTTCTGCCCATAGG + Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950753850 3:15155777-15155799 GCCTCCCTCCCTCCTCCCACTGG - Intergenic
951178601 3:19631933-19631955 GCCACACTTCTTCCTGCCACTGG - Intergenic
952262015 3:31749188-31749210 GAATTACTGCTTCTTCCCACTGG - Intronic
953815608 3:46153847-46153869 GGGACACTCCTTCTTCCCAGAGG + Intergenic
953931283 3:47007116-47007138 GCCCCACTCCTTCATCACCCAGG + Exonic
954078854 3:48200814-48200836 CCCTCACTGCCTCTCCCCACAGG + Intergenic
956683068 3:71799508-71799530 TCCTCTCCCCTTCTTCCAACCGG + Intergenic
957078981 3:75621489-75621511 GCCTCATTCCTGCAGCCCACTGG - Intergenic
958785889 3:98595553-98595575 GCCTCACTCCTTTCTTCCTCTGG + Intergenic
961000518 3:123371108-123371130 AGCTCACTCCTTCTTTCCTCTGG - Intronic
961312442 3:126012113-126012135 GCCACACTCCTTCCTGCCTCTGG + Intronic
961640763 3:128363551-128363573 TCCTGACTCCCTCTTCCCAGGGG - Intronic
963838119 3:150077749-150077771 CCCTCAAACCTTCTTCCTACAGG - Intergenic
964928907 3:161991575-161991597 TCCTCCTGCCTTCTTCCCACAGG - Intergenic
965733178 3:171793808-171793830 GCCTCACTTCATCTTCACACAGG + Intronic
967946211 3:194806187-194806209 TCCTCACAGCTTCTTCCCAATGG + Intergenic
968278180 3:197456736-197456758 GCCAGACTCCTACTTCCCACCGG + Intergenic
968737736 4:2306147-2306169 GCCTCAATGCTTCTTCCTCCAGG - Intronic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
974831075 4:67190409-67190431 GCCTCATTTGTTTTTCCCACAGG - Intergenic
976141547 4:81998469-81998491 GACTCACTCATTCTGCCCATTGG - Intronic
976413066 4:84739510-84739532 GCCACACTCCTTCTTCCCTCTGG + Intronic
977361656 4:96013393-96013415 GCCTTACCCCTACTTCCCATAGG + Intergenic
977453449 4:97227147-97227169 GGCTCACTCCTTCTTCTTAAGGG - Intronic
978738619 4:112112713-112112735 GCCTCACCCCTACTTCCCATAGG - Intergenic
981648379 4:147026485-147026507 GCCTGACATTTTCTTCCCACAGG + Intergenic
981734541 4:147935190-147935212 GCCTCACCTCATCTTCCTACAGG - Intronic
983472803 4:168177132-168177154 CCCTACCTCCTTCTCCCCACTGG + Intronic
984600001 4:181715033-181715055 CCCTCAGTTCTTTTTCCCACTGG - Intergenic
984744593 4:183202069-183202091 GCCTCACTCATTCCTTCCCCAGG - Intronic
985635822 5:1035525-1035547 GCCACACCCCTGCTTCCCGCAGG + Intronic
985685219 5:1278247-1278269 GCCTTACTCCTTCCTCCTCCAGG - Intronic
986214386 5:5705341-5705363 CCCACACTCCCACTTCCCACGGG + Intergenic
986702227 5:10421755-10421777 GCCTCCCTGCTTTTTCTCACAGG - Intronic
987740359 5:21900246-21900268 GCCTCCCTCCTGCCTTCCACAGG - Intronic
987832529 5:23114706-23114728 GCCTACCTCCTCCTTCCCAGTGG - Intergenic
988959784 5:36358354-36358376 GTCTCAGCCCTTCTTTCCACTGG - Intergenic
994723693 5:103409893-103409915 TCCTCCTTCTTTCTTCCCACTGG - Intergenic
994953498 5:106497272-106497294 GCCTCACTCCTCTTTCCGCCTGG + Intergenic
995031518 5:107487220-107487242 CCCCCACTCCCTCTTCCCCCCGG + Intronic
995374771 5:111461698-111461720 TCCTCCCTCCTCCTTCCCAGAGG + Intronic
995751328 5:115456067-115456089 GCCTGACTGCTTCATCTCACAGG + Intergenic
997162348 5:131622314-131622336 GCCTGCCTCCTTCTTCCCTTTGG - Intronic
998940254 5:147274202-147274224 GCCTCAGTCCTGCTTCGCACAGG - Intronic
999259335 5:150228301-150228323 GCCCCAGTCCCTCTTCCCTCTGG - Intronic
999623054 5:153491444-153491466 CCCTCACTCCTTCTTCTCGAGGG - Intronic
1000071331 5:157743704-157743726 GCTTCGTTCCTTCTTCCCATCGG + Exonic
1001169704 5:169407483-169407505 CCCTCACTCCTTGTACTCACAGG + Intergenic
1001247926 5:170119075-170119097 GCCTCACCCCTCCTGCCCTCAGG + Intergenic
1002439301 5:179256088-179256110 GACACGGTCCTTCTTCCCACAGG + Intronic
1002924926 6:1599861-1599883 GCCTCAATTCATCTTCCCCCAGG - Intergenic
1003112411 6:3261049-3261071 GCCTCACTCATTCATTCCACAGG - Intronic
1004012237 6:11701081-11701103 AGCGCCCTCCTTCTTCCCACTGG - Intergenic
1004565472 6:16791997-16792019 GCCTCCCTCCCTCTCCCCATTGG + Intergenic
1005583228 6:27252182-27252204 GCCTCATTTCATCTTCCCATCGG - Intronic
1005654288 6:27917675-27917697 TCCTCCCTCTCTCTTCCCACTGG - Intergenic
1006598738 6:35212182-35212204 CCCTCCCTCCTTCATTCCACTGG - Intergenic
1006743777 6:36327023-36327045 TCCTCACCTCTTCTTCCCACTGG + Exonic
1006844288 6:37051731-37051753 GCCCACCTCCTTCCTCCCACAGG + Intergenic
1007597499 6:43060395-43060417 CCCTCCCTCCCTCTGCCCACAGG - Intronic
1007768892 6:44177792-44177814 GCCTCACTCCTTTCTCCCCAGGG + Intronic
1007789898 6:44302910-44302932 TGTTCACTCCTTCCTCCCACAGG - Exonic
1007967255 6:46014699-46014721 GCCTCCATCCTTCCTCCTACAGG + Intronic
1009501946 6:64425024-64425046 ATCTCACTGCTTCTTCCAACTGG - Intronic
1011748489 6:90432207-90432229 GCCCCACCCCTTCTCCCCTCAGG + Intergenic
1013432207 6:110065087-110065109 CCCACACTCCCTCTTGCCACAGG - Intergenic
1014021391 6:116594153-116594175 CCCTCACCCCTGCTCCCCACAGG + Exonic
1015208712 6:130671616-130671638 GCCCCACTTGATCTTCCCACAGG - Intergenic
1015512182 6:134048866-134048888 GCCTGACTCCCTCTTCCCTAAGG + Intronic
1016609824 6:145976278-145976300 GCCTTAGTCCATATTCCCACTGG + Intergenic
1017108031 6:150906449-150906471 GCCTCAGTCCTTCTACGAACTGG - Intronic
1017770921 6:157644114-157644136 TCCTGACTCAGTCTTCCCACTGG + Intronic
1017890128 6:158631072-158631094 GCCTGCCTGCTCCTTCCCACAGG + Intronic
1018004903 6:159612781-159612803 TCACCACTGCTTCTTCCCACAGG + Intergenic
1023313170 7:38908817-38908839 GCCTCTCTTCCTCCTCCCACAGG + Intronic
1024246011 7:47471188-47471210 CCCTCACCCCTTCTCCCCACAGG - Intronic
1025166878 7:56720244-56720266 CCCTCCCTCCTTCTTTCAACAGG - Intergenic
1025176174 7:56803544-56803566 GCCCCACTCCTGCCTCCCAGGGG - Intergenic
1025695619 7:63772878-63772900 GCCCCACTCCTGCCTCCCAGGGG + Intergenic
1026045626 7:66903915-66903937 GCCTGACTCCTGCGTCCCAATGG + Intergenic
1026468494 7:70674699-70674721 GCTTAGCTCCCTCTTCCCACAGG - Intronic
1026811266 7:73467796-73467818 GTAACACTCCTTCATCCCACTGG + Intronic
1029838891 7:103341909-103341931 GCTTCAAACCATCTTCCCACAGG + Exonic
1030313552 7:108091900-108091922 GCCTTTCTGCATCTTCCCACAGG - Intronic
1031730918 7:125299544-125299566 GCCTGGCTCCTTCTGCTCACGGG - Intergenic
1032479788 7:132237014-132237036 AGCTCTCTCCTTCTTCCCAGTGG - Intronic
1033646924 7:143312022-143312044 TCCTCACTCCATCATCCCGCTGG - Intergenic
1036622159 8:10431372-10431394 CCCTCACCCCTGCTTCTCACTGG + Intergenic
1036709114 8:11067037-11067059 GCCTCACTCATCCTGCCCTCAGG - Intronic
1038660562 8:29493137-29493159 CCCTCCCACCTCCTTCCCACTGG + Intergenic
1039443547 8:37612346-37612368 GCCTTCCTCCTTCTCCCCATGGG - Intergenic
1039828150 8:41192193-41192215 GCCTCACTCCCTCTTTCTCCCGG + Intergenic
1040831883 8:51686126-51686148 TCCTCAGTTCTTCTTCCCAATGG + Intronic
1040946716 8:52892825-52892847 GGGTCACTCCATCTTCCCGCTGG - Intergenic
1043875837 8:85484926-85484948 TTCTCTCTCCTTCTTCACACAGG + Intergenic
1044194878 8:89363290-89363312 GCTTCACTTCATCTTCCAACTGG + Intergenic
1045347061 8:101302916-101302938 TCCTCACCCCATCTTCCCAGAGG - Intergenic
1045891748 8:107166039-107166061 GGCCGAGTCCTTCTTCCCACAGG - Intergenic
1047524795 8:125623599-125623621 CCCTTTCTCCTTCTTCCTACTGG + Intergenic
1047777651 8:128086761-128086783 GCTTAACTCCTTGTTCCTACAGG + Intergenic
1048572721 8:135668817-135668839 GCCTCCCTTCTTCCTCCAACAGG + Intergenic
1051799711 9:20918878-20918900 CCCTCTCTGCTTCTTCCCACTGG + Intronic
1053484076 9:38439087-38439109 GGCTCCCTCCTTCTTCCCGTGGG - Intergenic
1055508236 9:76969849-76969871 GACACACTCCTTCTTCTCTCAGG - Intergenic
1056647737 9:88429559-88429581 GCATCTCTCCTTCTTCCATCTGG - Intronic
1056678769 9:88698913-88698935 GAATCTCTTCTTCTTCCCACAGG + Intergenic
1057996828 9:99826708-99826730 TCATCACTGCTTCTTCCAACAGG + Exonic
1058459205 9:105167250-105167272 TCTTCACTCATTCTTCCCAGGGG - Intergenic
1060044119 9:120326466-120326488 GCCACACTCCTTCCTGCCTCAGG + Intergenic
1060727467 9:126015951-126015973 GCCTCAATCCTCTTTTCCACAGG - Intergenic
1061399006 9:130358285-130358307 GCCTCACTGCTCCTGCCCCCGGG + Intronic
1061843797 9:133375798-133375820 CCCTGACTCCTTGTTCCCACAGG - Intronic
1061870301 9:133516833-133516855 CCCTCCCTCCTTCTTCCTCCCGG + Intronic
1061901300 9:133673472-133673494 GCCTCTGCCCTCCTTCCCACAGG - Intronic
1061989688 9:134152284-134152306 GCCTCACTCCGGCTGCTCACTGG + Intronic
1062107348 9:134763210-134763232 GGCTCACTGCTTCAACCCACGGG - Intronic
1062255051 9:135616853-135616875 GCCTCTCTCCTCCGTCCCCCAGG - Intergenic
1186135632 X:6517515-6517537 GCCACATTCTCTCTTCCCACAGG + Intergenic
1186457061 X:9718085-9718107 TCCTCAGCCCTTCTGCCCACAGG - Exonic
1186626866 X:11304012-11304034 GTATCACTCCTGCTTCCAACTGG - Intronic
1186815896 X:13237771-13237793 GCCTCACTCCATCTTTTCTCTGG - Intergenic
1187274426 X:17805613-17805635 TCCTCTGTCCTTCATCCCACTGG - Intronic
1192172986 X:68868236-68868258 GCCTCACTCTTCCTCCACACGGG - Intergenic
1192804214 X:74495382-74495404 GCCTCACCTCTCCCTCCCACAGG + Intronic
1196306935 X:114114160-114114182 GCCTCACTCCTTCATATCACTGG - Intergenic
1196379095 X:115069356-115069378 GCCTGACTCCTTCAAGCCACAGG + Intergenic
1200214293 X:154360587-154360609 TCCTGACCCCTTCTTCCCTCAGG - Exonic
1201592123 Y:15627111-15627133 TCATCCCTCCTTCTTCCCCCTGG - Intergenic
1201732871 Y:17224225-17224247 GCCTCCCTCTGTCTTCCCTCTGG + Intergenic