ID: 972635016

View in Genome Browser
Species Human (GRCh38)
Location 4:40876520-40876542
Sequence CTGTATATACCGTTGTCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972635016 Original CRISPR CTGTATATACCGTTGTCGCT TGG Intronic
902460469 1:16571728-16571750 CTGTAAAGACCATTGACGCTAGG + Intronic
909675895 1:78238768-78238790 TTGTATTTACGGTTGTCACTTGG - Intergenic
910190612 1:84591274-84591296 ATGTATATTCTGTTGTCTCTGGG - Intergenic
913604944 1:120456851-120456873 CTGTAAAGACCATTGACGCTAGG - Intergenic
913641811 1:120819567-120819589 CTGTAAAGACCATTGACGCTAGG - Intronic
914083594 1:144432362-144432384 CTGTAAAGACCATTGACGCTAGG + Intronic
914189616 1:145397638-145397660 CTGTAAAGACCATTGACGCTAGG + Intronic
914211467 1:145583345-145583367 CTGTAAAGACCATTGACGCTAGG + Intergenic
914276669 1:146130772-146130794 CTGTAAAGACCATTGACGCTAGG + Intronic
914537714 1:148581727-148581749 CTGTAAAGACCATTGACGCTAGG + Intronic
914628211 1:149483618-149483640 CTGTAAAGACCATTGACGCTAGG - Intergenic
916948149 1:169750312-169750334 TTGTATATACAGTGGTCTCTGGG - Intronic
917087833 1:171321314-171321336 ATATATATACAGTTGTCTCTTGG + Intronic
1067363762 10:45606089-45606111 CAGAATATACAGTTGTCTCTTGG + Intergenic
1067999370 10:51313641-51313663 CTATATATACAGTTGTCCCTTGG + Intronic
1070049139 10:72869842-72869864 TTCTATATACAGTTGTCCCTAGG - Intronic
1072839501 10:98755545-98755567 ATGTATATTCCGTTGTTGTTGGG - Intronic
1085684214 11:78606879-78606901 TTGTACATACCGTTGTGGTTAGG - Intergenic
1087246513 11:95844550-95844572 GTGTTTATACAGTTGTCCCTTGG - Intronic
1091164369 11:133459899-133459921 ATGTATATTCTGTTGTTGCTGGG - Intronic
1091206139 11:133822679-133822701 CTGCATATCCAGTTGTCCCTCGG - Intergenic
1093125234 12:15321400-15321422 CTGTACATACCGTTGACACTTGG + Intronic
1093655593 12:21690435-21690457 ATGTATATTCAGTTGTTGCTGGG - Intronic
1097723759 12:63051246-63051268 CAGTATATACCGTGGTGGTTAGG - Intergenic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1100440361 12:94611547-94611569 GTATATATACAGTTGTCCCTTGG + Intronic
1104533599 12:129596436-129596458 TTTTATATACAGTTGTCCCTTGG + Intronic
1105340608 13:19521054-19521076 CTGTATACTCTGTTGTTGCTGGG + Intronic
1106126531 13:26904278-26904300 CTGCAAATACTGTTTTCGCTGGG + Intergenic
1107137637 13:36961612-36961634 ATATATATACAGTTGTCTCTTGG - Intronic
1107168745 13:37314976-37314998 ATGTATATTCTGTTGTCGTTGGG + Intergenic
1107169090 13:37317970-37317992 ATGTATATTCTGTTGTCGTTGGG - Intergenic
1108644838 13:52417283-52417305 CTGTTTATGCCATTGTTGCTTGG - Intronic
1109705704 13:66089226-66089248 CTGAATATAGCATTGTCTCTAGG - Intergenic
1123418308 15:20109190-20109212 CTATATATACAGATGTCGTTAGG + Intergenic
1123527526 15:21115724-21115746 CTATATATACAGATGTCGTTAGG + Intergenic
1133164577 16:3937602-3937624 CTGGATATGCCCTTGTAGCTGGG - Intergenic
1153917000 18:9754801-9754823 CAGTACATACAGTTGTCCCTCGG - Intronic
1165897645 19:39152827-39152849 CTGTATATATAGTTGGCCCTGGG + Intronic
1168103292 19:54152493-54152515 GTGAACATACCGCTGTCGCTGGG + Exonic
1202676902 1_KI270711v1_random:15457-15479 CTGTAAAGACCATTGACGCTAGG + Intergenic
925428433 2:3770659-3770681 CCAAATATACCGTTGTCACTAGG + Intronic
926496109 2:13590717-13590739 GTGTATATTCTGTTGTCGTTGGG + Intergenic
932223045 2:70015570-70015592 ATGTATTTACAGTTGTCCCTTGG - Intergenic
940739962 2:157496040-157496062 GTGTATATACGCTTGTCCCTAGG - Intergenic
941952937 2:171175563-171175585 GTGTATGTACAGTTGTCCCTTGG - Intronic
942686101 2:178533607-178533629 CTGAATATACTGTTGTGGCAAGG - Exonic
943957006 2:194205371-194205393 GTGTATATTCCGTTGTTGATTGG + Intergenic
1170501590 20:16980140-16980162 TTGTATATACTGTTGTGTCTTGG - Intergenic
1181350426 22:22251927-22251949 CTATATATACAGATGTCGTTAGG + Intergenic
960857013 3:122112191-122112213 CTGTAAAAACCGTTGTTGCTAGG - Intronic
967571094 3:191029163-191029185 CTGGATATAATGTTGTAGCTTGG - Intergenic
970965251 4:21920764-21920786 CAGTAAATACAGTTGTCCCTTGG - Intronic
971909885 4:32782229-32782251 CTGTAAATACCCTTGTCTTTCGG + Intergenic
972635016 4:40876520-40876542 CTGTATATACCGTTGTCGCTTGG + Intronic
975021713 4:69499327-69499349 ATGTATATTCTGTTGTCTCTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978054539 4:104247720-104247742 CTGTATATACAGTTCTTGGTTGG + Intergenic
978422447 4:108547079-108547101 GTGTATATAACGTTGTTGGTTGG - Intergenic
979103002 4:116646376-116646398 CTGTTTATTCCGTTGTGGTTAGG - Intergenic
984210601 4:176842545-176842567 ATGTACATACAGTTGTCCCTCGG - Intergenic
988215479 5:28267054-28267076 ATGTGTATACCGCTGTTGCTGGG - Intergenic
993418570 5:87669684-87669706 CTGGATATACAGTGGTCTCTTGG + Intergenic
997785788 5:136712017-136712039 TTGTGTATACAGTTGTCCCTTGG - Intergenic
1009035437 6:58112281-58112303 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009211252 6:60865873-60865895 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009612682 6:65966267-65966289 CTGTATCTACAGTTGCCTCTGGG - Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1029024087 7:97396408-97396430 TTCTATATACAGTTGTCCCTTGG + Intergenic
1034326818 7:150243534-150243556 GTGTATATACCATTGTCCCTTGG + Intergenic
1034766387 7:153725728-153725750 GTGTATATACCATTGTCCCTTGG - Intergenic
1041789052 8:61671040-61671062 CTGTATTTCCCATTGTTGCTGGG - Intronic
1046287810 8:112117876-112117898 ATATATATACAGTTGTCCCTTGG - Intergenic
1050620584 9:7448129-7448151 TTTTATATACAGTTGTCCCTCGG + Intergenic
1050647245 9:7733337-7733359 CTATATATACAGTTGTCCCTCGG + Intergenic
1052462420 9:28783195-28783217 ATGAATATACAGTTGTCCCTTGG + Intergenic
1058125996 9:101195650-101195672 CAGTATATATGGTTGTCACTAGG - Intronic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1196679954 X:118460543-118460565 AAGTATATACAGTTGTCCCTCGG - Intergenic
1202591564 Y:26489523-26489545 CTGTATACTCTGTTGTTGCTGGG - Intergenic