ID: 972635178

View in Genome Browser
Species Human (GRCh38)
Location 4:40877863-40877885
Sequence TATCATGACCTGCCACACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972635175_972635178 23 Left 972635175 4:40877817-40877839 CCACGTGTCATGAACTATTGTCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
972635177_972635178 2 Left 972635177 4:40877838-40877860 CCAGTGGCAAAGTGACTCTTAAC 0: 1
1: 0
2: 0
3: 11
4: 84
Right 972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972635178 Original CRISPR TATCATGACCTGCCACACCC CGG Intronic
900185458 1:1331212-1331234 CATCCTCACTTGCCACACCCTGG - Intergenic
902507680 1:16948576-16948598 CACCATGACCAGCCACACGCAGG + Intronic
903751317 1:25622759-25622781 TATCATAACCAGCAATACCCTGG - Intronic
910152229 1:84163538-84163560 TTTCATGACCAGCCCTACCCTGG + Intronic
912252917 1:108029801-108029823 TATCCTGACCTGCTTCATCCTGG - Intergenic
921512859 1:216053781-216053803 AATCCTGACATGCCACACCAAGG + Intronic
924027434 1:239849900-239849922 TATCCTCACCTGGCAAACCCAGG + Intronic
1063364354 10:5480726-5480748 ACTCATGACCTGCCACCCCAGGG - Intergenic
1065227930 10:23565309-23565331 TATCATGACCTGAGGCTCCCAGG - Intergenic
1070551109 10:77491441-77491463 TATTATTACCTGGCACACCAAGG + Intronic
1072306313 10:94111000-94111022 TATCACGACCACCCACACCAGGG - Intronic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1074064812 10:110004595-110004617 CACCATGACCGGCCAGACCCTGG + Intronic
1074743206 10:116505043-116505065 TATCATCACTTGCCACTCTCAGG - Intergenic
1074835936 10:117293796-117293818 TTTCATGACCTTCTACATCCTGG - Intronic
1075591094 10:123692281-123692303 TGTCATCACCTCCCACAGCCAGG - Exonic
1078944208 11:16045555-16045577 TATTATTACCTGGTACACCCTGG - Intronic
1088687929 11:112300170-112300192 TCTCATCATCTGCCAGACCCAGG + Intergenic
1089348743 11:117809238-117809260 TCCCAGGACCTGCCCCACCCTGG - Intronic
1089626579 11:119754886-119754908 AATGATGACCAGCCACACCCTGG - Intergenic
1090540120 11:127692714-127692736 TATCATCATCACCCACACCCAGG + Intergenic
1095942759 12:47737497-47737519 TATCTTGGCCCGGCACACCCTGG + Exonic
1096467292 12:51853788-51853810 TACCATGACCTGCTCCACCAGGG + Intergenic
1096545050 12:52332554-52332576 TACCATCACCAGGCACACCCAGG + Intergenic
1103183380 12:118934803-118934825 TATGATGACTGGCCACACCTGGG + Intergenic
1107300587 13:38961794-38961816 TATTATGACCTTCCACTCCCAGG - Intergenic
1114999222 14:28401383-28401405 TCTCATGACCTGCCAGGGCCTGG + Intergenic
1116760572 14:49007894-49007916 CATAATGATCTGCCACATCCAGG - Intergenic
1117832113 14:59762033-59762055 TACCATGTCATGCCACACCACGG - Intronic
1119777066 14:77256043-77256065 TCACATGACCTGTCACACCCAGG - Intronic
1122343397 14:101043445-101043467 TCCCCTGACCTGCCACTCCCTGG + Intergenic
1122585919 14:102806619-102806641 TATCATTTCCTGCCATGCCCTGG - Intronic
1123493379 15:20800003-20800025 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1123549888 15:21369105-21369127 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1131196205 15:90357226-90357248 AGACATGAGCTGCCACACCCAGG - Intronic
1132346627 15:101112637-101112659 TGTCACGACCTGGCACAGCCTGG - Intergenic
1202958217 15_KI270727v1_random:96323-96345 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1136411972 16:30082928-30082950 TATCGTGACCAGCCCCACCTTGG + Intronic
1137581971 16:49639117-49639139 TATCATGTCCTGCCAGGTCCAGG - Intronic
1138523811 16:57590153-57590175 TGTCTTGCCCTGTCACACCCAGG + Intronic
1139878262 16:70163723-70163745 CAGCGTGGCCTGCCACACCCTGG - Intergenic
1140359301 16:74331091-74331113 CAGCGTGGCCTGCCACACCCTGG + Intergenic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1146975342 17:37106725-37106747 TATCCTGACCTGCCAGACATAGG - Intronic
1150887788 17:69107759-69107781 TGTCATAACCTGTCACTCCCTGG + Exonic
1156344718 18:36246693-36246715 TTTCACCACCTGCAACACCCTGG - Intronic
1157244209 18:46039316-46039338 TACCATGCCCTGCCACCCCCAGG + Intronic
1158575585 18:58634776-58634798 CATCATTACCTGCCACACACTGG + Intergenic
1159138931 18:64369427-64369449 TCTCATGACCTGCCAGGGCCTGG + Intergenic
1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG + Intergenic
1166215612 19:41332569-41332591 AATCATGGCATGCCACACCCTGG + Intronic
1167609742 19:50501415-50501437 AACCAGAACCTGCCACACCCTGG + Intergenic
925919259 2:8627974-8627996 AAGCAGGACCTGCCCCACCCTGG + Intergenic
927303253 2:21540198-21540220 TTTCATGGCCTGCTTCACCCCGG + Intergenic
929947351 2:46381224-46381246 GTACATGACCTGCCACTCCCAGG + Intronic
930209299 2:48617871-48617893 TGTCATGGCCTGCCTCAACCCGG + Exonic
933223864 2:79722845-79722867 AATCATGATCTGTCACAACCTGG - Intronic
945100129 2:206256116-206256138 AAGCATGAGCTACCACACCCCGG + Intergenic
945457279 2:210064666-210064688 AAGCATGTACTGCCACACCCAGG - Intronic
947540541 2:230974462-230974484 TTTCATGACCGGCCCCACCAGGG - Intergenic
948240645 2:236430096-236430118 TATTATGATCAGCCACACACTGG - Intronic
1171056352 20:21910654-21910676 TATCATGTCTTGCCCCACCTGGG + Intergenic
1172595502 20:36148528-36148550 TCTCAAGACCTTCCACAGCCTGG - Intronic
1174190126 20:48734670-48734692 TACCATGACCTGCCTCCCACAGG - Intronic
1174685697 20:52452956-52452978 TTTCTGGACCTGCCACTCCCTGG + Intergenic
1176445305 21:6816032-6816054 ACTCCTGCCCTGCCACACCCTGG - Intergenic
1176823473 21:13681065-13681087 ACTCCTGCCCTGCCACACCCTGG - Intergenic
1180883203 22:19221256-19221278 TCTCATGACCTGCCATCTCCAGG + Intronic
1181580882 22:23827454-23827476 AATCCTGACCTGCCACCACCAGG - Intronic
1182476272 22:30578312-30578334 TAGCATGACCTCCCAAACACGGG + Intronic
950140715 3:10613256-10613278 AATCAGGACCAGCCACACACAGG - Intronic
950393721 3:12717621-12717643 CACCATGCCCAGCCACACCCAGG + Intergenic
954114692 3:48459903-48459925 TATGCTTACCTGCCAAACCCTGG - Exonic
954198826 3:49012310-49012332 AAGCTTGACCTGCCACACACGGG - Exonic
960049766 3:113228468-113228490 AATCCTGACCTACCTCACCCAGG - Intronic
961636720 3:128337644-128337666 TATCTGGACCTGTCACAACCAGG + Intronic
968933600 4:3597528-3597550 TATCCTGTCCTGCCAGGCCCGGG - Intergenic
970955495 4:21805850-21805872 TATCATGCCCTGCCAAGCACAGG - Intronic
972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG + Intronic
972862693 4:43190334-43190356 TATCTTGACTTTCCAAACCCTGG - Intergenic
978914721 4:114109943-114109965 CATCATGCCCAGCCACACACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988260693 5:28882924-28882946 CATCATTGCCTGCAACACCCTGG + Intergenic
989816320 5:45742108-45742130 CACCATTACCTGCCAGACCCAGG + Intergenic
990915842 5:60905219-60905241 TAACCTGAGCTACCACACCCAGG + Intronic
992066462 5:73114397-73114419 GGAGATGACCTGCCACACCCAGG + Intergenic
999445057 5:151632629-151632651 TTTCAAGGCCTGCCACAACCTGG - Intergenic
1000135627 5:158347673-158347695 CACCATGACCGGCCACATCCAGG - Intergenic
1000349719 5:160343886-160343908 TGTCATGCCCTGCCCCACCACGG + Intronic
1001045668 5:168369696-168369718 TTTCATAGCCTGCCAGACCCTGG + Intronic
1001279951 5:170379535-170379557 TGACAGGCCCTGCCACACCCTGG - Intronic
1002759629 6:191582-191604 GATCATGACCAAACACACCCAGG - Intergenic
1004065219 6:12237642-12237664 TATGATGACCTGCTACTCCGGGG + Intergenic
1016641907 6:146359265-146359287 TATCATGAGATGCCAGACCAAGG + Intronic
1017102792 6:150863501-150863523 TTTCGTGACCTGCCACAACGTGG + Intergenic
1018529796 6:164750554-164750576 GAGCATGACCTGCCACGCCTGGG + Intergenic
1018912856 6:168113437-168113459 CATCATGACCTTCCACACAGTGG - Intergenic
1022020930 7:26398761-26398783 TATCAGGCTCTGCCACACTCGGG - Intergenic
1031661702 7:124434321-124434343 TACCATAAACTGCCTCACCCAGG + Intergenic
1031805714 7:126303965-126303987 TATTCTGACCTGCCACATCAAGG - Intergenic
1031957368 7:127956043-127956065 TATCATCACCTCCCAGAACCTGG + Intronic
1037234041 8:16695617-16695639 TATCATGAACTGTCACTTCCAGG + Intergenic
1040447335 8:47508710-47508732 TATTATTACCTGCCAGAACCTGG - Intronic
1043113465 8:76217467-76217489 TATCATGACTTGCCTTTCCCAGG + Intergenic
1046310457 8:112429534-112429556 TATGTTGTCCTGCCACACTCTGG - Intronic
1056197855 9:84245904-84245926 TATAATTAACTGTCACACCCTGG + Intergenic
1056788930 9:89612966-89612988 TATCATGCCCTTTCATACCCCGG + Intergenic
1057113837 9:92501516-92501538 TTTGATGACCTGGCACACCTGGG + Intronic
1058575517 9:106396716-106396738 AATCATGACCTGCAAAGCCCTGG - Intergenic
1203523890 Un_GL000213v1:68493-68515 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1185725212 X:2414756-2414778 TATCATAACCTAACACACCTGGG + Intronic
1188973941 X:36651152-36651174 TAGCATGACTTCCCAGACCCTGG + Intergenic
1189680399 X:43510134-43510156 AGGCATGAGCTGCCACACCCAGG - Intergenic
1190303245 X:49068154-49068176 TATCATGACTAGCCACTCCCTGG - Intronic
1190776561 X:53556995-53557017 TCTCATGAAGTGCCACACCATGG + Intronic
1192032408 X:67528328-67528350 TATCATAAGCTTCTACACCCAGG - Intergenic
1198278505 X:135119575-135119597 AATCATTACCTGACACACACAGG + Intergenic
1198292455 X:135252941-135252963 AATCATTACCTGACACACACAGG - Intronic
1201010922 Y:9547797-9547819 GATCATGGCTTGCCACACTCAGG + Intergenic