ID: 972635190

View in Genome Browser
Species Human (GRCh38)
Location 4:40877892-40877914
Sequence CAGCTCAGGGTACAGGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972635181_972635190 -6 Left 972635181 4:40877875-40877897 CCACACCCCGGGCAGAGCAGCTC 0: 1
1: 0
2: 3
3: 64
4: 426
Right 972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG 0: 1
1: 0
2: 0
3: 24
4: 249
972635180_972635190 -2 Left 972635180 4:40877871-40877893 CCTGCCACACCCCGGGCAGAGCA 0: 1
1: 0
2: 2
3: 27
4: 247
Right 972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG 0: 1
1: 0
2: 0
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972635190 Original CRISPR CAGCTCAGGGTACAGGGCAT GGG Intronic
904911509 1:33937639-33937661 CAGCTCAGTGTAGAGGGTAATGG + Intronic
906242253 1:44249211-44249233 CAGGACAGCGTACAGGGCAGTGG + Intronic
906522001 1:46472858-46472880 CCTCTCAGAGTACAGGGCCTAGG + Intergenic
907268351 1:53276199-53276221 GAGCTCAGGGTGCAGAGCAAGGG + Intronic
908948877 1:69535518-69535540 CAGCTCATGGCAAAGGGCAAAGG + Intergenic
909735265 1:78951169-78951191 CATCTCAGCTTACAGAGCATGGG + Intronic
919419514 1:197353759-197353781 TAGCCCAGGGTGCAGGGCATTGG - Intronic
920381837 1:205539260-205539282 CACCTCAGGGAACAGGAGATGGG + Intergenic
921955354 1:220977678-220977700 CAGCACAGGGGACAGGGCACAGG - Intergenic
922616541 1:226964430-226964452 GAGCTCAGGGTACAGGGAAATGG - Intronic
922741241 1:228015514-228015536 AGGCTCGGGGTGCAGGGCATGGG + Intronic
923500568 1:234560471-234560493 AATCTCAGGGGACAGGGCCTAGG - Intergenic
1063464560 10:6234306-6234328 CAGCTCAAGGGACAGGTCCTGGG + Exonic
1064130928 10:12708997-12709019 CAGTTCAGGCCCCAGGGCATGGG - Intronic
1065972668 10:30817861-30817883 CAGCTCACGGGACAGAGCTTTGG - Intergenic
1067078730 10:43202411-43202433 CAGCACAGGGCCTAGGGCATGGG + Intronic
1069751489 10:70748072-70748094 CAGCTCATGGCCCAGCGCATGGG - Intronic
1069943762 10:71972518-71972540 CAGGTCAGGGCACAGGGGAGTGG - Intronic
1070995071 10:80771246-80771268 CAGCTCTCTGTGCAGGGCATAGG + Intergenic
1072340837 10:94447031-94447053 CAGCTCAGGCTAGAGTGCAGTGG - Intronic
1073106358 10:101034596-101034618 AAGCTCAGGGGCCAGGGCAGGGG + Intronic
1074050263 10:109875186-109875208 CAGCTGAGAGTACAGGGAACCGG + Intronic
1074053031 10:109897054-109897076 TACCTCAGGGTACAGGACAAAGG + Intronic
1075133167 10:119758025-119758047 CAGCACTGAGTACAGGCCATGGG - Intronic
1077050064 11:562595-562617 CAGCTCAGCCTCCAGGGCACGGG - Exonic
1077311138 11:1889588-1889610 CAACTTTGGGGACAGGGCATGGG + Exonic
1077319788 11:1936037-1936059 CAGCTCTGGGAACACAGCATGGG - Intronic
1077374292 11:2198330-2198352 CAGCTCAGGGGACAGAGGAGGGG + Intergenic
1084114379 11:67033307-67033329 CAGATCAGGGTACTGGGAATGGG - Intronic
1084220416 11:67674377-67674399 GAGCTCAGGGTAAAGGACACTGG - Intronic
1084247661 11:67871217-67871239 CACCTCTGGGGGCAGGGCATTGG - Intergenic
1084825162 11:71724276-71724298 CACCTCTGGGGGCAGGGCATTGG + Intergenic
1087046583 11:93848515-93848537 CAGCTCGGGGGACAGGACAAAGG - Intronic
1087070382 11:94073947-94073969 CATCACAGAGTACATGGCATAGG + Intronic
1089587523 11:119519874-119519896 CAGCTCAGGGTTCAGGGCTCAGG + Intergenic
1091034106 11:132217834-132217856 GAGCACAGGGCTCAGGGCATTGG - Intronic
1091846531 12:3660307-3660329 CATCTCAGGCTCCAGGGCACAGG + Intronic
1091948198 12:4568139-4568161 CACCTCTGGGTACAGCGCAAAGG + Intronic
1092233296 12:6789884-6789906 CAGCTCAGTGTCCAGAGCAATGG + Intronic
1092417940 12:8306612-8306634 CACCTCTGGGGGCAGGGCATTGG - Intergenic
1092509879 12:9143813-9143835 CAGCTCAGTGGAGAGGACATAGG + Intergenic
1094492375 12:30969159-30969181 CAGCTCAGGCTGCAGGGCCCTGG - Intronic
1096202071 12:49691620-49691642 CAGCACAGGGCACAGGGCAGTGG + Intronic
1096502247 12:52071201-52071223 CAGCACAGGATACAGGGCAACGG - Intronic
1097248714 12:57620856-57620878 CAGCTCAGGGTCCATGCCTTGGG - Intronic
1098692249 12:73503609-73503631 CACCTCTGGGGGCAGGGCATAGG - Intergenic
1101810876 12:108106789-108106811 CAGCTCAGGGCTCAGGGTAGAGG - Intergenic
1103933003 12:124460472-124460494 CAGCACAGGGTTGAGGGCAGTGG + Intronic
1104611752 12:130234753-130234775 CAGCTCAGGGGACAGGTCTGGGG + Intergenic
1104977282 12:132557835-132557857 CTTCTCTGGGTACAGGGCACGGG - Intronic
1104996586 12:132661652-132661674 CAGCTCCTGGTACTGGTCATTGG + Exonic
1107143986 13:37037155-37037177 CAACTCAGGTTGCAGTGCATTGG - Intronic
1108321863 13:49297747-49297769 CTGCTCAGGGGCCAGGACATGGG - Intergenic
1109363284 13:61324108-61324130 CACCTCTGGGGGCAGGGCATAGG + Intergenic
1112041467 13:95552567-95552589 CCCCTCAAGGGACAGGGCATGGG + Intronic
1113355515 13:109576280-109576302 GAGCTCAGGGAAAAGAGCATAGG - Intergenic
1113561233 13:111283289-111283311 CAGCTCAGGCTCCAGGGCTTGGG - Exonic
1113581356 13:111432026-111432048 CAGCACAGGGTAGAGGGCCAAGG + Intergenic
1113654579 13:112059687-112059709 TAGCTCAGCGTGCAGGGCACTGG + Intergenic
1113758772 13:112833124-112833146 CAGCTCAGTGTGGAGGGCACAGG - Intronic
1114141513 14:19916439-19916461 CACCTGAGGGAACAGGGTATGGG + Intergenic
1117245958 14:53886938-53886960 GAGCTTAGACTACAGGGCATGGG + Intergenic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1119770394 14:77217188-77217210 CAGGGCAGGGCAAAGGGCATGGG - Intronic
1119904200 14:78286562-78286584 CAGCTGAGAGTCCAGGGCAGTGG + Intronic
1121105280 14:91275263-91275285 CAGTACAGGGCACAGGGAATGGG + Intronic
1122536017 14:102463564-102463586 TACCTCAGGGTAGAGGGCATTGG + Intronic
1122716631 14:103700221-103700243 CAGCTCAGAGCACAGGGCTAAGG - Intronic
1202848335 14_GL000225v1_random:491-513 CACCTCAGTGATCAGGGCATAGG - Intergenic
1124869273 15:33524033-33524055 CAACTGAAGGTACAGGGAATAGG + Intronic
1126087022 15:45020686-45020708 CACCTCTGGGGGCAGGGCATAGG - Intergenic
1126087437 15:45023193-45023215 CAGCCGAGGGTCCAGGGCACTGG - Exonic
1126106535 15:45150583-45150605 CAGCTCAGGGTCCAGAGCCCAGG - Intronic
1127345754 15:58096253-58096275 CAGATCAGGGGACAGGGAAGAGG - Intronic
1128308207 15:66613838-66613860 CAGCCCAGGGTTCTGGGCCTGGG + Intronic
1128648964 15:69396726-69396748 CAGCTCAGGGTATGGGGAACTGG - Intronic
1128734987 15:70048422-70048444 CAGCTGAGCGCACCGGGCATGGG - Exonic
1129707893 15:77805068-77805090 CAGCCCAGGGTGCAAGGCCTGGG - Intronic
1129824644 15:78626617-78626639 CAGATCTGGGTACAGAGCCTGGG + Intronic
1130738395 15:86572673-86572695 TGCCTCAGGGTACAGGGCACAGG + Intronic
1131287233 15:91070431-91070453 CATCTCAGAGTTCAGGTCATCGG - Intergenic
1132120315 15:99170054-99170076 CTGCTAAGTGTTCAGGGCATTGG - Intronic
1132393788 15:101457690-101457712 CAGTACAGGGTGCAGGGCAGAGG + Intronic
1132647912 16:1007553-1007575 CAGCTCAGGGAAAAGGGTGTGGG + Intergenic
1132800276 16:1748643-1748665 CAGCTCATGGTACAGGGAGTCGG - Exonic
1133211880 16:4267866-4267888 CAGGTCAGAGTACAGAGTATGGG - Intronic
1137781919 16:51104374-51104396 CATCTCAGGGTGCAGGGCAGGGG + Intergenic
1139531305 16:67543989-67544011 CTGCAAAGGGTGCAGGGCATGGG - Intronic
1140866749 16:79068769-79068791 TAGCTCAGGCTGCAGGGCAGTGG - Intronic
1140918153 16:79512330-79512352 CAGCTCAGGGTACTGGTCTCTGG + Intergenic
1141256308 16:82405520-82405542 CAACTCAGGCTCCAGGGCATTGG - Intergenic
1142564018 17:827831-827853 CAGCAGAGGGAAGAGGGCATTGG + Intronic
1143041655 17:4042633-4042655 CAGCACAGGGGACAGTGCAGTGG - Intronic
1143120477 17:4603509-4603531 CATCTCAGGGTCCAGGGAAAGGG - Intronic
1147758252 17:42782075-42782097 CAGATCAGGGGACAGAGCCTAGG + Intronic
1147948113 17:44091929-44091951 GAGCTCAGGGTAGAGGGAACTGG - Intronic
1148535743 17:48437242-48437264 AAGCTCAGTGGACAGGGCATGGG + Intergenic
1149193001 17:54086183-54086205 CACCTCTGGGGGCAGGGCATAGG + Intergenic
1151575031 17:74948891-74948913 GAGCTCAGGGTACAGGGTGGGGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152239322 17:79153256-79153278 CAGCACAGGGTGCAGGGAAATGG - Intronic
1152662728 17:81550443-81550465 CAGCGCAGAGCACAGGGCCTGGG + Exonic
1157146360 18:45166856-45166878 CAGCTCAGGGACAGGGGCATAGG - Intergenic
1157356724 18:46941958-46941980 CAGCTAGGGTTACAGGGCACAGG + Intronic
1157813800 18:50716853-50716875 CCGCTCTGTGTACAGGGCATGGG - Intronic
1158293524 18:55968899-55968921 CAGGCGAGGGTACAGGGCAGTGG - Intergenic
1159014335 18:63089125-63089147 CAGCCCAGAGTACAGTGCCTGGG - Intergenic
1160342576 18:78102198-78102220 GAGCTCAGGGTACAGGTGTTTGG - Intergenic
1160589106 18:79931151-79931173 CAGCTAAGGGGAAAAGGCATAGG + Intronic
1161810153 19:6466850-6466872 CAGCTCAGGGTGCTGGGGCTCGG + Intronic
1163015463 19:14451552-14451574 AGGCTCAGGGTACAGGCCGTAGG - Intronic
1163015468 19:14451572-14451594 AGGCTCAGGGTACAGGCCGTAGG - Intronic
1163273264 19:16266902-16266924 CAGCCCAGGGGTCAGGGCATTGG + Intergenic
1164725089 19:30460846-30460868 CGACTCAGGGTGCAGGGCCTGGG + Intronic
1164790856 19:30979237-30979259 CAGCTTAGGGTACAGGCCGAAGG - Intergenic
1166122107 19:40692194-40692216 CAGCTTGCGGTGCAGGGCATAGG + Exonic
1166871215 19:45872269-45872291 CAGCTCCGGGTACGGGGCCCCGG + Exonic
1167270368 19:48502522-48502544 TAGCTCAGGGGACAGGCCCTCGG + Exonic
925576001 2:5360538-5360560 GCGGTCAGGGTGCAGGGCATGGG + Intergenic
926871673 2:17425560-17425582 CAGATCAGGGCTCAGGACATTGG - Intergenic
927689505 2:25197816-25197838 TAGCCCAGGCTGCAGGGCATTGG - Intergenic
927693364 2:25223634-25223656 CAGGACACGGTTCAGGGCATCGG + Intergenic
927968953 2:27291972-27291994 GAGCTCAGGGTGCAGGGCGGTGG - Intronic
928139096 2:28712298-28712320 CAGCACAGAGTACTAGGCATAGG - Intergenic
931858109 2:66325171-66325193 CAGCTCAGGGCATATGTCATTGG - Intergenic
935131735 2:100265666-100265688 GAGCTCAGAATTCAGGGCATGGG + Intergenic
935619776 2:105119011-105119033 CAGCTGAGAGGCCAGGGCATGGG + Intergenic
937098417 2:119250581-119250603 CAGCTCAGGGGAGAGGGAGTGGG - Intronic
937428389 2:121818137-121818159 GAGCACAGGGCACAGGGCACAGG - Intergenic
938141027 2:128794727-128794749 GAGCTCATGGTCCAGGGCAGGGG + Intergenic
938697124 2:133844375-133844397 CAGCTCAGGTTGCAGGACAGAGG - Intergenic
938765783 2:134459807-134459829 CAGCTCAGAGGACAGAGCCTGGG - Intronic
938797905 2:134734280-134734302 CAGCTCTGGGAACATGGCAATGG - Intergenic
938880614 2:135582572-135582594 CAGTACAGGGTGCAGGGAATGGG + Intronic
942126317 2:172828998-172829020 CAGCTCAGGGAACAGGGATCAGG + Intronic
947083119 2:226420825-226420847 GAGCTCAGGGCACAGGGCCCAGG + Intergenic
947563250 2:231176429-231176451 CAGCTGAGGGTACTGAGCAGTGG - Intergenic
948642874 2:239386452-239386474 CAGCTGAGGGTGCAGGTCCTGGG + Intronic
1168764383 20:371897-371919 CACCTCAGGGGACAGGGTAGGGG + Intronic
1168836933 20:883764-883786 CAGCCCAAGGCACAGGGCCTGGG - Intronic
1169422539 20:5471646-5471668 GAGCTCAGGGCACAGGGATTGGG + Intergenic
1169620306 20:7499098-7499120 CAACTGAGGATACAGGGCAAAGG + Intergenic
1169942297 20:10950389-10950411 GAGCACAGGGTACAGTGCAGAGG - Intergenic
1170308185 20:14963117-14963139 TAGCTCAGAGCACAGTGCATTGG + Intronic
1172065575 20:32217581-32217603 CAGCCCAGGTTACAGAGCAAGGG + Intronic
1172087709 20:32400707-32400729 CAGCTCAGAGTGCAGGACTTAGG - Intronic
1173226990 20:41167933-41167955 CAGCTCAGGCCTCTGGGCATAGG + Intronic
1173288884 20:41696985-41697007 CAGGTCAGGGTACAGGGAGATGG + Intergenic
1175177298 20:57119933-57119955 CAGCTGTGGGTACAGGGGTTGGG + Intergenic
1177733161 21:25055076-25055098 CAGGTCAGGCTACAGAGCAATGG + Intergenic
1177898986 21:26890514-26890536 CTGCTCAGGCTACAGTGCAGTGG + Intergenic
1177900059 21:26903947-26903969 AACCTCAGGGTGCAGGACATAGG + Intergenic
1178753110 21:35322999-35323021 CTGCTAAGGGGACAGAGCATAGG + Intronic
1178988958 21:37335644-37335666 CAGCTAAGGGTAGGGGGCAATGG - Intergenic
1180905163 22:19405289-19405311 CACCTGAGTGTACAGTGCATGGG + Intronic
1181275876 22:21687246-21687268 CGGCCCAGAGTACAGCGCATGGG - Intronic
1181545627 22:23600524-23600546 CAGGTCTGGGCACAGGGCCTGGG + Intergenic
1181546376 22:23604772-23604794 CAGCTCAGGGGACAGGGACAGGG + Intergenic
1181600785 22:23950751-23950773 CAGCCCAGGCTAGAGGGCAGTGG + Intergenic
1181607727 22:23990584-23990606 CAGCCCAGGCTAGAGGGCAGTGG - Intergenic
1181738595 22:24901819-24901841 CAGCTCTGGCTATAGGCCATCGG - Exonic
1181814683 22:25429375-25429397 CAGGTCTGGGCACAGGGCCTGGG - Intergenic
1182357768 22:29729995-29730017 CTGCCCAGGGCACAGGGCACAGG + Exonic
1182585512 22:31342406-31342428 CAGCTTAGGGCACAAGGCAGTGG - Intronic
1183106297 22:35617523-35617545 CAGCTCAGGCCACAGGGGGTGGG + Intronic
1184377047 22:44120165-44120187 CAGCCCCAGGTACAGGGCCTGGG + Intronic
1184391475 22:44205893-44205915 CAGAACAGGGTGCAGGGCATTGG + Intronic
1185184001 22:49381711-49381733 CAGCTCAGGGCTCAGGGCTCGGG + Intergenic
1185299552 22:50072339-50072361 CAGCCCATGGTGCAGGGCCTGGG + Intronic
949495573 3:4628595-4628617 TAGCTCAGGGAACAGGAAATGGG - Intronic
950628908 3:14268248-14268270 CACCTCAGCGTCCAGGGCCTGGG + Intergenic
950793079 3:15488930-15488952 CAGCTCAGGAGACAGAGCGTTGG + Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
954645826 3:52130978-52131000 CAGGTCTGGGTCCAGGGCAGGGG + Intronic
955228367 3:57079081-57079103 CAGCTCGGGGACCAGGGCAAAGG + Intronic
956411707 3:68986276-68986298 CAGGTTAGGTTACATGGCATAGG - Intronic
957948800 3:87097822-87097844 CACCTCTGGGAGCAGGGCATAGG - Intergenic
959642382 3:108656057-108656079 CACCTCTGGGGGCAGGGCATAGG + Intronic
960890557 3:122443360-122443382 CACCTCTGGGGGCAGGGCATAGG + Intronic
961895642 3:130165990-130166012 CATCTCTGGGGGCAGGGCATTGG - Intergenic
962699252 3:137980392-137980414 CACCTCTGGGGGCAGGGCATAGG + Intergenic
962813250 3:138976714-138976736 CAGGTCAGGGAGCAGGGCAGAGG - Intergenic
963223447 3:142836342-142836364 AAGCTCAGGGTCCAGGCCAGGGG - Intronic
968453440 4:685865-685887 CAGCACAGGGGACAGCACATTGG + Exonic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
968568175 4:1325976-1325998 GGGCTGAGGGTACAGGGCAGAGG + Intronic
969060463 4:4429858-4429880 TACCTCAGGGGACAGGGCCTTGG + Intronic
969747127 4:9081126-9081148 CACCTCTAGGGACAGGGCATTGG + Intergenic
970824381 4:20254068-20254090 CAGCTCAGGGTCCTGTGCCTGGG + Intronic
972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG + Intronic
972960713 4:44448660-44448682 CCGCTCAGGGTTCGGGGCAGCGG + Exonic
975183001 4:71368858-71368880 CATCTAAGGGTGCAGGGCATGGG + Intronic
975201659 4:71597383-71597405 CACCTCATGGTTCAGAGCATTGG + Intergenic
979129152 4:117018371-117018393 CTGCTCAGGCTACAGTGCAGTGG - Intergenic
979989004 4:127351805-127351827 CAGGTGAGGGGGCAGGGCATTGG + Intergenic
981548184 4:145916011-145916033 CACCCCAGTGTACAGGGGATTGG - Intronic
982306216 4:153933884-153933906 CAGCTCTGGGTACAAGGCAAAGG + Intergenic
986248198 5:6030226-6030248 CAGGTCAGGGATCAGGACATTGG - Intergenic
986772105 5:10983800-10983822 CGTCTCAGGGTGAAGGGCATTGG - Intronic
987418004 5:17684619-17684641 CAGCTCAGGGTACAAGGTTGGGG - Intergenic
988905614 5:35785582-35785604 TAGCTCAGGGTAGAGTGCAGTGG + Intronic
989109883 5:37897004-37897026 CAAGTCAGGGAACAGGGCAGTGG - Intergenic
991361766 5:65828181-65828203 CAGCTCATGGTACAGCACACCGG + Exonic
992209892 5:74468572-74468594 CAGCTCACTGGACAGGGAATGGG + Intergenic
993538388 5:89117201-89117223 CAGCTCAGGGGGCAGGGACTGGG + Intergenic
993842930 5:92902260-92902282 CAGCTCTGGCTTCAGGGTATAGG + Intergenic
994246830 5:97488369-97488391 CAGCTCAAGGTGCTGGGCACAGG + Intergenic
994840083 5:104911801-104911823 GAGCTCAGAGTGCAGTGCATGGG - Intergenic
995648296 5:114338770-114338792 GAGTTCAGGCTGCAGGGCATGGG - Intergenic
996477906 5:123941927-123941949 CACCTCTGGGGGCAGGGCATAGG + Intergenic
997888046 5:137649085-137649107 CAGTTCAGAGCACAGGGCCTCGG + Intronic
998804089 5:145901586-145901608 CAGAGCAGGGTAAAGGGGATTGG + Intergenic
999323939 5:150631543-150631565 CAGCGCAGGGGTCAGGGCAGTGG + Intronic
1001300861 5:170532742-170532764 CAGCTGAGTGTCCAGGGCAGGGG - Intronic
1001406058 5:171478416-171478438 CATCACATGGTACAGTGCATGGG - Intergenic
1001663038 5:173410912-173410934 CAGCTCAGGGTTCAGTGAACGGG + Intergenic
1001756156 5:174171895-174171917 CAGATCAATGTGCAGGGCATAGG - Intronic
1002398447 5:178976222-178976244 CAGAGCAGGGTACAGAGAATGGG - Intergenic
1003971039 6:11299410-11299432 CACCTCTGGGGTCAGGGCATAGG + Intronic
1007094828 6:39206679-39206701 CAGCACAGGGGAGAGGGCAGAGG + Intronic
1007170668 6:39861043-39861065 CATCTCAGGGTTCATGGCATGGG + Intronic
1007707028 6:43797419-43797441 CCTCCCAGGGTACGGGGCATTGG - Intergenic
1007909625 6:45500708-45500730 CAGCTGAAGGTAGAGGTCATGGG + Intronic
1007925543 6:45646769-45646791 TAGCTGAGGGTAGAGGGCAGAGG + Intronic
1008829072 6:55736085-55736107 CACCTCTGGGGGCAGGGCATAGG + Intergenic
1019353190 7:564717-564739 CAGCTCAGGGGAGGGGGGATCGG + Intronic
1019516311 7:1441680-1441702 CAGCGGAGGGGACGGGGCATAGG + Intronic
1019531566 7:1506131-1506153 CAGCGCAGGGTGCAGGGCCCTGG - Intergenic
1023653222 7:42391943-42391965 CACCTCAGGTTACAGGGCCAGGG + Intergenic
1023865863 7:44238162-44238184 CAGCTAAGGGGACAAGGCAGAGG - Intronic
1025117262 7:56268639-56268661 CTGCCCAGGCTACAGTGCATTGG + Intergenic
1026898085 7:74022025-74022047 CAGCTGAGGGTTCCGGGCATGGG + Intergenic
1026975337 7:74494425-74494447 CAGCTCAGAGTCCAGGGCAAGGG + Intronic
1027702539 7:81486299-81486321 CAGCTGTGGGTACTGGGCATGGG - Intergenic
1028441986 7:90874120-90874142 CAGCTCAGGGAAGAGGGGAAGGG - Intronic
1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG + Intronic
1033876252 7:145822467-145822489 CAGCTCAGGCTCCTGGGGATGGG + Intergenic
1034849966 7:154484419-154484441 TTGCTCAGAGCACAGGGCATGGG - Intronic
1036370297 8:8156497-8156519 CACCTCTGGGGGCAGGGCATTGG + Intergenic
1036583483 8:10100358-10100380 CAGATCAAGGCACAGGGCTTGGG - Intronic
1036880595 8:12509134-12509156 CACCTCTGGGGGCAGGGCATTGG - Intergenic
1037574344 8:20187128-20187150 CAGCCCAGGGTACATGTAATTGG - Intergenic
1038374069 8:27020565-27020587 TACCTCAGGGTAAAGAGCATAGG - Intergenic
1039449618 8:37661561-37661583 CAGCTCAGGGTACAGCTCAAAGG + Intergenic
1042054809 8:64753577-64753599 CAACTCAGGGGCCAGGGCAGTGG + Intronic
1043641155 8:82452098-82452120 CAGCACTGGGCACAGGGCACTGG + Intergenic
1045143512 8:99313746-99313768 CACCTCTGGGGACAGGGCATAGG - Intronic
1045586179 8:103539768-103539790 CAGCTCAGGGGTTAGGGCACAGG - Intronic
1047434773 8:124827157-124827179 CAGCTCAGGGAAAACGGCACTGG - Intergenic
1047758845 8:127939257-127939279 CATATCAGGGTACAGGGCCAAGG - Intergenic
1049859638 8:144889854-144889876 CTTCTCAGGGTACGGGGCCTGGG - Intronic
1051189683 9:14498572-14498594 CAGCTCAGGATGCAGATCATTGG + Intergenic
1052031227 9:23631155-23631177 GAGCTCACTGTACAGAGCATTGG - Intergenic
1052158574 9:25226467-25226489 CAGCTCGGGGAACAGGGTAGGGG + Intergenic
1053444021 9:38137582-38137604 CACCTCACGGTTCAGGCCATGGG - Intergenic
1056861903 9:90192738-90192760 CACCTCTGGGGGCAGGGCATAGG + Intergenic
1058694835 9:107550409-107550431 TCGCCCAGGGTACAGGGCAGTGG + Intergenic
1060047748 9:120354020-120354042 CAGCTGAGAGCACAGGGCAGAGG + Intergenic
1060474363 9:123975844-123975866 CAGCTCTGGGCACTGGGCACTGG + Intergenic
1060964709 9:127706108-127706130 CAGAGCAGGGTTCAGGCCATTGG + Intronic
1062024663 9:134334785-134334807 CAGCTGAGGGGACAGGACTTGGG + Intronic
1062554567 9:137108109-137108131 CCGCACAGGGCACAGGGCACAGG - Intronic
1187032107 X:15498709-15498731 CAGCTAAAGGGACATGGCATGGG - Intronic
1191273509 X:58511062-58511084 CAGCTCAGGGGCCAGGGCTCGGG - Intergenic
1192931400 X:75810377-75810399 CACCTCTGGGGGCAGGGCATAGG - Intergenic
1193583582 X:83294108-83294130 CAGCTTTGGGTGCAGGTCATGGG - Intergenic
1197749650 X:129955767-129955789 TTGCTCAGGCTACAGTGCATTGG - Intergenic
1198819636 X:140633450-140633472 CACCTCTGGGGTCAGGGCATAGG + Intergenic
1199990400 X:152984566-152984588 CAGCTCAGGGGACAGGCCTGAGG + Intergenic
1199990469 X:152984833-152984855 CAGCTCAGGGGACAGGCCTGAGG + Intergenic
1200033490 X:153314040-153314062 CAGCTCAGGGGACAGGCCTGAGG + Intergenic
1200033559 X:153314307-153314329 CAGCTCAGGGGACAGGCCTGAGG + Intergenic
1201178838 Y:11327036-11327058 CACCTCAGAGAACAGTGCATAGG + Intergenic
1202039913 Y:20671208-20671230 CAACTCAGGCTGCAGTGCATTGG + Intergenic