ID: 972636239

View in Genome Browser
Species Human (GRCh38)
Location 4:40886533-40886555
Sequence CTGTAAAAGAATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972636239 Original CRISPR CTGTAAAAGAATAAGGAGGA AGG Intronic
901104399 1:6743993-6744015 CTGGCAAACATTAAGGAGGAAGG - Intergenic
901272518 1:7963616-7963638 CTGTAAAAGGCTAAGGCGGGCGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902961236 1:19964174-19964196 CTCTAAAAGATAAAGGAGGCAGG + Intergenic
904810033 1:33157484-33157506 CTGACAAAGAATAAGGAAGGGGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905682487 1:39884014-39884036 CTGTGAAAGAATAATAGGGACGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
907212082 1:52832609-52832631 CTACAAAAGAAAAAGGGGGAAGG - Intergenic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
907949157 1:59164221-59164243 CTGTTAAAGACTAAGGAGTGGGG + Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
909609767 1:77539810-77539832 CAGTAAAACAACAGGGAGGAGGG - Intronic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910160119 1:84263427-84263449 AGGTAAAAGGATAAGGAAGAAGG + Intergenic
910363396 1:86437717-86437739 CTGTTCAAGAATATGGAGGCTGG + Intronic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
911844562 1:102734650-102734672 CTCCAAAATAATCAGGAGGAAGG - Intergenic
912202732 1:107476757-107476779 CTGTCAAAGACTTAGAAGGAGGG - Intronic
915697444 1:157758244-157758266 CTGTAAAAGAATGAGGAACTGGG + Intronic
915863545 1:159473545-159473567 CTGTAAAAGAAAATAGATGAAGG - Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916843417 1:168624108-168624130 ATGTAAAAGAATATGGAGTGTGG + Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918883349 1:190156599-190156621 CAGTAAAAGAAAAACGGGGATGG + Intronic
919199471 1:194336293-194336315 CTGTAAAGGAATACTGAGGCTGG + Intergenic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
921078964 1:211723767-211723789 CTGGAAAAGAGAAAGGAGGGTGG - Intergenic
921252441 1:213310485-213310507 CTGTGAAAGAACCAGAAGGAAGG - Intergenic
921756018 1:218856468-218856490 CTGTAACAGTATTATGAGGAGGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
924910381 1:248505700-248505722 TTGTAAAATAATAAAGATGATGG - Intergenic
924913719 1:248542339-248542361 TTGTAAAATAATAAAGATGATGG + Intergenic
1063807662 10:9665632-9665654 CTGTAAAAGAATAAAAAGTATGG - Intergenic
1064279753 10:13940956-13940978 CTATAAAGGAAGAAGCAGGATGG + Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1067321124 10:45222267-45222289 CAGTAAAGAAATATGGAGGAAGG + Intergenic
1067795947 10:49322379-49322401 CTGCAAAAGAAAAAGGTGCAGGG - Intronic
1068381459 10:56259187-56259209 ATGCAAAAAAGTAAGGAGGAGGG - Intergenic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1070275638 10:75003622-75003644 CTGTAATATAATAAGGAAAATGG + Intronic
1070339809 10:75487593-75487615 CTGTAAGAGAATAGGAAGGAGGG - Intronic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071755919 10:88539073-88539095 TTCTAAAAGACTAAGGAAGATGG + Intronic
1072111341 10:92323035-92323057 CTGAAAAAGAATAAAGAAGGTGG - Intronic
1072185680 10:93036258-93036280 CTGTGAAAGACTGAAGAGGAGGG - Intronic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1073655259 10:105407635-105407657 CTATAAGAAAATAAGGTGGACGG - Intergenic
1074283384 10:112074452-112074474 CTGCAATAGAATCATGAGGAGGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1081578295 11:44333594-44333616 CAGAAAAAAAATAAGGAGCAGGG - Intergenic
1083379098 11:62250110-62250132 CTGTAAAAAAAAAAGGATGTTGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085522622 11:77147222-77147244 CTGTAAAAAGATTAGGGGGAGGG - Intronic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1086065593 11:82740387-82740409 CTGTAAAAAAAAAAAAAGGAAGG - Intergenic
1087126635 11:94633903-94633925 CTGAAAAAGAATAACAAGAAAGG + Intergenic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1089048588 11:115526112-115526134 CTGTAAAGGAAAAAGGTGGGAGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1090046782 11:123342721-123342743 CTGTAACAGTATTAAGAGGATGG + Intergenic
1090201352 11:124859940-124859962 CTTTAAAAGAATAGAGAGGATGG + Intergenic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090947376 11:131443290-131443312 TTGTAACAGAATAAAGAAGAGGG + Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1092761170 12:11812644-11812666 CTGTGAAAGAATACTGAGGGCGG - Intronic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093303569 12:17482688-17482710 CTGCAAAATAATAAAGGGGAGGG + Intergenic
1093310379 12:17574918-17574940 CTGTAAAAGAATCCTGGGGAAGG - Intergenic
1093417189 12:18933449-18933471 CTTTAAAAGGGTAAGGCGGAGGG - Intergenic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093544229 12:20327172-20327194 CTATAAGAGAATAAGGAGGCCGG - Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1095223362 12:39646846-39646868 CTGTCAAAGACTAAGTAGCAAGG + Exonic
1095314232 12:40740316-40740338 AAGTAAAAAGATAAGGAGGATGG - Intronic
1096087253 12:48874056-48874078 CTAAAAAAAAATTAGGAGGAAGG + Intergenic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1097268891 12:57762107-57762129 CTGTAAGAGATTAAGGGGGTGGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097907771 12:64938200-64938222 CTGAAAGAGAATAAGTAGGAAGG + Intergenic
1098085460 12:66837822-66837844 TAGTAACAGAATAAAGAGGAAGG + Intergenic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1099320771 12:81145688-81145710 CTGAAATAGAATCAGAAGGATGG + Intronic
1099757301 12:86869259-86869281 CTGTAAAAGATTATCTAGGAGGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100666875 12:96764325-96764347 CTGTAAAAGAGAAAGGAGTTGGG + Intronic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1100864311 12:98840106-98840128 CTCTAAAAGAAAAAGAGGGAAGG + Intronic
1101514274 12:105419978-105420000 CTATGAAAGATAAAGGAGGAGGG + Intergenic
1101952515 12:109187759-109187781 CTGTAAAAAAATAACGAAGTTGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1104617944 12:130285893-130285915 ATGTAAAAAAATAAAGAGGCTGG - Intergenic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106316990 13:28603034-28603056 CTGTCACAGAATGTGGAGGAGGG + Intergenic
1106321728 13:28645740-28645762 CTGTTAAAGACTTTGGAGGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106968652 13:35106761-35106783 CTTTAAAAAAAAAAGGCGGAGGG - Intronic
1107197279 13:37667606-37667628 CTTTAAAAGATTCTGGAGGAGGG - Intronic
1107961681 13:45564744-45564766 CTGTGAAAAAATAAGGACCAAGG + Intronic
1108692583 13:52872618-52872640 CAGTGAAAGAAAAAGGAGCATGG + Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110751208 13:79118666-79118688 CTAAAAAAGAAAAAGAAGGAAGG + Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111526125 13:89473258-89473280 CTCTAAAAAATTCAGGAGGAGGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1114234139 14:20810111-20810133 CTTTAGAAGAATAAGGAAGTGGG + Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115147234 14:30239621-30239643 GAGTAAAAATATAAGGAGGAGGG - Intergenic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1115470351 14:33762424-33762446 CTTTAAAATAAAAAGGGGGAGGG + Intronic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1116207916 14:41891904-41891926 CTGTGACAGAATCGGGAGGACGG - Exonic
1117365115 14:55019566-55019588 CTTTAAAATAATAAAGAGTAAGG + Intronic
1119613681 14:76084274-76084296 ATCTAAAAGGATAAGGAGAAGGG - Intronic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120439777 14:84521252-84521274 CTGCACAGGAATAAGGAAGAGGG + Intergenic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1121689703 14:95868494-95868516 CTCTAAATGAATAAGGAAGGAGG - Intergenic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1122936495 14:104960077-104960099 TTGTAAAACAAAAAGGAGGCTGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1125599002 15:40905535-40905557 CTTTAAAAAAAAAAGGCGGAGGG - Intergenic
1126755095 15:51918073-51918095 CTGTAAAAGTATAAAAGGGAAGG + Intronic
1126926168 15:53589048-53589070 CTGTAACTGAATAAGGAGTGAGG + Intronic
1127126219 15:55814362-55814384 CTATAAAACAATGAGGAGGCCGG - Intergenic
1128061149 15:64736766-64736788 CTGCAAAGGTATCAGGAGGAGGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130630917 15:85568326-85568348 GAGTAATATAATAAGGAGGAGGG + Intronic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130805897 15:87321639-87321661 CTGTAATTTAATAAGGAGGCAGG + Intergenic
1133089513 16:3392925-3392947 CTGGAAAAGATTAAGTTGGATGG + Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135817746 16:25651227-25651249 CTGTAAGAAAATAAGGAAAAGGG - Intergenic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1138278944 16:55758120-55758142 CTCTACAAGAATAAGGAGAAAGG - Intergenic
1138289590 16:55835554-55835576 CTCTACAAGAATAAGGAGAAAGG + Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139712973 16:68790557-68790579 CTCAAAAAGAATAAGGAGAATGG - Intronic
1140025077 16:71280832-71280854 CAATAAAAGAATAAGGGGGCAGG + Intergenic
1140117110 16:72051448-72051470 TTTTAAAATATTAAGGAGGAGGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143688487 17:8539207-8539229 CTATAACAGAATAAGTAAGATGG - Intronic
1143800396 17:9374765-9374787 CATTAAAAGAATAAAGAGGTTGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1144003612 17:11078793-11078815 AAGTAAAAGGATAAGGAGCATGG + Intergenic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1146032349 17:29377011-29377033 CTGTAAAAGGATTAGCAGGATGG - Intergenic
1146246145 17:31284822-31284844 CTGTAAAACAATGTGGAGGCCGG + Intronic
1146247467 17:31301881-31301903 CTGCAAAAGAATAAGGCACAGGG - Intronic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147269577 17:39258950-39258972 CTGAAAGAGAATAAGGGGAAAGG + Intergenic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1148681201 17:49474556-49474578 CTAGGAAAGAACAAGGAGGAAGG - Intronic
1149507822 17:57210677-57210699 GTGTAAAAGAAAAAAGAGGTGGG + Intergenic
1149734087 17:58975878-58975900 CTAAAAAGGAATATGGAGGAGGG + Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1153147940 18:2055140-2055162 CTGTAAAAGGACAAAAAGGAAGG - Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1155354574 18:24939951-24939973 CTGGAAAAGAATGAGGGAGATGG - Intergenic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1155723946 18:29055238-29055260 CTGTAAAAAGATAAGGAAGGGGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1157298385 18:46462163-46462185 CTGTAGAGGAATAATGAGGGAGG + Exonic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1164053810 19:21605476-21605498 CGTCAAAAGAATAAGGAGAATGG + Intergenic
1164393102 19:27842649-27842671 CAGTGCAAGAATAAGTAGGAAGG + Intergenic
1164676402 19:30104479-30104501 CTGTAAAGCAGTAAGGAGAATGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925556812 2:5140096-5140118 TTCTAAAATAATAAAGAGGAAGG - Intergenic
926630753 2:15134146-15134168 GTGTGATAGAATAAGGAGGTGGG + Intergenic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
927449687 2:23197995-23198017 TTGTTAAACACTAAGGAGGAAGG + Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929744393 2:44640999-44641021 CTGTAACATAAAAAGGAGGGAGG - Intronic
930554736 2:52881613-52881635 ATGACATAGAATAAGGAGGAAGG + Intergenic
931164536 2:59732860-59732882 CTGGAAGAGAATAAGGAGACAGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936759475 2:115758650-115758672 CTGTAAAAGAATAAAATTGAAGG + Intronic
937696795 2:124817327-124817349 TTGTAAAAGCATATGGAGCATGG + Intronic
939581970 2:143961293-143961315 CAGTAAAAGACTATGGGGGAAGG - Intronic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940549536 2:155135658-155135680 TTGTTAAAGAATAATGATGAAGG + Intergenic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942111661 2:172688602-172688624 CTATAAAGGATAAAGGAGGAGGG + Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943246161 2:185453563-185453585 TTGCAAAAAATTAAGGAGGAGGG + Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
944386321 2:199169051-199169073 TTGTAAAAGAATAATGACAAAGG + Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
947291403 2:228578877-228578899 CTGATAAAGAATTAGGATGACGG - Intergenic
947923370 2:233898967-233898989 CTGTAAAAAAATGATGAAGATGG - Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171134566 20:22684905-22684927 CTGTAAGAGAGTGAGGAAGAGGG + Intergenic
1172083654 20:32361341-32361363 CTCTAAAAAAATAATGAGGCTGG + Intronic
1172569394 20:35957252-35957274 CAGTAAAAAAATAATGTGGAGGG + Intronic
1172583584 20:36066530-36066552 CTGTACCAGAATAAGGGGGAAGG + Intergenic
1172791535 20:37509249-37509271 CAGTAATTGAACAAGGAGGATGG - Intronic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1176725504 21:10428695-10428717 CTCTAAAAGATTGAGGGGGAGGG - Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1181163737 22:20972746-20972768 CTGTAATTGAAAAAGGAGGCGGG + Intronic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182996110 22:34813862-34813884 CGGCAAAAGAATGAGGATGAGGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
951277229 3:20703082-20703104 GTGTAAAATAATATAGAGGAAGG - Intergenic
951444686 3:22764930-22764952 CTGTAAAAGGACAAAGAGAAAGG - Intergenic
952145912 3:30531719-30531741 CTGCTCAGGAATAAGGAGGATGG - Intergenic
952271085 3:31832040-31832062 CTGTAAGAGAATAATGAGAGAGG + Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
954480224 3:50792943-50792965 TTCTAAAAAACTAAGGAGGAGGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
956335558 3:68159561-68159583 CTCTAAAAAACTAAGTAGGAAGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957589915 3:82182971-82182993 CAGTAAAAGAATAAAGAGTGAGG - Intergenic
957977393 3:87464618-87464640 TTCCAAAAGATTAAGGAGGAGGG + Intergenic
958922274 3:100120832-100120854 CAGGAAAAGAGTAAGAAGGAGGG + Intronic
959718461 3:109459860-109459882 CTGGAAGAGAATAAAAAGGATGG - Intergenic
960682121 3:120259998-120260020 GAGTAAAATAATAAGGGGGAGGG + Intronic
960699041 3:120423152-120423174 CTGTAAAATAATAAAGAAAATGG - Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
962829205 3:139124779-139124801 CTTTAAAATAATAGGGAGGTTGG + Intronic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963730873 3:148970813-148970835 CAGTTAAAAAATAAGGGGGAGGG - Intergenic
963988160 3:151621368-151621390 GTTTCAAAGAATAAGGAGAAAGG + Intergenic
965147419 3:164924486-164924508 CTTCAAAAAATTAAGGAGGAGGG - Intergenic
965367240 3:167815890-167815912 GAGTAAAAGAGTAAGGAGAATGG - Intronic
965391298 3:168107659-168107681 CTGTAAATGACTAATAAGGATGG + Intergenic
965565402 3:170111248-170111270 CTTTAAAACAAGAAGAAGGAAGG + Intronic
965876138 3:173322555-173322577 CTATAAAAGAGTAAGGGGGCTGG - Intergenic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
967597912 3:191349555-191349577 CTGTGAAAGAATCGGAAGGATGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968766782 4:2475745-2475767 CTGTAAGAGAGTAAGAAGTAGGG - Intronic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972895821 4:43619077-43619099 TTGTAAAAAATTATGGAGGAGGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973278135 4:48331881-48331903 CTGAGATAGAATAAGGGGGAAGG + Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974566652 4:63586301-63586323 TTGTTAAAGTATATGGAGGATGG - Intergenic
975122199 4:70740600-70740622 CTGTAAAGTAATAATGTGGATGG + Intronic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978072302 4:104489396-104489418 CTTTAAAAGAATAAAGAGAAGGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978145683 4:105368648-105368670 TTGTTCAAGAATAAGGAGAAAGG + Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
978740123 4:112127526-112127548 CTTTAAAAAAAAAAGGATGAAGG + Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
981676912 4:147353255-147353277 TTGTAAAAGAAACAGGGGGATGG - Intergenic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
984139454 4:175985040-175985062 CTGAAAAAGAAAAAGAAGGTGGG - Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
988474050 5:31566999-31567021 CAGTAAAAGACTGGGGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990087936 5:52001884-52001906 CTATAAGAGTATAAAGAGGAAGG - Intergenic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990594603 5:57300303-57300325 CCGTAAAAGAATATGGAGCATGG - Intergenic
990924222 5:61001245-61001267 AAGTAAAAGTATAAGGAGGTTGG - Intronic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995865558 5:116686561-116686583 CTGAAACAGATTTAGGAGGAGGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997369692 5:133350642-133350664 ATGTAAAAGAATACAGAGGCGGG + Intronic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
999811527 5:155131838-155131860 CTTTAAAAAAATAAGGAAAATGG + Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000717897 5:164669409-164669431 CTATTAAAGAATAAGGAGACTGG - Intergenic
1001605111 5:172954271-172954293 CTGTAAAAGATTTGGGAGGCCGG + Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003349355 6:5301448-5301470 CTCTAAAAGAACAAAGAAGATGG + Intronic
1003517284 6:6827593-6827615 TTGTGAAAGAAAAAGGAGGCCGG + Intergenic
1003586725 6:7396831-7396853 CTGTAAAAGAATTATGATCAAGG - Intronic
1004410039 6:15372652-15372674 CCTTAAAAGAATAAGAAGAACGG - Intronic
1005913862 6:30334835-30334857 CTCAAAAAGAATCAAGAGGATGG - Intronic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006796232 6:36734188-36734210 CAGTAAAAGAATCAGCTGGAGGG - Intergenic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1009928296 6:70146522-70146544 CTATAAAAGAATAAGGAACGGGG - Intronic
1010326984 6:74575780-74575802 CTTTTAAAAAATAAGTAGGATGG + Intergenic
1010355528 6:74928227-74928249 CTGTAAAAGAATAAGAAAAATGG - Intergenic
1011239375 6:85255072-85255094 CTGCAAAAGAATAAAGATGAGGG - Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1011869636 6:91876504-91876526 AGGTAAAAGCATAAGGAGAAGGG + Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1012551559 6:100468122-100468144 CTGCAAAAAAATAAAGAGAATGG - Intergenic
1014226703 6:118856508-118856530 CTGTAAAAGACTCAGGAGAATGG - Exonic
1014266056 6:119278987-119279009 CTATAAAAGAATACTGAGGCTGG - Intronic
1014484121 6:121978091-121978113 CTTTAAGAGAATAGGGAGGGAGG + Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016403100 6:143701596-143701618 CTGTACAAAAATGGGGAGGAGGG - Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017791760 6:157805817-157805839 ATGTAAAAGAATACAGAAGAAGG - Intronic
1018185466 6:161262486-161262508 CTATGAGAGAATAATGAGGAGGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019888834 7:3928997-3929019 CTGAGAAAGAATAAGGAACAGGG - Intronic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1022088495 7:27092129-27092151 CTGTAAAAGACTCAAGTGGATGG - Intergenic
1022162092 7:27721331-27721353 CTGAAAAATAGCAAGGAGGATGG + Intergenic
1022270955 7:28807509-28807531 CTGTAAAAGAATCAGGCCCAGGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024923316 7:54584958-54584980 AGGTAAAAGAGAAAGGAGGAAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1029782280 7:102747487-102747509 CACCAAAAGAATAAGGAGGGAGG + Intergenic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1031255828 7:119447248-119447270 CTGCAAAAAATTTAGGAGGATGG - Intergenic
1031519724 7:122748861-122748883 CTGTTAAACAATAAGGGGGTGGG + Intronic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1034063415 7:148113865-148113887 CAGTAACAGAATAATGAGGCAGG - Intronic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036016605 8:4792099-4792121 CTGTTAGAAAATACGGAGGAAGG - Intronic
1037756746 8:21715186-21715208 CAGTTAAAGAATAAACAGGAAGG - Intronic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041989221 8:63965718-63965740 GTGTAAAAGAATAACGAAAATGG + Intergenic
1042972959 8:74431353-74431375 CTTTAAAATAACACGGAGGAGGG + Intronic
1043005922 8:74818528-74818550 CTGAAGAAGAATAAGCATGAAGG - Intronic
1043506271 8:80906441-80906463 GTGAGAAAGAATAAGGAAGAGGG - Intergenic
1043722878 8:83568988-83569010 CTGTAAAACTATAAACAGGACGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044330786 8:90917801-90917823 CAGTAAAAGAAAAAGTAGAATGG - Intronic
1044634000 8:94304184-94304206 CTAGGAAAGATTAAGGAGGAGGG + Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1046050889 8:109021239-109021261 GTGTAAAATAATAGGAAGGATGG - Intergenic
1046344134 8:112900724-112900746 CTTTAAAAGAAGAAGAATGAGGG + Intronic
1046494717 8:114998669-114998691 CAATAAAAAAAAAAGGAGGAAGG - Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047064941 8:121271331-121271353 CTTTTAAAGAAATAGGAGGATGG + Intergenic
1048937228 8:139367320-139367342 CTCTAAAAGTTAAAGGAGGATGG + Intergenic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051164745 9:14249647-14249669 CTGTAAAAAAATAGAAAGGAAGG + Intronic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053783443 9:41633536-41633558 CTCTAAAAGAATTAGGGTGATGG + Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055365087 9:75535105-75535127 CTTTAACAAAATAAGGAAGAGGG + Intergenic
1055634462 9:78261546-78261568 CTTTAAAGGAGTAATGAGGAGGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056975745 9:91251593-91251615 CTGTAAAAGAAAAAGGGAAAGGG + Intronic
1057691437 9:97290163-97290185 CTGTCAAAAAAAAAGAAGGAAGG + Intergenic
1058206210 9:102111674-102111696 CTGCAAAATAATAAGCAAGATGG - Intergenic
1058834835 9:108851832-108851854 CTGGTATAGAAAAAGGAGGAGGG - Intergenic
1059489982 9:114658968-114658990 CTGGAAAAGAGAAAGGAGGTTGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1187526904 X:20062478-20062500 CTTTAAAAAAAAAAGAAGGAAGG + Intronic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187833603 X:23408134-23408156 CAGTAAAAGAATAAGGGAGGAGG - Intergenic
1188305209 X:28553501-28553523 TAATAAAAGAATATGGAGGAGGG + Intergenic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1188488987 X:30716272-30716294 CTTTGAGAGTATAAGGAGGAGGG + Intronic
1188997837 X:36907177-36907199 TAGTTAAAGAATAAGGAGTAAGG + Intergenic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1191075481 X:56448796-56448818 CTGAAAAAATTTAAGGAGGAAGG - Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191701124 X:64043996-64044018 CTGAAAAAGAGTAAGCAGGCTGG - Intergenic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1193193507 X:78602295-78602317 CTGCAAAAAAATAAAGAAGAAGG - Intergenic
1193570484 X:83135775-83135797 CTGTTAAAGAATAAGAAGGTGGG - Intergenic
1194305575 X:92243541-92243563 CTGAAAAAGAATAAAATGGAAGG - Intronic
1196200009 X:112875561-112875583 CTTTAAAAAAATTAGTAGGAAGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197352609 X:125396558-125396580 CTGTAAAAGAATAAGAACATAGG - Intergenic
1197647762 X:129036448-129036470 CTGTGAAAGAATTGGGTGGAGGG - Intergenic
1198272755 X:135070070-135070092 CTCTTAAAGAAACAGGAGGAAGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1199329781 X:146545334-146545356 CTGTAAAAAAAAAAAGAGGTTGG + Intergenic
1199966551 X:152825105-152825127 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1199966565 X:152825170-152825192 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic