ID: 972636833

View in Genome Browser
Species Human (GRCh38)
Location 4:40891854-40891876
Sequence TTTCTTGGCTAGGATTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972636833_972636841 29 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636841 4:40891906-40891928 AGACAGGTGGAGAATTTGGTGGG 0: 1
1: 0
2: 4
3: 23
4: 194
972636833_972636837 13 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636837 4:40891890-40891912 GACTGAAGGAGAGAGAAGACAGG 0: 1
1: 0
2: 6
3: 77
4: 811
972636833_972636838 16 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636838 4:40891893-40891915 TGAAGGAGAGAGAAGACAGGTGG 0: 1
1: 0
2: 5
3: 144
4: 1280
972636833_972636836 -1 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636836 4:40891876-40891898 AGAACAGCAGTTTTGACTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 198
972636833_972636840 28 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636840 4:40891905-40891927 AAGACAGGTGGAGAATTTGGTGG 0: 1
1: 0
2: 4
3: 39
4: 315
972636833_972636839 25 Left 972636833 4:40891854-40891876 CCTTCTAAATCCTAGCCAAGAAA 0: 1
1: 0
2: 0
3: 15
4: 163
Right 972636839 4:40891902-40891924 GAGAAGACAGGTGGAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972636833 Original CRISPR TTTCTTGGCTAGGATTTAGA AGG (reversed) Intronic
900981381 1:6048032-6048054 TTTTGTGGCCAGGATTTAGAGGG - Intronic
901590993 1:10342590-10342612 TTTATTAGCTAAGACTTAGAGGG + Intronic
901673935 1:10872000-10872022 ATTCTTGGCTTGGAGTCAGAGGG + Intergenic
907648592 1:56270140-56270162 TTACTTGGTGAGGATTTACATGG + Intergenic
907852070 1:58264912-58264934 TTTCTTTGCTATGATTTGCACGG + Intronic
920576875 1:207067733-207067755 TTTCTAGGCTTAGAGTTAGAAGG + Intronic
920814489 1:209318715-209318737 TTTCTAGGCTAGGAAGTAGAAGG - Intergenic
921290847 1:213656016-213656038 TTCTTTGGCTAGCATTTATATGG + Intergenic
924885505 1:248210980-248211002 TGTCCTGACTAGGATTAAGATGG - Intergenic
924906408 1:248457618-248457640 TTTATTACCTGGGATTTAGAAGG - Intergenic
924921479 1:248634423-248634445 TTTATTACCTGGGATTTAGAAGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1066486164 10:35846898-35846920 TATATTGGCTAGGATTTTGCTGG + Intergenic
1066619350 10:37327660-37327682 ATTCTTGGCTGGAATTTATATGG + Intronic
1068985513 10:63104541-63104563 TTTCTTGCCTGGGAACTAGACGG - Intergenic
1073648086 10:105327702-105327724 TTACTTGGGTAGGATTCACAAGG - Intergenic
1073699370 10:105908220-105908242 TTTCATGGCTAGAGTTTAGTGGG + Intergenic
1074008470 10:109452888-109452910 TTAGTTGGATAGGTTTTAGATGG - Intergenic
1074832675 10:117260539-117260561 TTCCTTTGCTAGCATTTAAATGG + Intronic
1079187145 11:18247920-18247942 TTCCTTGGCGAGGCTTTTGATGG - Exonic
1079189658 11:18266957-18266979 TTCCTTGGCGAGGCTTTTGATGG + Exonic
1079767368 11:24411602-24411624 TGTCGTGGCTAGCATGTAGAAGG - Intergenic
1080095543 11:28402021-28402043 ACTCTTGGATAGGTTTTAGAAGG - Intergenic
1085363846 11:75918846-75918868 TTTCTAGGCTAATATTTAAAAGG + Intronic
1085639102 11:78180149-78180171 TTTCTTGGATAGGACCTAAAAGG + Intronic
1086316109 11:85594455-85594477 TTTTTTGGAGAGGAATTAGAGGG - Intronic
1086835599 11:91617876-91617898 TTTCTTGGCAAGGATTTCTTTGG - Intergenic
1086913493 11:92500131-92500153 TTTGTTGACTAAAATTTAGAAGG + Intronic
1089441353 11:118520156-118520178 TTTCCTGGATAAGATTTAAAAGG + Intronic
1091695197 12:2623670-2623692 TTCCTGGGCTAGCATTTGGAAGG - Intronic
1092771959 12:11904817-11904839 TTCCTTCTCTAGGATTTGGAAGG + Intergenic
1094097066 12:26718323-26718345 CTTATTGGCTAGGATTTATATGG - Intronic
1098249174 12:68550995-68551017 TTTCTTGGATAAGGTTTTGAGGG - Intergenic
1106275102 13:28197170-28197192 TTCCTTGGCTAGGAAAAAGAAGG - Exonic
1108074147 13:46661386-46661408 TTTCTTGGCTAATATATATAAGG - Intronic
1108943752 13:55994064-55994086 TTTCTTATCTAGGAATTATATGG + Intergenic
1109372735 13:61445250-61445272 TTTAGTGGCTAGATTTTAGATGG - Intergenic
1109786552 13:67182987-67183009 TTTCTTAGCTAGGTGTTGGAAGG + Intronic
1110149549 13:72234011-72234033 TTTGTTGGCGAGAATTTAGTTGG - Intergenic
1110545637 13:76752289-76752311 TTTGTTGGCTTGTTTTTAGAAGG + Intergenic
1112726477 13:102310582-102310604 TTTCTGGGCCAGGAGATAGAGGG + Intronic
1112967301 13:105212372-105212394 TTTCTTCTCTAGGATTTCAAGGG - Intergenic
1113085877 13:106568829-106568851 TTTCGTGGCTAGGGTTGAGGAGG - Intergenic
1113416163 13:110130266-110130288 TTTCATGGCTAGGACTTGGTAGG - Intergenic
1114739856 14:25084595-25084617 TTACATGGCTAAGATTTTGATGG + Intergenic
1117612321 14:57497277-57497299 TTTCTTGGAAAGGCTTCAGAAGG + Intergenic
1117949126 14:61063254-61063276 GTTTTTAGATAGGATTTAGAGGG - Intronic
1119422046 14:74513044-74513066 TTTCCTGGCATGGATTTAGGAGG - Intronic
1120534877 14:85682227-85682249 TTTTTTAGCTTGCATTTAGAAGG + Intergenic
1124152856 15:27197656-27197678 TTGCTTGGCTTAGTTTTAGAAGG + Intronic
1124797965 15:32800981-32801003 TTTCATTTCTAGTATTTAGAGGG + Intronic
1126163196 15:45632637-45632659 CTTCTTGGCTTGGATGTGGAGGG + Intronic
1130398614 15:83528938-83528960 TTTTTTGGATTGGCTTTAGAGGG + Intronic
1133455711 16:5940694-5940716 TTTCTAGGCCAGGAATTAGAGGG + Intergenic
1134365222 16:13570923-13570945 TTTCTGGGCAAGGATTTTTAAGG + Intergenic
1140222826 16:73056659-73056681 CTTCTTAGAGAGGATTTAGAGGG - Intronic
1141041233 16:80674327-80674349 CTTCTTGGAGAGCATTTAGAAGG + Intronic
1141813904 16:86396346-86396368 TTTATTGGCTGGGATGAAGAAGG + Intergenic
1141899489 16:86981675-86981697 TTTCTTGACTTGGATGTAGCGGG - Intergenic
1146341776 17:32025614-32025636 TTTCCTTCCTAGGACTTAGAGGG + Intronic
1146351028 17:32094021-32094043 TTTCCTTCCTAGGACTTAGAGGG - Intergenic
1146397519 17:32480600-32480622 TTTCTTGGCTTTGTTGTAGAGGG - Exonic
1149947382 17:60945346-60945368 ATTCTTGTTTAGGATTTTGAGGG - Intronic
1150256650 17:63751189-63751211 TTTCTTGACCAGCATTTACAAGG + Intronic
1155103305 18:22635676-22635698 ATTCTTGGCTAAGTTTTAGATGG + Intergenic
1157923524 18:51738324-51738346 TTTCTTGGATATGATATAAAAGG + Intergenic
1158054825 18:53266083-53266105 GTGCTTGGTTAGGATTTGGATGG - Intronic
1158454151 18:57591830-57591852 TTTCTCACCTAGGATTTTGAGGG + Intergenic
1158958673 18:62568069-62568091 TTTCTTGTAAAAGATTTAGAAGG + Intronic
1159990011 18:74894631-74894653 TTTCTTCTCTATGATTTATAGGG + Intronic
1164424625 19:28130277-28130299 ATTCTTGGCCTGGCTTTAGAAGG + Intergenic
1164848405 19:31456648-31456670 TTTCTTGGTTAGGGTTTGCATGG + Intergenic
1165921450 19:39300655-39300677 TTTCTTGATTAGGAGTCAGAGGG + Intergenic
1167870332 19:52363771-52363793 TGTCGTGGATAGGATTTAGTTGG + Intronic
925837833 2:7963203-7963225 TTTCTTGGTAATAATTTAGAGGG + Intergenic
929052060 2:37846001-37846023 TTTCCTGGCTTGGATTTTAATGG - Intergenic
930076986 2:47414128-47414150 TTTCTTGGTTTGGATTGGGAAGG + Intronic
930959195 2:57238331-57238353 TTTTTTGGCTAGTATTTTGTTGG - Intergenic
932950508 2:76287702-76287724 TTTCTTGGCTTGGCTTTGGATGG - Intergenic
935694008 2:105755120-105755142 CTTCCTAGCTTGGATTTAGAAGG + Intronic
938423727 2:131166460-131166482 TTTCTTTCCTATGATTTAAAAGG - Intronic
938950198 2:136248268-136248290 TGGCTTGGCTAGAATTTAGTAGG - Intergenic
939662338 2:144905421-144905443 TGTCTTGGCTTAGATTTATAGGG + Intergenic
941039837 2:160608812-160608834 TTTATTGCTTAGGATTTAAAAGG - Intergenic
941372737 2:164687243-164687265 TTTATTGGTTAGTATTAAGAGGG + Intronic
942749548 2:179272185-179272207 TTTCTAGGCTAGGATTTTAAAGG - Intergenic
943944911 2:194046403-194046425 AATCTTGGTAAGGATTTAGAGGG - Intergenic
945056626 2:205874847-205874869 TTTCTTGTCTAGGAGGTAGCAGG - Intergenic
947357627 2:229313446-229313468 TTGCTTGGCTAAGACATAGAAGG - Intergenic
947849263 2:233271906-233271928 ATTCTTGGCCAGGATGTAGAAGG - Intronic
1169704125 20:8483502-8483524 TTACTTGGCCAACATTTAGAAGG - Intronic
1170681952 20:18533818-18533840 TTTCCTGGCAAGGCTTTGGAAGG + Intronic
1170971742 20:21123270-21123292 TGTCTTAGCTAGAACTTAGAGGG - Intergenic
1177498151 21:21915467-21915489 TTTCTTGGTCTGGATTTAGATGG + Intergenic
1178330580 21:31687061-31687083 ATTCTTGGCTGTGATTTAAATGG - Intronic
1179594022 21:42430349-42430371 TTTCCTCTCTAGGATTTGGAGGG + Intronic
1181602563 22:23961063-23961085 CTTCTTGGCGAAGATGTAGACGG + Exonic
1181605951 22:23980244-23980266 CTTCTTGGCGAAGATGTAGACGG - Exonic
1183160116 22:36107660-36107682 ATTCTTGGCTAGCGTTTACAGGG + Intergenic
1183463194 22:37965317-37965339 TTTGTTGGGTAGGTTTTGGATGG + Intronic
950434383 3:12969774-12969796 TGTCTCGGCTGGGATTTAGAAGG + Intronic
951712850 3:25602733-25602755 TTCCTTGGCTTGGAGTTACATGG + Intronic
952933565 3:38377922-38377944 TTTCTCGGGAAGGATTTAGTTGG + Intronic
954867094 3:53738967-53738989 TTTCTTGGCCAGGCTATGGAAGG - Intronic
956544836 3:70389316-70389338 TTTCTTGGCAAGGAAGAAGATGG + Intergenic
956712612 3:72051558-72051580 TTTCTTTGGAAGGATTTAGAGGG + Intergenic
957322136 3:78644987-78645009 TGTCTGGGCTGTGATTTAGATGG + Intronic
958605062 3:96347318-96347340 TTACTTGGCTAATATTTAGAAGG - Intergenic
958644845 3:96856501-96856523 TTTATTGGCTAAATTTTAGAAGG - Intronic
958657950 3:97027128-97027150 GTTCTTTGCAAGGATTTGGATGG + Intronic
959739549 3:109701277-109701299 TTTCTTCTCTTGAATTTAGAAGG - Intergenic
961414285 3:126746039-126746061 GTTCTTGGCTAGGACTTGGGTGG + Intronic
963626636 3:147681452-147681474 TTTTTGGCCTAGGAATTAGATGG + Intergenic
964348832 3:155782685-155782707 TTTCTTGGCTTGTATTTATCCGG - Intronic
965038183 3:163469933-163469955 TTTCTTTCCTAGAGTTTAGATGG - Intergenic
969616001 4:8252889-8252911 TTTCTTATCTAGCATTTTGATGG + Intergenic
972155748 4:36159380-36159402 TTTCTTGGCTAGCAGATAGGGGG + Exonic
972636833 4:40891854-40891876 TTTCTTGGCTAGGATTTAGAAGG - Intronic
974732223 4:65882714-65882736 TTTCTTTGGTAAAATTTAGAAGG - Intergenic
974755357 4:66199244-66199266 TTTCTTAGCAATGATTTACATGG + Intergenic
978027994 4:103901632-103901654 TTTCTTGTCTAGAATTTTCATGG - Intergenic
978508061 4:109482239-109482261 TTTCTTGTCATGTATTTAGAAGG + Intronic
978696791 4:111590485-111590507 ATTCTTGCCTAGGATTTCAAGGG + Intergenic
979901016 4:126218712-126218734 TTTCTGGATTAGGATTCAGAAGG - Intergenic
980447019 4:132922667-132922689 TTTCTTGGCCAGGATTCCCATGG + Intergenic
983088940 4:163481230-163481252 TATGTTGGCTAGCATTTTGAAGG - Intergenic
983424602 4:167567418-167567440 TTTCTTTGCGAGGACATAGATGG + Intergenic
983552268 4:169029834-169029856 TATCTTGGGTAGAATTCAGAGGG + Intergenic
984648713 4:182246438-182246460 TTCCTTTTCTAGGATATAGATGG + Intronic
986206872 5:5632815-5632837 TTGATTGACTAGGAATTAGAGGG - Intergenic
988435512 5:31169869-31169891 TTTTTTGGCTAGAAATCAGAAGG - Intergenic
989710618 5:44392292-44392314 TTTCTTTGCTAGGATTGAAAAGG + Intergenic
991007254 5:61841518-61841540 TTTCTTTGATAGCATTTACAGGG + Intergenic
991658993 5:68931599-68931621 TTACTTGCCTAGAATTAAGATGG - Intergenic
991666471 5:69004799-69004821 TTTCCTAGCTAGGAATCAGAAGG - Intergenic
993042316 5:82828397-82828419 TTTCTTCGCTAGAATTTATATGG + Intergenic
996319789 5:122202167-122202189 TTTTTTGGCTTGGATCTAGCAGG + Intergenic
998313396 5:141157171-141157193 TTTCTAAGGTAGGTTTTAGAAGG - Intergenic
998637310 5:143970584-143970606 TTTCTTGGCTTGAATCTAAACGG - Intergenic
998742609 5:145222091-145222113 TCTATTGTCTAGGAATTAGATGG + Intergenic
1003867190 6:10374148-10374170 TTTGTAAGCTGGGATTTAGAGGG + Intergenic
1004209569 6:13625235-13625257 TTTCTAGGCTAGGAATTGGGTGG - Intronic
1007326232 6:41062170-41062192 GTTCTTTGGTAAGATTTAGATGG + Intronic
1008920672 6:56842205-56842227 TTTCATAGGTAGGATTCAGATGG - Intronic
1009042848 6:58201132-58201154 GTACTAGGCTAGGACTTAGAAGG + Intergenic
1009218682 6:60955368-60955390 GTACTAGGCTAGGACTTAGAAGG + Intergenic
1009555574 6:65160728-65160750 ATTCTTGGCTAGAATTTTTAAGG - Intronic
1018092463 6:160356703-160356725 TTTCTTGGTTATGATTTAAGAGG - Intronic
1018552938 6:165019085-165019107 TTTCTGGACTGGGATTTGGATGG - Intergenic
1018874944 6:167813911-167813933 ATTCTAGGCTTGGATTTGGATGG - Intergenic
1021121359 7:16799231-16799253 TTTGTTGGCTTGCTTTTAGAAGG + Intronic
1024826325 7:53395043-53395065 TCTCTTGGCTAGCATTTACTGGG + Intergenic
1025927693 7:65972691-65972713 TTTCTGGGGCAGGATTTGGAGGG - Intronic
1031631824 7:124052625-124052647 TTTCTTGCATAGTATGTAGAAGG + Intergenic
1032085034 7:128879411-128879433 TTTTTTGGCTAGGAGGTAGCTGG + Intronic
1032964015 7:137074719-137074741 CTTCTTTGCTGGGGTTTAGATGG - Intergenic
1036698480 8:10994842-10994864 TTTCTGGGCTAAAATTTAGGGGG - Intronic
1041693515 8:60713471-60713493 TTTCTTAGCTAGAATATAGAGGG + Intronic
1042765818 8:72321111-72321133 TCTCTTGACCAAGATTTAGAGGG - Intergenic
1043850624 8:85212380-85212402 TTTCTTTGCTTGCATTTTGAGGG + Intronic
1045362068 8:101442112-101442134 TTTCGATGCTAGCATTTAGAAGG + Intergenic
1047439788 8:124867507-124867529 TTTCTTGGTTAGGGTTGGGAAGG - Intergenic
1049135894 8:140899242-140899264 TTTCTAGGCTAGGAAATAAAAGG + Intronic
1052652547 9:31322201-31322223 TTTATTGGCTAAAATATAGAAGG + Intergenic
1053150077 9:35737697-35737719 TTTCTGGGCCAGGATACAGATGG + Intronic
1055374005 9:75629132-75629154 TCACTTGGCTAGGATTTAAGTGG - Intergenic
1056622589 9:88226504-88226526 TTTCTTTGCTTGTTTTTAGATGG - Intergenic
1056812136 9:89772944-89772966 TTTCTAGGCTAGGCCTTAGGAGG + Intergenic
1058327698 9:103718744-103718766 GTTCTTGGCTGGGATTTTTAAGG + Intergenic
1059889203 9:118782495-118782517 TTGCTTACCTAGTATTTAGAGGG + Intergenic
1060681210 9:125566849-125566871 TTTCTTGTCTGGAGTTTAGAGGG - Intronic
1187204666 X:17170716-17170738 TTTCTGGGGAAAGATTTAGATGG + Intergenic
1188562977 X:31491041-31491063 TTTTCTGGTTAAGATTTAGATGG - Intronic
1193451877 X:81680768-81680790 TTTCTAGGCCATGATTTAGGAGG - Intergenic
1194157329 X:90407026-90407048 TTTTTTTGCTAGGATTTTTATGG + Intergenic
1194718859 X:97317372-97317394 TCTCTTGCCTAGGAAATAGAAGG + Intronic
1196360573 X:114850910-114850932 TCTCTTGGATAGTGTTTAGATGG - Intronic
1199232865 X:145459412-145459434 TTTCCTGCCCAGGATGTAGAAGG + Intergenic
1200503661 Y:3984018-3984040 TTTTTTTGCTAGGATTTGTATGG + Intergenic