ID: 972637099

View in Genome Browser
Species Human (GRCh38)
Location 4:40893996-40894018
Sequence TAGATTATGAGGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 0, 2: 10, 3: 83, 4: 693}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972637093_972637099 27 Left 972637093 4:40893946-40893968 CCTGGGAGACACAGCGAGACTCC 0: 144
1: 2574
2: 41658
3: 101024
4: 147599
Right 972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG 0: 1
1: 0
2: 10
3: 83
4: 693
972637094_972637099 6 Left 972637094 4:40893967-40893989 CCATCTCAACAACAACAACAAAA 0: 248
1: 801
2: 2071
3: 4027
4: 116398
Right 972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG 0: 1
1: 0
2: 10
3: 83
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972637099 Original CRISPR TAGATTATGAGGGCCGGGCG CGG Intronic
900196596 1:1379600-1379622 AAAATTAAGAAGGCCGGGCGCGG + Intergenic
900273866 1:1810353-1810375 TATTTTTTGTGGGCCGGGCGCGG - Intronic
900283280 1:1885846-1885868 AAGATTAAGTGGGCCGGGCACGG - Intronic
901100249 1:6714447-6714469 TGGATTATTTCGGCCGGGCGCGG - Intergenic
901158652 1:7157867-7157889 CACATTTTGGGGGCCGGGCGCGG + Intronic
901617573 1:10553997-10554019 TACAAAATGTGGGCCGGGCGCGG + Intronic
902081742 1:13825718-13825740 TTGATTGTGGAGGCCGGGCGCGG - Intergenic
902629732 1:17697428-17697450 TAGAGCACGAGAGCCGGGCGTGG - Exonic
903064429 1:20690975-20690997 TAGCTGATGGTGGCCGGGCGTGG - Intronic
903379494 1:22886914-22886936 TAGACTTTGCTGGCCGGGCGCGG - Intronic
903463945 1:23539110-23539132 TAGATTAGTGGGGCTGGGCGTGG + Intergenic
903874307 1:26462309-26462331 TAGAATATGACGGCCAGGCATGG - Intronic
903940286 1:26925248-26925270 TAAATTTAGAAGGCCGGGCGCGG + Intronic
904106709 1:28090732-28090754 TAGATTGTGGGGGCCGGGCGTGG - Intergenic
904219639 1:28955632-28955654 TAGATCATCAGGGCTGGGCGTGG - Intronic
904583083 1:31562340-31562362 AAGATAATCAGGGCCGGGCGCGG - Intergenic
904779439 1:32934388-32934410 TGCAATCTGAGGGCCGGGCGAGG + Intergenic
904853326 1:33475956-33475978 GAGAGAAAGAGGGCCGGGCGCGG - Intronic
905054950 1:35085335-35085357 AATAATATGGGGGCCGGGCGCGG - Intronic
905136628 1:35805587-35805609 TAGAGTATGGTGGCCGGGCATGG + Intergenic
905215468 1:36404077-36404099 TAAAATATGTTGGCCGGGCGCGG - Intergenic
905305770 1:37016922-37016944 AAGATGTTGAGGGCCAGGCGCGG + Intronic
905439603 1:37986519-37986541 GGGCATATGAGGGCCGGGCGCGG + Intronic
905746936 1:40426182-40426204 AACATTATGAGGGCCAGGGGTGG - Intergenic
905781514 1:40714788-40714810 AAAATTTTGAGGGCAGGGCGTGG + Intronic
906234277 1:44194954-44194976 TTTAATATCAGGGCCGGGCGCGG + Intergenic
907263141 1:53237237-53237259 AAGATGTTGGGGGCCGGGCGCGG - Intronic
907365514 1:53955916-53955938 AAGATTATGTTGGCCGGGCGCGG - Intronic
907976423 1:59435498-59435520 TAGAGCATGAGGGGCGGGCAAGG - Intronic
908341698 1:63187384-63187406 TAAAAAATCAGGGCCGGGCGTGG + Intergenic
908380072 1:63589438-63589460 GAAATAATGAGGGCCGGGTGTGG + Intronic
908687284 1:66735528-66735550 GAGATCGTGTGGGCCGGGCGCGG + Intronic
909660618 1:78077896-78077918 TAGTGTATCACGGCCGGGCGCGG + Intronic
911076512 1:93880492-93880514 AAGATCAGGAGGGCTGGGCGAGG - Intergenic
911347256 1:96711915-96711937 TAGATTGTTGGGGCTGGGCGCGG + Intergenic
911729252 1:101275652-101275674 TAGATAATCAGGGCTGGGCATGG - Intergenic
911789212 1:101990693-101990715 TAGTTCATGGTGGCCGGGCGCGG + Intronic
911849694 1:102802623-102802645 TCTATAAAGAGGGCCGGGCGTGG + Intergenic
911864983 1:103006816-103006838 TAAGTGATAAGGGCCGGGCGCGG - Intronic
912092353 1:106095278-106095300 AAGAATGTGTGGGCCGGGCGTGG - Intergenic
912388840 1:109287577-109287599 TAAATTTTGTGGGCCGGGTGCGG - Intergenic
912836589 1:113001744-113001766 AAGATGAAGAGGGCCAGGCGTGG - Intergenic
915358974 1:155274086-155274108 AAGTTTACTAGGGCCGGGCGCGG + Intronic
916347559 1:163811174-163811196 AACATTATGAGGGCCAGGTGAGG + Intergenic
916715940 1:167446701-167446723 CAGATAATGGGGGCCAGGCGCGG + Intronic
916845407 1:168645107-168645129 TAGATCAAGAGGGTCGGGGGAGG + Intergenic
917330524 1:173875615-173875637 TATATAATGCAGGCCGGGCGCGG - Intronic
917422407 1:174878513-174878535 TTGATTTTGGGGGCCGGGCGTGG - Intronic
918023841 1:180722382-180722404 AACATTTTAAGGGCCGGGCGCGG - Intronic
918055678 1:181019870-181019892 AAGAGTATGTAGGCCGGGCGCGG + Intronic
918076784 1:181176663-181176685 AAGATAATGTGGGCCGGGTGTGG + Intergenic
918432814 1:184479911-184479933 TAAAGAATGAGGGCCGGGTGTGG - Intronic
918914899 1:190622728-190622750 TAGAGTCTATGGGCCGGGCGCGG + Intergenic
919218634 1:194595708-194595730 TATTTTGTGATGGCCGGGCGCGG + Intergenic
919700209 1:200623853-200623875 AAGAAAATTAGGGCCGGGCGCGG - Intergenic
919897941 1:202021044-202021066 TCTATTATGAGGGCCTGGGGTGG + Intergenic
920047399 1:203142292-203142314 TGCACTATGAGGGCAGGGCGTGG + Intronic
921328143 1:214008343-214008365 TAAAATATGAGGGCTGAGCGCGG - Intronic
922459447 1:225803594-225803616 TAGAATAGGAGGGCCGGGCGTGG - Intergenic
922489056 1:226000555-226000577 TAGATTGTACTGGCCGGGCGCGG + Intergenic
924522689 1:244818914-244818936 CAGCTTATGTGGGCCAGGCGTGG + Intergenic
924578032 1:245298175-245298197 TAGAACATTAGGGCTGGGCGCGG - Intronic
924813001 1:247419443-247419465 AAAATTATTACGGCCGGGCGCGG - Intronic
1063575087 10:7254529-7254551 AAGATTCTGGGGGCCAGGCGCGG + Intronic
1064024939 10:11840634-11840656 TAGATAGTGGGGGCCAGGCGCGG + Intronic
1064616237 10:17160759-17160781 GAGGTTTTGTGGGCCGGGCGCGG - Intronic
1064818292 10:19292600-19292622 TAAATAATGCAGGCCGGGCGGGG + Intronic
1065705261 10:28466486-28466508 TTGATTTTGTAGGCCGGGCGCGG + Intergenic
1066334186 10:34459459-34459481 AAGAAAATGAGGGCCGGGTGTGG - Intronic
1066388497 10:34960548-34960570 AAGGTTTTGTGGGCCGGGCGTGG - Intergenic
1066423520 10:35283791-35283813 TAGCTTAATTGGGCCGGGCGAGG + Intronic
1066632761 10:37472747-37472769 TAGAATAAGTGGGCCGGGCACGG + Intergenic
1067347809 10:45449883-45449905 TAGAATAAGTTGGCCGGGCGCGG - Intergenic
1067358538 10:45554762-45554784 TATAAAATTAGGGCCGGGCGTGG + Intronic
1067488205 10:46672602-46672624 TACCTGATGAGGGCCAGGCGTGG - Intergenic
1067520220 10:46994622-46994644 AAGAGCATCAGGGCCGGGCGCGG - Intronic
1067606596 10:47669426-47669448 TACCTGATGAGGGCCAGGCGTGG + Intergenic
1068358404 10:55942594-55942616 TAGAATAAGTCGGCCGGGCGCGG - Intergenic
1068635544 10:59344250-59344272 TAGTTTATAGAGGCCGGGCGCGG - Intronic
1068702004 10:60030430-60030452 TAAAAGTTGAGGGCCGGGCGTGG - Intronic
1068892680 10:62164073-62164095 TATATTATGAGGGCTAGGCATGG - Intergenic
1069169251 10:65204590-65204612 TAGATAGATAGGGCCGGGCGCGG + Intergenic
1069446226 10:68475471-68475493 AAGAAATTGAGGGCCGGGCGTGG - Intergenic
1070371256 10:75784407-75784429 TAGATAATGCTGGCCGGGTGCGG + Intronic
1070431629 10:76345360-76345382 AAGGTTTTGTGGGCCGGGCGCGG - Intronic
1071000383 10:80824598-80824620 TAAAGAATAAGGGCCGGGCGCGG - Intergenic
1071348586 10:84716585-84716607 TATATTATGCAGGCCGGGCGCGG - Intergenic
1071622164 10:87130778-87130800 TACCTGATGAGGGCCAGGCGTGG + Intronic
1072064728 10:91855459-91855481 AAGAATATGAGGGCTGGGCATGG - Intronic
1072583745 10:96763388-96763410 GAGATAATGCAGGCCGGGCGCGG + Intergenic
1073429103 10:103474743-103474765 AAGATGAGGGGGGCCGGGCGTGG - Intronic
1073787117 10:106901751-106901773 TAGATTTTACTGGCCGGGCGAGG + Intronic
1073794891 10:106976619-106976641 TAGATGATGGCAGCCGGGCGCGG - Intronic
1073838351 10:107470058-107470080 TTCTTCATGAGGGCCGGGCGTGG + Intergenic
1075126459 10:119703934-119703956 TAGAATATGTTGGCAGGGCGTGG - Intergenic
1075752660 10:124786214-124786236 AAGAATTTCAGGGCCGGGCGTGG + Intronic
1075992555 10:126850131-126850153 CAGAATGTGATGGCCGGGCGCGG + Intergenic
1076387928 10:130071912-130071934 TAGAATATGACGGCCAGGCGCGG - Intergenic
1077079005 11:714950-714972 AAGAGTTTGTGGGCCGGGCGCGG + Intronic
1077424788 11:2469948-2469970 TTGTTTAAAAGGGCCGGGCGTGG - Intronic
1077582647 11:3426735-3426757 GAGAGAATGAGGGCCGGGCGTGG + Intergenic
1077623450 11:3749016-3749038 TAAATTAAGAGGGCCGGGCGCGG + Intronic
1078716655 11:13846276-13846298 AATGCTATGAGGGCCGGGCGCGG + Intergenic
1078942929 11:16029345-16029367 TGTCTAATGAGGGCCGGGCGTGG + Intronic
1079235841 11:18689582-18689604 GAGCCTATGTGGGCCGGGCGTGG + Intergenic
1079449412 11:20586599-20586621 AAGCTTAAGAGGGCCGGGCACGG + Intergenic
1080222400 11:29921283-29921305 TAATTTATGTGGGCTGGGCGTGG - Intergenic
1080313714 11:30924780-30924802 TAGATTAATTCGGCCGGGCGCGG + Intronic
1081020397 11:37940502-37940524 ATGCTTATTAGGGCCGGGCGCGG + Intergenic
1081841689 11:46206547-46206569 TAGTTTATCTGGGCCGGGTGTGG - Intergenic
1082082365 11:48022171-48022193 AAGATGATGAAGTCCGGGCGCGG + Intronic
1083312488 11:61791550-61791572 TAGAAATTGAGGGCCAGGCGCGG - Intronic
1083577949 11:63805999-63806021 TGAAATATGGGGGCCGGGCGTGG - Intergenic
1084062182 11:66683354-66683376 TGGATTACTTGGGCCGGGCGCGG - Intergenic
1084132571 11:67147965-67147987 TCTCTAATGAGGGCCGGGCGTGG - Intronic
1084256573 11:67946962-67946984 TAGAACAAGAGGGCCGGGCATGG - Intergenic
1084628355 11:70327479-70327501 TTGATCATGAATGCCGGGCGTGG + Intronic
1084832875 11:71783290-71783312 GAGAGAATGAGGGCCGGGCATGG - Intergenic
1085002843 11:73056790-73056812 TAGATTGACAAGGCCGGGCGCGG + Intronic
1085805718 11:79634037-79634059 AAGAGAATGAGGGCTGGGCGCGG - Intergenic
1086104723 11:83134862-83134884 TAGACTGTGTGGGCCGGGTGCGG + Intergenic
1086190666 11:84074816-84074838 TAGAAACTGTGGGCCGGGCGCGG - Intronic
1087453638 11:98355047-98355069 TATATTTTTAGGGCCGGGTGTGG + Intergenic
1087772214 11:102222952-102222974 TATTTTTTTAGGGCCGGGCGCGG + Intronic
1087889963 11:103526802-103526824 AAAATCAAGAGGGCCGGGCGTGG - Intergenic
1089274139 11:117322402-117322424 TGCATAATGTGGGCCGGGCGCGG - Intronic
1089497463 11:118914845-118914867 CTGAGTTTGAGGGCCGGGCGCGG + Intronic
1090743129 11:129684467-129684489 AACATTATAATGGCCGGGCGTGG - Intergenic
1091510804 12:1123702-1123724 TACATAAAGCGGGCCGGGCGCGG + Intronic
1092410238 12:8247195-8247217 AAGAGAATGAGGGCCGGGCATGG + Intergenic
1093121176 12:15273429-15273451 AAGAATATTACGGCCGGGCGCGG - Intronic
1093257437 12:16887229-16887251 ATAATAATGAGGGCCGGGCGCGG - Intergenic
1093394966 12:18669956-18669978 AAGAGGAAGAGGGCCGGGCGCGG - Intergenic
1094012434 12:25823487-25823509 TAAATTATTGGGGCCGGGTGCGG - Intergenic
1094401772 12:30069737-30069759 TAGAGCAGGAAGGCCGGGCGTGG + Intergenic
1094588703 12:31801129-31801151 AAGATTGTGGGGGCCGGGCACGG + Intergenic
1094613072 12:32012217-32012239 AAGTTAATGAAGGCCGGGCGCGG - Intergenic
1097050180 12:56218242-56218264 TAATTTATGTGGGCCAGGCGCGG - Intronic
1097713272 12:62938095-62938117 TAAAAAAAGAGGGCCGGGCGCGG + Intergenic
1098269826 12:68759017-68759039 TAGAAAGAGAGGGCCGGGCGCGG - Intronic
1098427195 12:70378244-70378266 TAGAGCTTGAAGGCCGGGCGCGG - Intronic
1098785040 12:74742983-74743005 AAAACCATGAGGGCCGGGCGCGG + Intergenic
1098869613 12:75802259-75802281 AAGGACATGAGGGCCGGGCGTGG + Intergenic
1099161685 12:79249392-79249414 GAGGTAAAGAGGGCCGGGCGCGG - Intronic
1099169880 12:79350540-79350562 TGCATCCTGAGGGCCGGGCGCGG - Intronic
1099605933 12:84801050-84801072 AAAATTAACAGGGCCGGGCGTGG - Intergenic
1099791875 12:87346279-87346301 TACATGATTAGGGCCGGCCGCGG + Intergenic
1100149034 12:91712938-91712960 TAGATATTCAGGGCCGGGCACGG - Intergenic
1100536850 12:95519720-95519742 TACAGATTGAGGGCCGGGCGCGG - Intronic
1101146419 12:101844911-101844933 AAGATGGTGAGGGCCGGACGTGG - Intergenic
1101487309 12:105178079-105178101 TATATTCTGAAGGCCTGGCGCGG - Intronic
1102674314 12:114646273-114646295 TAGACAACCAGGGCCGGGCGCGG - Intergenic
1103085017 12:118056155-118056177 TGGATTTTGAGGGCAGGGTGAGG - Intronic
1103267358 12:119642162-119642184 CAGATTATGCTGGCCGGGCGTGG + Exonic
1103476958 12:121225699-121225721 TAAATATTCAGGGCCGGGCGTGG - Intronic
1103643636 12:122373132-122373154 AAGTTAATAAGGGCCGGGCGTGG + Intronic
1104011505 12:124933779-124933801 TAGATTATGAAGTCCGAGTGTGG + Intergenic
1104636175 12:130438965-130438987 GAGAGGATGAGGGGCGGGCGGGG - Intronic
1105016782 12:132790755-132790777 AAGTTAAAGAGGGCCGGGCGCGG + Intronic
1105377076 13:19855550-19855572 AAGATACTGTGGGCCGGGCGCGG - Intronic
1105395196 13:20025611-20025633 AAGAATATGAGGGCAGGGTGTGG - Intronic
1105458455 13:20562516-20562538 AAGATTTTGTAGGCCGGGCGCGG - Intergenic
1105618100 13:22039755-22039777 AAGATAAAGATGGCCGGGCGCGG - Intergenic
1105656333 13:22443718-22443740 AACATCATGAGGGCAGGGCGTGG - Intergenic
1105709596 13:22994615-22994637 AAGAAAATGAAGGCCGGGCGTGG + Intergenic
1106390074 13:29326688-29326710 TAGATTACCAGAGCCAGGCGTGG + Intronic
1106664420 13:31836691-31836713 TATATAAAGAGGGCCGGGCGTGG + Intergenic
1107224649 13:38032636-38032658 TATCTTATGGCGGCCGGGCGCGG - Intergenic
1108496573 13:51031137-51031159 TAGTATTTGAGGGCTGGGCGTGG - Intergenic
1108647484 13:52445347-52445369 TACATAATGCTGGCCGGGCGCGG + Intronic
1109191281 13:59327279-59327301 TATATTAAAAGGGCCAGGCGCGG + Intergenic
1109282880 13:60377526-60377548 TAGATTATTAGGGCCGGGCATGG + Intergenic
1109298573 13:60565343-60565365 AAGATACTGACGGCCGGGCGCGG - Intronic
1109639719 13:65174790-65174812 TAACTTGTGAGGGCCGGGTGCGG + Intergenic
1109980844 13:69903928-69903950 AAGTATGTGAGGGCCGGGCGCGG - Intronic
1110214722 13:73013009-73013031 AATATTAGAAGGGCCGGGCGCGG + Intronic
1111096856 13:83527562-83527584 TAGATGTAGTGGGCCGGGCGCGG + Intergenic
1111290077 13:86155190-86155212 TATAGTATGTCGGCCGGGCGCGG - Intergenic
1111579761 13:90207749-90207771 TAAATTATACAGGCCGGGCGCGG - Intergenic
1111997809 13:95182078-95182100 TAAATGCTGAGGGCCCGGCGTGG - Intronic
1112149096 13:96737333-96737355 GAGATTATTTTGGCCGGGCGCGG + Intronic
1112287177 13:98114455-98114477 TAAATTTTGTGGGCCGGGCGCGG + Intergenic
1112295888 13:98186699-98186721 AAGATGATATGGGCCGGGCGTGG + Intronic
1112303323 13:98250430-98250452 AAAAATATGAGGGCCGGGCACGG + Intronic
1112527089 13:100160210-100160232 AAGATCATGTGGGCCGGGCGCGG + Intronic
1112528606 13:100178785-100178807 TAAAATGTGTGGGCCGGGCGCGG + Intronic
1113120683 13:106920770-106920792 TAGATTTTTGGGGCGGGGCGGGG + Intergenic
1113713539 13:112487839-112487861 AAAAGTATGAGGGCCGGGCATGG + Intronic
1114238102 14:20840136-20840158 TAAAACATGAAGGCCGGGCGCGG - Intergenic
1115175532 14:30558200-30558222 TACAGTTTGAGGGCCGGGCGCGG - Intergenic
1115256473 14:31407916-31407938 TACATTAATAGGGCCGGGCATGG - Intronic
1115492691 14:33973383-33973405 GAGAAATTGAGGGCCGGGCGCGG - Intronic
1115558896 14:34565365-34565387 TAGAATATGTCAGCCGGGCGCGG - Intronic
1115590815 14:34863451-34863473 TAGATGAGCATGGCCGGGCGCGG - Intronic
1115689216 14:35826365-35826387 TAGGTTGTGAGGCCCGGGCCGGG + Exonic
1116315674 14:43389166-43389188 GAGAAGATGACGGCCGGGCGCGG + Intergenic
1116328065 14:43559441-43559463 TAAAATATTGGGGCCGGGCGCGG + Intergenic
1116622288 14:47221396-47221418 GAGATAAAGAGGGCCGGGCACGG + Intronic
1116856463 14:49956646-49956668 TAAATGCTGAGGGCCGGGCACGG + Intergenic
1116894694 14:50304543-50304565 TACAAAATTAGGGCCGGGCGTGG + Intronic
1117057917 14:51931954-51931976 AAGAAAATGTGGGCCGGGCGCGG + Intronic
1117306975 14:54487239-54487261 TACAAAATTAGGGCCGGGCGCGG + Intronic
1117370783 14:55076721-55076743 TATAAAATGAGGGCCGGGCGTGG + Intergenic
1117907110 14:60601730-60601752 TATTTTATGTAGGCCGGGCGCGG + Intergenic
1118208149 14:63742589-63742611 AAAATTATAAGGGCCAGGCGTGG - Intergenic
1119031022 14:71192838-71192860 TAGAAGACTAGGGCCGGGCGTGG - Intergenic
1119104105 14:71907662-71907684 TACAGTATGAGGGCCGGGGTGGG + Intergenic
1119140112 14:72259615-72259637 TGCTTAATGAGGGCCGGGCGCGG + Intronic
1119532529 14:75373020-75373042 TAAGTTATATGGGCCGGGCGTGG - Intergenic
1120124345 14:80723114-80723136 AAGATAAAGAGGGCCGGGTGCGG - Intronic
1120857076 14:89222104-89222126 AAGATTGTGTAGGCCGGGCGCGG - Intronic
1120882736 14:89426939-89426961 TAGAAGAGGAGGGCCGGGCGCGG + Intronic
1120888700 14:89472428-89472450 TAGATTGTGCAGGCCGGGCGCGG + Intronic
1121186912 14:91981304-91981326 TATATTATTTGGGCCGGGTGCGG - Intronic
1121360327 14:93252017-93252039 TTGATAATCAGGGCCGGGCGTGG + Intronic
1122223579 14:100258641-100258663 AAACTCATGAGGGCCGGGCGTGG - Intronic
1123720480 15:23056660-23056682 TGGATTATGTGGGCCGGGTGTGG + Intergenic
1123896205 15:24832813-24832835 AAGATGATGGAGGCCGGGCGCGG + Intronic
1123914763 15:25012737-25012759 TAAATTTTATGGGCCGGGCGTGG - Intergenic
1124362549 15:29048643-29048665 TAGTGTATGATGGCTGGGCGGGG + Intronic
1125643073 15:41247680-41247702 TAAATAAATAGGGCCGGGCGCGG + Intronic
1125704902 15:41725541-41725563 TAAATAAGTAGGGCCGGGCGCGG + Intronic
1125853320 15:42924980-42925002 TTGTTTATGGGGGCCGGGTGTGG - Intergenic
1125871917 15:43109821-43109843 ATTATTCTGAGGGCCGGGCGCGG - Intronic
1125923810 15:43544886-43544908 TGGATTATTGGGGCCGGGCGTGG + Intronic
1126741828 15:51785120-51785142 TACTTTATTTGGGCCGGGCGCGG + Intronic
1127389878 15:58496973-58496995 TACTTTAAAAGGGCCGGGCGCGG - Intronic
1127443797 15:59039252-59039274 TAGAATATCAAGGCCGGGAGTGG - Intronic
1127543714 15:59969125-59969147 AAGAATTTAAGGGCCGGGCGCGG + Intergenic
1127682928 15:61315080-61315102 TAGAGTTTGAAGGCCGAGCGTGG + Intergenic
1127719872 15:61689028-61689050 TTCACTATGTGGGCCGGGCGCGG - Intergenic
1128134614 15:65253618-65253640 AAGAGAATGAAGGCCGGGCGCGG - Intronic
1129127791 15:73459520-73459542 TATTTAATTAGGGCCGGGCGCGG - Intronic
1129292952 15:74582456-74582478 AAGATTATGGTGGCTGGGCGCGG - Intronic
1129362294 15:75031434-75031456 AAAATTAACAGGGCCGGGCGCGG + Intronic
1129384401 15:75187994-75188016 TAAAAAATGAGGGCCGGGCACGG - Intergenic
1129835946 15:78705683-78705705 AAGATGGTGGGGGCCGGGCGCGG - Intronic
1130037527 15:80375231-80375253 TAAATATTTAGGGCCGGGCGCGG - Exonic
1130635046 15:85610683-85610705 TAGAGCTTAAGGGCCGGGCGTGG + Intronic
1131208837 15:90475425-90475447 AAGCTTATGATGGCCGGGCATGG - Intronic
1131781506 15:95864663-95864685 TAGACTAAGAGGGCCAGGTGCGG + Intergenic
1131781598 15:95865701-95865723 AAGAGTAAGAGGGCCAGGCGTGG + Intergenic
1132362636 15:101230216-101230238 TAGGGTATTAGGGCCGGGCGTGG - Intronic
1132821285 16:1872455-1872477 AATATTATGAAGGGCGGGCGCGG + Intronic
1132931929 16:2463029-2463051 TAGCATGTGAGGGCCGGGCGCGG + Intronic
1133176274 16:4017352-4017374 TAGATAATGTGGGCCAGGCATGG + Intronic
1133351231 16:5101991-5102013 AAGAGAATGAGGGCCGGGCATGG + Intergenic
1133522739 16:6574715-6574737 TAGAAGATACGGGCCGGGCGCGG - Intronic
1133993130 16:10726377-10726399 AATATAATGGGGGCCGGGCGCGG - Intergenic
1134176914 16:12014440-12014462 GAAATTATCAGAGCCGGGCGCGG + Intronic
1134586956 16:15419856-15419878 AAGAAAATGTGGGCCGGGCGCGG - Intronic
1134630304 16:15751451-15751473 ATGATGATGATGGCCGGGCGCGG - Intronic
1134931249 16:18209752-18209774 TAAATTAACTGGGCCGGGCGTGG + Intergenic
1135028719 16:19019138-19019160 TAGATAATCCTGGCCGGGCGTGG - Intronic
1135641938 16:24127294-24127316 AAGAATATCATGGCCGGGCGTGG - Intronic
1135675081 16:24408238-24408260 TAGTTAATGATGGCCAGGCGCGG - Intergenic
1136184603 16:28579544-28579566 AAGATAATTAGGGCCGGGCGTGG - Intronic
1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG + Intronic
1138358999 16:56410589-56410611 ATTATAATGAGGGCCGGGCGTGG + Intronic
1140107835 16:71977031-71977053 AAAATTTTGTGGGCCGGGCGCGG - Intronic
1140172291 16:72618322-72618344 AAGATTCTGAGGGCCGGGCGCGG - Intergenic
1141342443 16:83215367-83215389 TAAACTATGTGGGCCGGGCGTGG - Intronic
1142015462 16:87743986-87744008 TAGAATTTGAGGGCCAGGCGTGG + Intronic
1142587722 17:984574-984596 CACATGATGTGGGCCGGGCGCGG + Intergenic
1142598893 17:1043457-1043479 TAAATTTTAGGGGCCGGGCGCGG - Intronic
1142905494 17:3038595-3038617 TAAAAAATCAGGGCCGGGCGTGG + Intergenic
1143237839 17:5418540-5418562 AGAATTATGAAGGCCGGGCGCGG - Intronic
1143559193 17:7682081-7682103 GAAATAATGAGGGCCGGGTGCGG - Intronic
1143606675 17:7990623-7990645 TAGAGTACACGGGCCGGGCGCGG + Intergenic
1144015563 17:11192036-11192058 TTTGTTAAGAGGGCCGGGCGCGG + Intergenic
1144563017 17:16337333-16337355 TAGCTTAGCAGGGCCGGGCGTGG - Intronic
1144569479 17:16387111-16387133 AAGGTAATGGGGGCCGGGCGCGG + Intergenic
1144726941 17:17506862-17506884 TAGGTGTTGAGGGCTGGGCGGGG - Intronic
1145121685 17:20266291-20266313 TAGGTGCTGGGGGCCGGGCGCGG + Intronic
1146390872 17:32421812-32421834 AAGATGATGAGGGCTGGGCACGG - Intergenic
1146932251 17:36785590-36785612 TAGTTTAAGAGTGCCGGGCTGGG + Intergenic
1147002866 17:37377366-37377388 TCTTTTTTGAGGGCCGGGCGTGG + Intronic
1147252205 17:39159585-39159607 TAGAAAATGATGGCGGGGCGCGG - Intronic
1147297102 17:39492697-39492719 AAGAAAATGAAGGCCGGGCGCGG - Intronic
1147687257 17:42293922-42293944 TAGATAGAGAGGGCCAGGCGTGG + Intronic
1147693160 17:42330717-42330739 GAGAAAATGTGGGCCGGGCGCGG - Intronic
1147813089 17:43187468-43187490 TAGATGTTGGAGGCCGGGCGCGG - Intronic
1147877373 17:43631332-43631354 AAGAATATAAGGGCCGGGTGCGG - Intergenic
1148028787 17:44606059-44606081 AAGATGAAGTGGGCCGGGCGTGG - Intergenic
1148878891 17:50709887-50709909 TAGACTTTGGGGGCCGGGCGCGG - Intergenic
1149186591 17:54005054-54005076 AATGTTATGGGGGCCGGGCGCGG - Intergenic
1149688479 17:58553331-58553353 GAGTTTATGCAGGCCGGGCGCGG + Intergenic
1149915897 17:60609035-60609057 TACATAATAAAGGCCGGGCGCGG - Intronic
1150196733 17:63306662-63306684 AAAATTATGGGGGCCGGGCATGG + Intronic
1150526078 17:65924264-65924286 TAAATTATGCTGGCCGGGCACGG - Intronic
1151046499 17:70926054-70926076 TGTATTTTGAGGGCCGGGAGCGG + Intergenic
1151138271 17:71968319-71968341 TAGAATAAAAGGGCTGGGCGTGG + Intergenic
1151291010 17:73149999-73150021 AAGTTTTTGGGGGCCGGGCGCGG + Intergenic
1151333684 17:73426794-73426816 TAGCCTATGGGGGCCGGGCGCGG + Intronic
1151374009 17:73671473-73671495 TAAATTATAGAGGCCGGGCGCGG + Intergenic
1151835879 17:76582457-76582479 AAGAATATGAAGGCCGGGCATGG - Intronic
1151940794 17:77290535-77290557 TAAATTCTTAGGGCCGGGAGCGG + Intronic
1152086168 17:78220136-78220158 TAGACTTTCAGGGCCGGGCATGG + Intronic
1152098014 17:78283555-78283577 TGAATTTGGAGGGCCGGGCGTGG - Intergenic
1152712749 17:81882130-81882152 TAGAGATTGAGGGCCAGGCGCGG + Intergenic
1154087617 18:11322665-11322687 TAGGTTTTGTTGGCCGGGCGTGG - Intergenic
1154200561 18:12297044-12297066 AAGGTTATGGGGGCCGGGAGCGG + Intergenic
1154247234 18:12709924-12709946 AAGTTTATGAGGGCTGGGCGTGG - Intronic
1154933664 18:21028049-21028071 AAAATTAAGTGGGCCGGGCGCGG - Intronic
1154952271 18:21221943-21221965 TATGATATGAGGGCCGGGCACGG - Intergenic
1155180062 18:23337181-23337203 TACATTATTTAGGCCGGGCGCGG + Intronic
1155278405 18:24212346-24212368 AAGTTTTTGAAGGCCGGGCGTGG - Intronic
1155287169 18:24301936-24301958 TAGTTAATCATGGCCGGGCGTGG + Intronic
1155465676 18:26132975-26132997 AATATTATCTGGGCCGGGCGCGG + Intergenic
1155487200 18:26358418-26358440 GATAATATTAGGGCCGGGCGAGG + Intronic
1156203589 18:34861193-34861215 TAGCTTTTAACGGCCGGGCGCGG + Intronic
1156365833 18:36426192-36426214 TAGTGTGTGAAGGCCGGGCGCGG - Intronic
1157135320 18:45048680-45048702 TAGAAGATTAGGGCCGGGCGCGG + Intronic
1159061325 18:63517775-63517797 AATTTTATTAGGGCCGGGCGCGG + Intergenic
1159135417 18:64331730-64331752 TAGGTTATGAGAGCTGGGCCAGG - Intergenic
1159242438 18:65759540-65759562 AAGATAATGGGGGCCGGGTGTGG - Intronic
1159322842 18:66876003-66876025 TATAATATGTTGGCCGGGCGCGG - Intergenic
1159931646 18:74318498-74318520 CAGCTTAAGAGGGCCGGGCGTGG + Intronic
1160300769 18:77676091-77676113 AAGAATTTGGGGGCCGGGCGCGG + Intergenic
1160757872 19:767130-767152 TTTAGGATGAGGGCCGGGCGTGG - Intergenic
1160787327 19:907103-907125 TGTATAATGAGGGCCGGGCGTGG - Intronic
1160925809 19:1545019-1545041 AAAATTATGAGGGCTGGGTGCGG + Intergenic
1161335340 19:3709857-3709879 GGGATATTGAGGGCCGGGCGCGG + Intronic
1161449427 19:4336601-4336623 AAGATAATGGGGGCCGGGCGTGG - Intronic
1162040947 19:7970850-7970872 TAGATGAGGATGGCCGGGCGCGG - Intronic
1162064188 19:8115143-8115165 TTGATTCTCTGGGCCGGGCGCGG - Intronic
1162591083 19:11592139-11592161 TAGAGTATCTGGGCCAGGCGTGG - Intronic
1162675985 19:12298697-12298719 AAGACAATGTGGGCCGGGCGCGG + Intergenic
1163084606 19:14970419-14970441 TATAGTATAATGGCCGGGCGGGG + Intronic
1163247667 19:16107241-16107263 TAGCTCTTGAGGGCCGGGCGCGG - Intergenic
1163261528 19:16193490-16193512 TAGGCTATGTAGGCCGGGCGTGG - Intergenic
1163461804 19:17442966-17442988 AATATTTTGAGGGCCTGGCGTGG + Intronic
1163505159 19:17701379-17701401 AAAATAAAGAGGGCCGGGCGCGG + Intergenic
1163728569 19:18936697-18936719 TAAATTGTTGGGGCCGGGCGCGG + Intronic
1164557885 19:29267545-29267567 AAAATAATGAGGGCCAGGCGCGG - Intergenic
1164630446 19:29758371-29758393 TAGGTTATGTGGGCTGAGCGTGG + Intergenic
1165736150 19:38177069-38177091 TAGTTTAGCTGGGCCGGGCGCGG + Intronic
1166186797 19:41145025-41145047 TAAATTAAATGGGCCGGGCGTGG - Intergenic
1167005274 19:46772133-46772155 TGGACTATGCTGGCCGGGCGCGG - Intronic
1167120889 19:47515683-47515705 TAGCTGAAGAGGGCCGGGCACGG + Intergenic
1167212507 19:48142145-48142167 TACAAAATTAGGGCCGGGCGCGG + Intronic
1167534828 19:50043142-50043164 AAGAATATGGGGGCCAGGCGTGG + Intronic
1167551475 19:50163734-50163756 AACAATATGTGGGCCGGGCGTGG - Intergenic
1167685633 19:50954210-50954232 AAGATGATCATGGCCGGGCGCGG + Intergenic
1167938501 19:52926752-52926774 TAAAAAAAGAGGGCCGGGCGCGG - Intergenic
1167969813 19:53182075-53182097 TAAGTAATGAAGGCCGGGCGCGG + Intronic
1167997966 19:53421802-53421824 TAAATTATCATGGCTGGGCGTGG - Intronic
1168042510 19:53769678-53769700 AAGAGAATGATGGCCGGGCGCGG - Intergenic
1168399823 19:56079136-56079158 TAAAAAATGAAGGCCGGGCGCGG + Intergenic
1168528133 19:57104973-57104995 TAGAAAATCAGGGCCGGGCGCGG - Intergenic
926367647 2:12147551-12147573 TAAATCATGAAGGCCGGGCATGG - Intergenic
927462657 2:23312560-23312582 TAGACCATGCGGGCCGGGTGCGG + Intergenic
927629784 2:24763247-24763269 TAGAAATTGTGGGCCGGGCGCGG + Intronic
927805432 2:26142698-26142720 TGTATTATAAGGGCTGGGCGTGG + Intergenic
928150942 2:28828275-28828297 CACAAGATGAGGGCCGGGCGTGG - Intronic
928564504 2:32530498-32530520 TGGAATATAAGGGCCGGGTGCGG - Intronic
928684311 2:33732381-33732403 AAGAATATGACGGCCGGGCGCGG - Intergenic
929648238 2:43651355-43651377 TGAAATTTGAGGGCCGGGCGCGG - Intronic
930519636 2:52448744-52448766 TAATGCATGAGGGCCGGGCGCGG + Intergenic
930805495 2:55485334-55485356 AAAATTACAAGGGCCGGGCGCGG + Intergenic
931383486 2:61775314-61775336 CACATTGTGAGGGCCGGGTGTGG - Intergenic
932267036 2:70376624-70376646 AAGAAAATGTGGGCCGGGCGCGG - Intergenic
932532568 2:72551784-72551806 AAGATTTTAATGGCCGGGCGCGG - Intronic
932981505 2:76673764-76673786 TAGATAAGCACGGCCGGGCGCGG - Intergenic
933022811 2:77216374-77216396 TACAGTATTTGGGCCGGGCGCGG + Intronic
933029343 2:77307188-77307210 AAAAATATGGGGGCCGGGCGCGG - Intronic
933382410 2:81566558-81566580 TATAATATGCAGGCCGGGCGCGG + Intergenic
933479224 2:82834159-82834181 TAAATGATTTGGGCCGGGCGCGG + Intergenic
933670929 2:85006587-85006609 AAGAAAATGAGGGCCGGGCGCGG - Intronic
934666992 2:96178875-96178897 TTGAATATGTGAGCCGGGCGTGG - Intergenic
934779160 2:96958358-96958380 TAGATTATTCAGGCCGGACGTGG - Intronic
934932921 2:98443117-98443139 TTGATTATGACTGCCAGGCGTGG + Intergenic
935252489 2:101275729-101275751 AATACTAGGAGGGCCGGGCGCGG - Intronic
935555619 2:104506753-104506775 AAGAATATTGGGGCCGGGCGTGG - Intergenic
935850172 2:107210612-107210634 GACAGCATGAGGGCCGGGCGCGG + Intergenic
936551102 2:113440172-113440194 AATATTAAGGGGGCCGGGCGCGG - Intronic
936574667 2:113642914-113642936 CAGATGATTGGGGCCGGGCGCGG - Exonic
936787548 2:116112074-116112096 AAGATAAGGAGGGCCGGGTGCGG + Intergenic
937774740 2:125762997-125763019 TAGAGTCTGAGGGCTGGGTGTGG + Intergenic
937952065 2:127396164-127396186 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
938008982 2:127813192-127813214 AAGATTATAGGGGCTGGGCGTGG - Intergenic
938020845 2:127904725-127904747 TAAATTGTGGGGGCCGGGCTCGG + Intergenic
938316388 2:130332188-130332210 TAAAAAATGAAGGCCGGGCGCGG - Intergenic
939602474 2:144210046-144210068 TATATTATGTGGGCGGGGGGGGG + Intronic
939944004 2:148386426-148386448 TACTTTATGCCGGCCGGGCGCGG + Intronic
940507153 2:154570327-154570349 TAGTCTATTAAGGCCGGGCGCGG - Intergenic
940816426 2:158302493-158302515 ACAATTATGAGGGCCGGGAGCGG + Intronic
940935916 2:159495193-159495215 TTTAATATGAAGGCCGGGCGCGG + Intronic
941329310 2:164159252-164159274 AAAATTATCAGGGCCGGGTGCGG + Intergenic
941819770 2:169832642-169832664 TGCTTTATGGGGGCCGGGCGTGG + Intronic
941875352 2:170426727-170426749 TAGATACTTAGGGCCAGGCGTGG + Intronic
941948088 2:171122252-171122274 TATCTTATTAGGGCCGGGTGCGG - Intronic
942170751 2:173287306-173287328 AAGTTAAAGAGGGCCGGGCGCGG - Intergenic
942437613 2:175998031-175998053 TAAAGTATTTGGGCCGGGCGTGG - Intronic
942517272 2:176767248-176767270 AAGAATATGTCGGCCGGGCGCGG + Intergenic
943860450 2:192855422-192855444 TGAATGATGTGGGCCGGGCGCGG + Intergenic
943911831 2:193578960-193578982 AAAATTGTGGGGGCCGGGCGCGG + Intergenic
944219084 2:197284593-197284615 TACATTATTAGAGCCAGGCGTGG + Intronic
944562288 2:200952549-200952571 TAAATTATATAGGCCGGGCGCGG - Intronic
944925584 2:204460675-204460697 TAGCTGATGAGGGCCGGGCGTGG + Intergenic
945679637 2:212898471-212898493 TAGGTAAAAAGGGCCGGGCGCGG + Intergenic
945916423 2:215709200-215709222 TAGATTATGAGGACTTGGCGTGG - Intergenic
946424926 2:219589259-219589281 TACATTAGGAGGGACGGGCGCGG + Intergenic
946846079 2:223860087-223860109 ATGTTTATGTGGGCCGGGCGTGG - Intronic
946958815 2:224961026-224961048 TTGGTGATGGGGGCCGGGCGCGG - Intronic
947306102 2:228749281-228749303 TAGATTAGTGCGGCCGGGCGCGG + Intergenic
947499238 2:230660162-230660184 TAGAGTAAGTGGGCCAGGCGCGG - Intergenic
947880891 2:233510692-233510714 TAGTGTATGTTGGCCGGGCGCGG - Intronic
948648358 2:239423237-239423259 TGGATTTTGTTGGCCGGGCGCGG + Intergenic
948661955 2:239512882-239512904 TATATTATCTGGGCTGGGCGTGG - Intergenic
949015756 2:241709377-241709399 GAGATGGTGAGGGCGGGGCGGGG + Exonic
1168759227 20:337557-337579 AATATTTTGAGGGCCGGGCGTGG + Intergenic
1169086958 20:2832610-2832632 TAGAATAAAGGGGCCGGGCGTGG - Intergenic
1169164435 20:3409576-3409598 AAGGTTTTGAAGGCCGGGCGCGG - Intergenic
1169316132 20:4592508-4592530 TAGGCTATGAGGGCAGGGGGTGG + Intergenic
1169325398 20:4671448-4671470 AAAATCATGAGGGCCGGGCGCGG + Intergenic
1169588187 20:7110815-7110837 TAGATTTTTAGGGCTGGGGGTGG + Intergenic
1169993285 20:11527228-11527250 TACCTTAAGTGGGCCGGGCGTGG + Intergenic
1170330644 20:15207024-15207046 TAGATAATATGGGCCGGGCGCGG - Intronic
1170849278 20:19989564-19989586 TATTTTCTGAGGGCCAGGCGTGG - Intronic
1170891295 20:20377942-20377964 TAAATTATCAGGGCCAGGTGTGG - Intergenic
1170976594 20:21170676-21170698 TAGTATTTGATGGCCGGGCGTGG - Intronic
1172596027 20:36151809-36151831 TATAAGATGGGGGCCGGGCGCGG + Intronic
1172725390 20:37036554-37036576 TAAATAATGAAGGCCGGGCACGG - Intronic
1172948625 20:38707355-38707377 GAGATAATGCCGGCCGGGCGTGG - Intergenic
1173514339 20:43654462-43654484 AAAACTTTGAGGGCCGGGCGTGG + Intergenic
1173606211 20:44333679-44333701 GAGGATATGAGGGCCTGGCGGGG + Intergenic
1173991969 20:47310505-47310527 CAGATTAGGAGGGCCAGGCACGG + Intronic
1174471043 20:50761038-50761060 TGGATAAGCAGGGCCGGGCGTGG - Intergenic
1174602576 20:51736643-51736665 TACAATGTGAGGGCCAGGCGCGG - Intronic
1174877159 20:54239681-54239703 TAAATAATCAGGGCCAGGCGTGG + Intergenic
1175676422 20:60949950-60949972 TAGATGAACATGGCCGGGCGTGG + Intergenic
1177432887 21:21013489-21013511 TAGTTCACGAGGGCCGGACGTGG + Intronic
1177605269 21:23369914-23369936 AAAATTATCTGGGCCGGGCGCGG + Intergenic
1177865843 21:26512489-26512511 AAGACTCTGTGGGCCGGGCGCGG - Intronic
1178339193 21:31771300-31771322 TAGTTGATGAAGGCCAGGCGCGG - Intergenic
1179777828 21:43678447-43678469 TAGATGTTGGTGGCCGGGCGCGG - Intronic
1180220969 21:46357717-46357739 TTGACTCAGAGGGCCGGGCGTGG - Intronic
1181385398 22:22541652-22541674 TAGATTGATAGGGCCGGGCGCGG + Intergenic
1181736894 22:24889248-24889270 GTGACTATGAGGGCCGGGCACGG - Intronic
1183727620 22:39598285-39598307 TGGAGGATGAGGGCAGGGCGGGG - Intronic
1183765249 22:39867191-39867213 TAGATTTCTCGGGCCGGGCGCGG - Intronic
1184018968 22:41807869-41807891 TAAATAAAAAGGGCCGGGCGCGG + Intronic
1184026889 22:41864608-41864630 AAGATTTTTTGGGCCGGGCGCGG - Intronic
1185266840 22:49908659-49908681 CAGATTGTCCGGGCCGGGCGTGG + Intronic
1185271749 22:49932894-49932916 TAGATAAATAAGGCCGGGCGTGG - Intergenic
1185425506 22:50767962-50767984 CAGATGATTGGGGCCGGGCGCGG + Exonic
950240525 3:11365927-11365949 TAGAACTTGTGGGCCGGGCGCGG + Intronic
951273504 3:20656619-20656641 TAAAATTTGAGGGCCGGGCGCGG + Intergenic
951898127 3:27630536-27630558 AAGATTTTGCTGGCCGGGCGCGG - Intergenic
952030148 3:29131875-29131897 AAGAACATGCGGGCCGGGCGCGG - Intergenic
952143003 3:30500443-30500465 GAGATGATGCAGGCCGGGCGCGG - Intergenic
952334148 3:32390836-32390858 TAAATTAGCTGGGCCGGGCGCGG - Intergenic
952815126 3:37441127-37441149 TGTATTGTTAGGGCCGGGCGCGG - Intergenic
953489765 3:43339525-43339547 TACATTACATGGGCCGGGCGCGG + Intronic
953944343 3:47133457-47133479 AAGAATATGTGGGCCAGGCGTGG + Intronic
954070283 3:48138109-48138131 TTGATTAAGGAGGCCGGGCGCGG + Intergenic
955231912 3:57107086-57107108 AGAATTATGAGGGCCGGGCGCGG + Intronic
955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG + Intergenic
955791674 3:62594449-62594471 ATCATAATGAGGGCCGGGCGCGG - Intronic
955807071 3:62748028-62748050 TACATGAAGATGGCCGGGCGTGG + Intronic
955910496 3:63854716-63854738 AAGAAAAGGAGGGCCGGGCGCGG + Intronic
956175330 3:66467649-66467671 TAGCTAATGTGGGCTGGGCGTGG - Intronic
956480924 3:69673378-69673400 TAGAGAATGAGGGCCAGGCATGG - Intergenic
957418869 3:79942226-79942248 AAGATGACGAAGGCCGGGCGCGG - Intergenic
957766492 3:84632063-84632085 AAGAAAATGGGGGCCGGGCGCGG + Intergenic
957844525 3:85714718-85714740 TAGATAAACAGGGCCAGGCGCGG - Intronic
958069658 3:88593867-88593889 TAGAGTATGAGGGCCGGGCACGG + Intergenic
958501430 3:94914693-94914715 TAGACTATGTGGGCCGGGCGCGG + Intergenic
958908849 3:99971045-99971067 GAGAATATGGGGGCTGGGCGTGG + Intronic
958980318 3:100711389-100711411 TAAAATTTGAGGGCCGGGCACGG - Intronic
959178177 3:102944613-102944635 GAGACTGTTAGGGCCGGGCGTGG + Intergenic
960409924 3:117310238-117310260 TAAATTATCCTGGCCGGGCGCGG - Intergenic
960768074 3:121159920-121159942 TAGAAAATGTCGGCCGGGCGCGG - Intronic
961097089 3:124166746-124166768 TAAATTTGGAGGGCCCGGCGTGG + Intronic
961326929 3:126114540-126114562 CAGATGGTGAGGGCCGGGCCTGG - Exonic
961759058 3:129151866-129151888 TACTTTATCAGGGCCGGGTGTGG + Intronic
963133558 3:141879479-141879501 TACATTTTTGGGGCCGGGCGCGG + Intronic
963155760 3:142094593-142094615 TATAGTTTGAGGGCTGGGCGTGG - Intronic
963690135 3:148488996-148489018 AAGAACTTGAGGGCCGGGCGCGG - Intergenic
963936792 3:151061927-151061949 ATGTTTTTGAGGGCCGGGCGCGG - Intergenic
964108894 3:153068804-153068826 TAGGATTTGAGGGCCGGGCGCGG + Intergenic
964334094 3:155636455-155636477 TAGATTTTGTAGGCCAGGCGCGG + Intronic
964410739 3:156395253-156395275 GACATTGTTAGGGCCGGGCGCGG + Intronic
964851718 3:161103080-161103102 TATATTATTAGAGCCGGGTGAGG + Intronic
965100251 3:164288942-164288964 TATAGTAAGAAGGCCGGGCGCGG - Intergenic
965153575 3:165014537-165014559 TCTATGATGAGGGCCAGGCGTGG - Intronic
965944639 3:174225439-174225461 TAGATTATTCTGGCCGGGCGCGG + Intronic
965950341 3:174300931-174300953 AAGAAAATCAGGGCCGGGCGCGG + Intergenic
966412016 3:179653915-179653937 TAGAATGTCAGGGCCAGGCGCGG + Intronic
966423700 3:179758786-179758808 AAAATTTTAAGGGCCGGGCGCGG - Intronic
966838189 3:184066029-184066051 TACACTATGACGGCCAGGCGCGG + Intergenic
966861803 3:184234679-184234701 CAGAATATGAGGCCCGGGTGAGG + Exonic
967044086 3:185720451-185720473 TAGGCTTTGGGGGCCGGGCGCGG - Intronic
967667517 3:192190763-192190785 AAGAGTATTGGGGCCGGGCGCGG - Intronic
968072679 3:195796371-195796393 TAGTTTATAGTGGCCGGGCGAGG - Intronic
969836397 4:9845718-9845740 TTGATGATCAGGGCCGGGCGCGG - Intronic
971782596 4:31056076-31056098 AAAATAATGAGAGCCGGGCGTGG + Intronic
972218202 4:36921116-36921138 GAGAAAATGTGGGCCGGGCGTGG + Intergenic
972484040 4:39525797-39525819 TAGAAAATGGGGGCCGGGCGTGG - Intronic
972534248 4:39986343-39986365 TAAATAATTAGGGCCGGGCACGG - Intergenic
972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG + Intronic
972812099 4:42601324-42601346 TGGATTTTTAGGGCCAGGCGCGG - Intronic
973267467 4:48225465-48225487 AAGAATGTGAGGGCCGGTCGTGG - Intronic
973984982 4:56341819-56341841 TAGAAGTTGGGGGCCGGGCGTGG + Intronic
974165685 4:58198641-58198663 TAGAGTTTTAAGGCCGGGCGTGG - Intergenic
975551046 4:75612832-75612854 TAGATTTTCTGGGCCGGGAGCGG + Intronic
975688107 4:76937798-76937820 GAGTTTATGTGGGCCGGGCGCGG - Intergenic
976426864 4:84914129-84914151 TAGGTTATTAGGGCCGGGTGTGG + Intronic
976576791 4:86681635-86681657 TATATAATGTAGGCCGGGCGTGG + Intronic
976685791 4:87813116-87813138 TTGAGTATCAGGGCCGGGAGTGG - Intergenic
977122510 4:93120661-93120683 TAGATGATGGGGACTGGGCGCGG + Intronic
977211484 4:94223202-94223224 TTAATAAAGAGGGCCGGGCGTGG + Intronic
977604975 4:98974897-98974919 TAGACAAAAAGGGCCGGGCGCGG - Intergenic
978155203 4:105481903-105481925 TATTTTTTTAGGGCCGGGCGCGG - Intergenic
978229667 4:106384088-106384110 TACATTAAGAGGGCCGGGCGTGG + Intergenic
978327603 4:107576780-107576802 TAGATTATGGGGGCCGGTGGGGG - Intergenic
978404416 4:108364170-108364192 AACATTTTGAGGGCCAGGCGTGG - Intergenic
978431086 4:108634065-108634087 TAGAATTGTAGGGCCGGGCGCGG - Intergenic
978445388 4:108775536-108775558 AAGTTTATAAGGGCCAGGCGTGG - Intergenic
978638568 4:110841386-110841408 AAGAAGATGAGGGCCGGGCGCGG - Intergenic
978814239 4:112885208-112885230 TAAATAAGCAGGGCCGGGCGTGG + Intronic
978818511 4:112936632-112936654 TGGATAATGCTGGCCGGGCGTGG - Intronic
979132100 4:117059813-117059835 TGAATTGTGACGGCCGGGCGCGG - Intergenic
979235027 4:118390083-118390105 TAAATAATGAGGGCCGGGTGCGG - Intergenic
979340492 4:119516907-119516929 AAGAGAATGAGGGCTGGGCGCGG - Intronic
979688963 4:123540608-123540630 GAGATAATAAAGGCCGGGCGCGG - Intergenic
980839459 4:138240274-138240296 TGGAATTTGAGGACCGGGCGCGG + Intronic
981117229 4:141005776-141005798 TATTTTAAAAGGGCCGGGCGCGG + Intronic
982664827 4:158249193-158249215 AAGAATATCAGGGCCGGGCACGG - Intronic
982939497 4:161531912-161531934 TATTTTTAGAGGGCCGGGCGTGG + Intronic
983086424 4:163450500-163450522 TATATTTTGTAGGCCGGGCGCGG - Intergenic
983194344 4:164788774-164788796 TAGAAGAAAAGGGCCGGGCGTGG - Intergenic
983261252 4:165459611-165459633 AAGAAAATGAAGGCCGGGCGTGG + Intronic
983295229 4:165858813-165858835 TACTTCATGTGGGCCGGGCGCGG + Intergenic
983349019 4:166563005-166563027 TACATTATCAGGGTCGGGGGAGG + Intergenic
983690465 4:170463821-170463843 TATATTAAGACGGCCGGGCGCGG + Intergenic
983991730 4:174127970-174127992 TAAATCATGAGAGCCGGGTGTGG - Intergenic
984235554 4:177153461-177153483 TGGCTTTTTAGGGCCGGGCGCGG + Intergenic
984384327 4:179035688-179035710 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984718964 4:182952657-182952679 TGGATGATGAAGGCTGGGCGTGG + Intergenic
985261225 4:188116784-188116806 TTAATAATGTGGGCCGGGCGCGG - Intergenic
985548669 5:522467-522489 TAGATATTCACGGCCGGGCGCGG + Intronic
985619758 5:948037-948059 TGGATTGAGAGGGCGGGGCGGGG + Intergenic
985886574 5:2684807-2684829 AAGATGGTGGGGGCCGGGCGGGG - Intergenic
986713888 5:10508458-10508480 AAGGATATTAGGGCCGGGCGTGG - Intronic
987459088 5:18185309-18185331 CAAAATATGTGGGCCGGGCGCGG + Intergenic
987713163 5:21530543-21530565 AAAATAATGTGGGCCGGGCGCGG - Intergenic
987798833 5:22666578-22666600 AAGATAGAGAGGGCCGGGCGCGG - Intronic
987920490 5:24273467-24273489 TAGAAAGTGTGGGCCGGGCGCGG - Intergenic
988297122 5:29379579-29379601 GAGTAAATGAGGGCCGGGCGCGG - Intergenic
988507507 5:31836726-31836748 TAAATTATGTAGGCTGGGCGAGG + Intronic
988511065 5:31865191-31865213 TAGATTATGAGTCCTGGGGGAGG + Intronic
988549923 5:32191084-32191106 AAAATAATGAAGGCCGGGCGTGG - Intergenic
989026034 5:37069371-37069393 TAGATTCTAGGGGCTGGGCGCGG + Intergenic
989621128 5:43385185-43385207 TTGTTTATCATGGCCGGGCGCGG - Intronic
989761670 5:45023363-45023385 TAGAACATGAGGGCCGGGTGTGG - Intergenic
990311297 5:54541316-54541338 AAGACCAGGAGGGCCGGGCGCGG - Intronic
990465557 5:56068136-56068158 TAAACAAAGAGGGCCGGGCGCGG + Intergenic
990625084 5:57601498-57601520 TAAATTCAGAGGGCCGGGAGTGG + Intergenic
990841951 5:60091760-60091782 AAGAAAATGTGGGCCGGGCGCGG + Intronic
991674470 5:69077220-69077242 TACATTAGGTAGGCCGGGCGCGG + Intergenic
991713886 5:69433746-69433768 CAGATTTTGGGGGCCAGGCGTGG - Intronic
992852708 5:80826837-80826859 AAGATTCTGGAGGCCGGGCGCGG - Intronic
994182602 5:96784202-96784224 TAGATAACTACGGCCGGGCGCGG + Intronic
994195202 5:96915297-96915319 TAAATTATATGGGCTGGGCGCGG - Intronic
995107313 5:108389182-108389204 TATATAATAAGGGCCGGGCATGG - Intergenic
995151309 5:108849899-108849921 CACATTATTAGGGCCAGGCGCGG + Intronic
995379751 5:111518633-111518655 AAGAACAAGAGGGCCGGGCGCGG - Intergenic
995784313 5:115812755-115812777 TAGAAAATGAGGGCTGGGTGTGG + Intronic
996490009 5:124083683-124083705 TTGATGATGAGGGCTGGGTGTGG - Intergenic
996714712 5:126577992-126578014 TGAATTATGCAGGCCGGGCGTGG + Intronic
996812446 5:127532395-127532417 TACCTTAAGATGGCCGGGCGCGG - Intronic
996849973 5:127940737-127940759 TAAAAAATGAGGGCCGGACGCGG - Intergenic
997320021 5:132970314-132970336 TAGCATATTAGGGCCGGGCGCGG + Intergenic
997535171 5:134615056-134615078 GAAATTCTGGGGGCCGGGCGCGG + Intronic
997572477 5:134941826-134941848 AAGATTATGGGGGCTGGGTGTGG + Intronic
997766843 5:136513187-136513209 TAGAATAAGGTGGCCGGGCGTGG + Intergenic
997996921 5:138594339-138594361 TACATTATGAGGGTCTGGAGAGG - Intergenic
998101363 5:139438024-139438046 AACATTATGAGGGCCGGGCGCGG + Intronic
999538752 5:152548862-152548884 AAGATACTGAAGGCCGGGCGCGG + Intergenic
1000470443 5:161633537-161633559 GAAATGAAGAGGGCCGGGCGCGG + Intronic
1000494980 5:161971027-161971049 AAAAAAATGAGGGCCGGGCGGGG - Intergenic
1000694689 5:164366055-164366077 AAAGCTATGAGGGCCGGGCGCGG - Intergenic
1000707224 5:164526728-164526750 AAGTTTAAGAGGGCCGAGCGCGG - Intergenic
1000826964 5:166057089-166057111 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1001079397 5:168656023-168656045 TAAATTTTTATGGCCGGGCGTGG - Intergenic
1001132615 5:169077245-169077267 TACAGTATGTAGGCCGGGCGCGG + Intronic
1001977493 5:176012070-176012092 TAAATTATCTAGGCCGGGCGTGG - Intronic
1002114743 5:176950577-176950599 TACATACTGAGGACCGGGCGCGG + Intronic
1002239930 5:177831699-177831721 TAAATTATCTAGGCCGGGCGTGG + Intergenic
1002954976 6:1853226-1853248 TATATAAGGAGGGCCGGGCGCGG + Intronic
1003533654 6:6957531-6957553 CACATCATGAGGGCTGGGCGCGG + Intergenic
1003566517 6:7227250-7227272 TAAAATTTTAGGGCCGGGCGTGG + Intronic
1003662569 6:8076611-8076633 TATATTTTGTAGGCCGGGCGTGG - Intronic
1003989001 6:11467144-11467166 AAGATAATCAGGGCCGGGCGTGG - Intergenic
1004573080 6:16867038-16867060 AATATTGTGAGGGCCGGGCACGG + Intergenic
1005300778 6:24468194-24468216 TAGATTGGGAGGGCCAGGTGTGG - Intronic
1005324467 6:24685634-24685656 TACAGTAAAAGGGCCGGGCGCGG - Intronic
1005436772 6:25820588-25820610 TAAAGAATGATGGCCGGGCGCGG + Intronic
1006112586 6:31757432-31757454 TCGGCTATCAGGGCCGGGCGCGG - Intronic
1006206316 6:32346303-32346325 GAGGATATGACGGCCGGGCGCGG - Intronic
1006338847 6:33434812-33434834 AAGAGTAGGGGGGCCGGGCGCGG + Intronic
1006649868 6:35542825-35542847 AACATTATGCTGGCCGGGCGCGG - Intergenic
1006667293 6:35704849-35704871 TTGATTCTGCTGGCCGGGCGCGG + Intronic
1006825754 6:36934601-36934623 TATAAAATGAAGGCCGGGCGGGG - Intergenic
1007003940 6:38342243-38342265 TAGGATTTGAGGGCCGGGCATGG + Intronic
1007557707 6:42781030-42781052 TAGATTATGTGGCCCAGGCCGGG - Intronic
1007798284 6:44369250-44369272 TAAAATCTGTGGGCCGGGCGCGG + Intronic
1008201332 6:48594159-48594181 TATATGGTTAGGGCCGGGCGCGG - Intergenic
1008350607 6:50485071-50485093 AGAATAATGAGGGCCGGGCGCGG - Intergenic
1010383258 6:75248376-75248398 TAAAGGATGTGGGCCGGGCGCGG - Intronic
1010384336 6:75262054-75262076 TATTTGATGAGGGCCGGGTGCGG + Intronic
1010434813 6:75817013-75817035 TAGATAAAGGGGGCCGGGCACGG + Intronic
1010606058 6:77890645-77890667 GAGATTATGAGGGGCTGGGGTGG + Intronic
1010882637 6:81198576-81198598 TAGAGCATCTGGGCCGGGCGCGG - Intergenic
1010937436 6:81878869-81878891 AAGATAATTAGGGCCGGGCGCGG + Intergenic
1011014824 6:82743410-82743432 TAGATTGTGAAGGCCTGGCCAGG + Intergenic
1011631896 6:89334756-89334778 AAGAAAATGATGGCCGGGCGCGG - Intronic
1013129827 6:107222362-107222384 TAGGTAAGGAGGGCCGGGCATGG + Intronic
1013482926 6:110567654-110567676 TTGTTTATATGGGCCGGGCGCGG + Intergenic
1013775743 6:113676758-113676780 TAGTTGATGAGGGCTGGGCACGG - Intergenic
1014292881 6:119580723-119580745 TACATTATGAGGGTCAGGCATGG + Intergenic
1014770330 6:125452666-125452688 TAGATAATGCAGGCCAGGCGTGG - Intergenic
1015118651 6:129677100-129677122 TTGCTTATGTTGGCCGGGCGCGG + Intronic
1015404976 6:132826807-132826829 TTGAAAATTAGGGCCGGGCGCGG + Intergenic
1015441325 6:133250349-133250371 AAGAATATGGGGGCTGGGCGCGG + Intronic
1015775678 6:136811858-136811880 AAGATAATTAGGGCCGGGCATGG + Intergenic
1015931314 6:138362816-138362838 TAGGTTAGGTGGGCTGGGCGTGG - Intergenic
1017128101 6:151084673-151084695 TATATTAGACGGGCCGGGCGTGG + Intronic
1019267479 7:126284-126306 CAGATCATGGAGGCCGGGCGTGG - Intergenic
1019944679 7:4317874-4317896 TAAAGACTGAGGGCCGGGCGCGG + Intergenic
1019979341 7:4609694-4609716 TTTAATATGGGGGCCGGGCGCGG + Intergenic
1020237394 7:6366932-6366954 TAAAATGTTAGGGCCGGGCGTGG + Intergenic
1020806156 7:12792860-12792882 TACATAATATGGGCCGGGCGCGG + Intergenic
1021560973 7:21968432-21968454 TAAGTTATTAGGGCCGGGTGCGG + Intergenic
1022275981 7:28855423-28855445 TGGCTTATGCTGGCCGGGCGCGG - Intergenic
1022307606 7:29162369-29162391 AACATTATGATGGCCAGGCGTGG + Intronic
1022560660 7:31345838-31345860 TAAATTAGGAGGGCCAGGGGAGG - Intergenic
1022835722 7:34112202-34112224 TAGACAATGAAGGCCAGGCGCGG + Intronic
1022848926 7:34240010-34240032 AAGATCATGGAGGCCGGGCGTGG - Intergenic
1023040148 7:36165725-36165747 TGGATCATTAGGGCCGGGCATGG - Intronic
1023092220 7:36627987-36628009 TAGCTCTCGAGGGCCGGGCGTGG + Intronic
1023412585 7:39902615-39902637 TAGATCAGCAGGGCCGGGAGCGG + Intergenic
1023429714 7:40077562-40077584 TATTTAACGAGGGCCGGGCGTGG + Intronic
1025078082 7:55960645-55960667 TAAATGATGATGGCCAGGCGTGG + Intronic
1025175479 7:56799049-56799071 AAGATTATAAGGGCCAGGCGCGG - Intergenic
1025196617 7:56939173-56939195 AACATTATCGGGGCCGGGCGCGG + Intergenic
1026434039 7:70378064-70378086 GACATTATGCTGGCCGGGCGCGG - Intronic
1026738161 7:72961934-72961956 AATATTCTAAGGGCCGGGCGCGG + Intronic
1026821271 7:73550945-73550967 TTAAATATGTGGGCCGGGCGTGG - Intronic
1026836106 7:73640484-73640506 TAGATGATGGCGGCCGGGCGTGG + Intergenic
1026859414 7:73775867-73775889 AAGAAATTGAGGGCCGGGCGCGG + Intergenic
1027048946 7:75009556-75009578 TAGGTTCTCAGGGCCGGGCGCGG - Intronic
1027105573 7:75403134-75403156 AATATTCTAAGGGCCGGGCGCGG - Intronic
1027178607 7:75921553-75921575 GAGATTTAAAGGGCCGGGCGTGG - Intronic
1027512287 7:79097829-79097851 TAGCTGATGTGGGCCAGGCGTGG + Intronic
1027633932 7:80645308-80645330 AAGATTGGGAGAGCCGGGCGTGG - Intronic
1027668572 7:81069738-81069760 AAGATTATGCTGGCTGGGCGCGG + Intergenic
1028151934 7:87383785-87383807 AAGAAAATGTGGGCCGGGCGTGG - Intronic
1029152680 7:98492031-98492053 GAAATTAACAGGGCCGGGCGCGG + Intergenic
1029209368 7:98893238-98893260 AAGATTAGGAGGGCTGGGCGAGG - Intronic
1029370510 7:100147843-100147865 TAGCATTTGAGGGCCGGACGCGG + Intergenic
1029713483 7:102312837-102312859 GAGATTCTCAGGGCCGGGCGCGG + Intronic
1030897353 7:115077357-115077379 TGGATCATCAGGGCTGGGCGCGG + Intergenic
1031908623 7:127489403-127489425 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1032692711 7:134305029-134305051 TCTACTATGATGGCCGGGCGCGG + Intronic
1033176189 7:139126026-139126048 TAGAAAATGCTGGCCGGGCGCGG + Intergenic
1033797814 7:144868861-144868883 AAAATTATCATGGCCGGGCGCGG - Intergenic
1033927461 7:146480968-146480990 CAGGTTCTGGGGGCCGGGCGCGG - Intronic
1034158452 7:148974711-148974733 TACATTAACTGGGCCGGGCGCGG + Intergenic
1035831496 8:2699387-2699409 TACATTATTAGGGCCAGGCATGG - Intergenic
1036197841 8:6736140-6736162 TAGATGAAGAAGGCTGGGCGTGG - Intronic
1036291507 8:7496588-7496610 TAGAATATGCTGGCCAGGCGCGG - Intronic
1036329982 8:7814955-7814977 TAGAATATGCTGGCCAGGCGCGG + Intronic
1036487802 8:9195362-9195384 TATATCATAAGGGCTGGGCGCGG + Intergenic
1036850609 8:12198274-12198296 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1036871974 8:12440539-12440561 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1037233413 8:16687905-16687927 TAAATGCAGAGGGCCGGGCGCGG + Intergenic
1037937233 8:22923274-22923296 TAGATCACAAGGGCTGGGCGTGG + Intronic
1037978489 8:23232162-23232184 TAGCCTATGACGGCCGGGCACGG + Intergenic
1038039361 8:23710879-23710901 TAGAGGTTCAGGGCCGGGCGCGG - Intergenic
1038762813 8:30400376-30400398 AAGAAAATGAGGGCCAGGCGTGG - Intronic
1039565631 8:38550418-38550440 AAGATTAGGAAGGCCAGGCGCGG - Intergenic
1040501349 8:48008210-48008232 AAGTTCATGAGGGCCGGGCGCGG - Intergenic
1040935063 8:52773851-52773873 AAGATTACCAAGGCCGGGCGTGG + Intergenic
1041159302 8:55021919-55021941 TATATCCTTAGGGCCGGGCGTGG + Intergenic
1041279138 8:56194006-56194028 TACCTAATGAAGGCCGGGCGTGG - Intronic
1042099157 8:65255549-65255571 TAAATTATGGGGGCCGGGTGCGG + Intergenic
1042923966 8:73947901-73947923 TAGTACTTGAGGGCCGGGCGGGG + Intronic
1043292404 8:78619104-78619126 TATTATATGAAGGCCGGGCGCGG - Intergenic
1043399848 8:79873089-79873111 AAGATTATGAAGGCCAGGCACGG - Intergenic
1043536920 8:81215269-81215291 TAGAGCACGTGGGCCGGGCGAGG + Intergenic
1043588261 8:81794766-81794788 AAGATTATTGTGGCCGGGCGCGG + Intergenic
1044575828 8:93768319-93768341 TATATTAAAAGGGCTGGGCGTGG + Intronic
1044584788 8:93859313-93859335 TAGATGGTGGGGGCCGGGCGTGG + Intronic
1044984115 8:97742844-97742866 TAGATTTATTGGGCCGGGCGTGG - Intergenic
1045118964 8:99014406-99014428 AAAATTATGCAGGCCGGGCGCGG - Intronic
1045142597 8:99302987-99303009 TAGTTTAGAAGGGCCGGGTGTGG + Intronic
1046533399 8:115476307-115476329 TATATTTTCTGGGCCGGGCGCGG - Intronic
1047038754 8:120969500-120969522 TAGTAGATGAGGGCCGGGCATGG - Intergenic
1047248731 8:123166095-123166117 AGGATTATCAGGGCCGGGAGGGG + Intergenic
1047258042 8:123230936-123230958 TTAACTATGCGGGCCGGGCGCGG - Intronic
1047316750 8:123741669-123741691 TGGAGAATGTGGGCCGGGCGTGG + Intergenic
1047697586 8:127417988-127418010 TGAATTTTCAGGGCCGGGCGTGG - Exonic
1048477300 8:134755111-134755133 TAGCTTTTGGGGGCTGGGCGTGG + Intergenic
1048784342 8:138034691-138034713 TAAATTTTCAGGGCTGGGCGCGG + Intergenic
1048826566 8:138433228-138433250 AAGATTATTAAGGCCGGGCACGG + Intronic
1048900099 8:139028875-139028897 TAGACTATAGTGGCCGGGCGCGG - Intergenic
1049120000 8:140727903-140727925 TAGAGAAAGACGGCCGGGCGCGG + Intronic
1049635126 8:143684149-143684171 TAGGTTATGAGGGCCGGGATCGG + Intergenic
1049904143 9:200121-200143 GAAATTATCTGGGCCGGGCGCGG + Intergenic
1049980275 9:897724-897746 TAGATTTTTTAGGCCGGGCGCGG - Intronic
1050254594 9:3780624-3780646 TAAAAAATGATGGCCGGGCGCGG + Intergenic
1050875791 9:10634328-10634350 AAGATTTTCTGGGCCGGGCGCGG + Intergenic
1051280707 9:15440657-15440679 TAAAAAATCAGGGCCGGGCGCGG + Intronic
1051402534 9:16698398-16698420 GTCATGATGAGGGCCGGGCGCGG + Intronic
1051408624 9:16766075-16766097 GAAATTATGAGTGCCGGGCGCGG - Intronic
1051652405 9:19341832-19341854 TAGTCTATGTGGGCTGGGCGTGG + Intronic
1051768203 9:20547322-20547344 GACAGTATGAGGGCCGGGCATGG - Intronic
1052904811 9:33824344-33824366 TAGCTGGTGTGGGCCGGGCGCGG + Intronic
1053018830 9:34680396-34680418 TAAAATAAGAAGGCCGGGCGCGG + Intergenic
1053118715 9:35528793-35528815 TAGCTTAAAAGGGCCGGGCATGG + Intronic
1053253230 9:36592465-36592487 GAAAATTTGAGGGCCGGGCGCGG - Intronic
1053555301 9:39131533-39131555 AAGAGTGTGAGGGCCGGGCGCGG + Intronic
1053819421 9:41951784-41951806 AAGAGTGTGAGGGCCGGGCGCGG + Intronic
1053917704 9:42955534-42955556 TAGATTTTGAAGGCAAGGCGAGG - Intergenic
1054109686 9:61095437-61095459 AAGAGTGTGAGGGCCGGGCGCGG + Intergenic
1054611171 9:67235688-67235710 AAGAGTGTGAGGGCCGGGCGCGG - Intergenic
1055088678 9:72340222-72340244 TAGAAAGTGTGGGCCGGGCGTGG - Intergenic
1056261631 9:84854654-84854676 AAGAGCCTGAGGGCCGGGCGCGG + Intronic
1056602812 9:88059658-88059680 TATATTATGAGGGCAGGATGTGG - Intergenic
1057158495 9:92867057-92867079 TAGATGATGGGGGCCGGGCATGG + Intronic
1057502171 9:95604505-95604527 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1057533142 9:95873019-95873041 CAGAAAATGAGGGCCGGGCGCGG + Intergenic
1059883689 9:118720719-118720741 TAAATGATGACGGCCGGGCGCGG + Intergenic
1060359915 9:122944865-122944887 AAGATTATTTAGGCCGGGCGCGG - Intronic
1060470623 9:123945229-123945251 TGTTTTATGTGGGCCGGGCGAGG + Intergenic
1061843371 9:133373306-133373328 TACATGATGAAGGCTGGGCGCGG + Intronic
1061928613 9:133820613-133820635 TTGTTTATGGAGGCCGGGCGCGG - Intronic
1061988840 9:134146524-134146546 TAGATAAGGGAGGCCGGGCGCGG - Intronic
1062200147 9:135298521-135298543 AAGTTTATACGGGCCGGGCGCGG - Intergenic
1062366945 9:136214704-136214726 TGGTTTCTGAGGGCCGGGCATGG - Intronic
1062470762 9:136703029-136703051 ATGATTTAGAGGGCCGGGCGCGG + Intergenic
1203781975 EBV:105797-105819 TCCATTATGTGGGACGGGCGAGG - Intergenic
1186488945 X:9956372-9956394 TAAATAAATAGGGCCGGGCGCGG - Intergenic
1186650976 X:11559635-11559657 TAAAGTAGGAGGGCCGGGCGCGG + Intronic
1187063501 X:15810724-15810746 CAGAATATCAGGGCCAGGCGCGG + Intronic
1187125091 X:16447245-16447267 TTTATTTTGAGGGCCGGGTGCGG - Intergenic
1187507583 X:19889140-19889162 AAGAATGTGAAGGCCGGGCGCGG + Intergenic
1188205061 X:27345831-27345853 AAGAAAATGTGGGCCGGGCGTGG + Intergenic
1188428979 X:30083641-30083663 ACTATTATAAGGGCCGGGCGCGG - Intergenic
1188684506 X:33053303-33053325 TAGTTACTGTGGGCCGGGCGCGG + Intronic
1188731432 X:33650662-33650684 AAGATTTCGAGGGCCGGGCACGG - Intergenic
1188787541 X:34366641-34366663 AAAATAATGGGGGCCGGGCGTGG + Intergenic
1188799823 X:34515725-34515747 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1189015395 X:37091615-37091637 AAGAAAATGAGGGCCAGGCGTGG - Intergenic
1189342945 X:40218481-40218503 AAGATTATTAAAGCCGGGCGAGG + Intergenic
1190018580 X:46851344-46851366 AAGATTATGTGGGCCGGGCTCGG + Intronic
1190052656 X:47162583-47162605 TAGAGTATGGAGGCCGGGTGTGG + Intronic
1190344615 X:49326073-49326095 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190345708 X:49335630-49335652 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190346811 X:49345180-49345202 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190348061 X:49536207-49536229 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190349162 X:49545763-49545785 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190350266 X:49555319-49555341 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190351368 X:49564878-49564900 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190352468 X:49574431-49574453 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190353569 X:49583979-49584001 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190354671 X:49593501-49593523 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190355776 X:49603051-49603073 AAAATTATCTGGGCCGGGCGTGG - Intronic
1190510475 X:51169259-51169281 TATATTTTGGGGGCTGGGCGCGG - Intergenic
1190865570 X:54381900-54381922 TAGAATATCACGGCTGGGCGCGG + Intergenic
1195262109 X:103142614-103142636 AACATTATGCCGGCCGGGCGCGG - Intergenic
1195600319 X:106739447-106739469 TAAAATATGAGGGCCGGGCATGG - Intronic
1196351857 X:114741228-114741250 GAGATTGGGAGGGCCGGGCACGG + Intronic
1196788539 X:119443409-119443431 TAGAGAATGGGGGCTGGGCGCGG - Intronic
1198206301 X:134468322-134468344 TAGTATTTGATGGCCGGGCGGGG + Intronic
1198238122 X:134756139-134756161 AAGATGATGAAGGCCGGGCGTGG - Intronic
1198625445 X:138567389-138567411 AAGATGAGAAGGGCCGGGCGCGG - Intergenic
1198708001 X:139470155-139470177 TAGTTACTGATGGCCGGGCGTGG - Intergenic
1198752828 X:139952564-139952586 AGGATTGTGGGGGCCGGGCGCGG - Intergenic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1199821778 X:151456779-151456801 AAAAAAATGAGGGCCGGGCGCGG + Intergenic
1202017207 Y:20422544-20422566 TAAATGGTGAGGGCCGGGCGTGG - Intergenic