ID: 972638679

View in Genome Browser
Species Human (GRCh38)
Location 4:40906548-40906570
Sequence TTTCAGAGTCCCAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972638675_972638679 0 Left 972638675 4:40906525-40906547 CCACCAGTACTTAGTTAAGGGGA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 159
972638676_972638679 -3 Left 972638676 4:40906528-40906550 CCAGTACTTAGTTAAGGGGATTT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 159
972638673_972638679 1 Left 972638673 4:40906524-40906546 CCCACCAGTACTTAGTTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972638679 Original CRISPR TTTCAGAGTCCCAATGAGGA GGG Intronic
904698631 1:32345134-32345156 TTCCAGAGTCCCCAGGAGGAAGG + Intergenic
907896937 1:58700927-58700949 TTACAGTGTCCCAGTGAGGTAGG + Intergenic
911445637 1:97988193-97988215 TTTCAGGGTACTAATCAGGAAGG + Intergenic
913082539 1:115402194-115402216 GTTGAGTGTCCCAATGAGGGGGG - Intergenic
915023798 1:152806792-152806814 TTTCTGAGCCCCATGGAGGAAGG - Intronic
915793968 1:158706674-158706696 TTTCAGACTTCAGATGAGGAGGG + Intergenic
920084636 1:203406339-203406361 CTTCAGAGGCCCACTTAGGATGG + Intergenic
924558535 1:245138009-245138031 TTTCAGAGTCCACATGTGGAGGG + Intergenic
1063916682 10:10890035-10890057 GGTCAGGGTCACAATGAGGAGGG + Intergenic
1063981858 10:11459313-11459335 CTTGAGAGTCCCACTGAGTATGG + Intronic
1069042921 10:63713242-63713264 TTTCAGAGTCCCAGATGGGAGGG - Intergenic
1069532630 10:69230399-69230421 ATTCAGAGTCCCCAGGGGGAGGG - Intronic
1071573137 10:86708853-86708875 TCTCAGAGCCCCAGAGAGGAAGG + Intronic
1075353763 10:121751763-121751785 TTTCAGAGACCCAGTCAAGAAGG - Intronic
1078436929 11:11333000-11333022 TTTCGTAGTCTAAATGAGGATGG - Intronic
1078460247 11:11509820-11509842 TTTCAGTTTCCCACAGAGGATGG - Intronic
1078596137 11:12688260-12688282 TTTCAGAGTCCTGATTATGAAGG - Intronic
1078872795 11:15364539-15364561 CTTCAGAATCCCCATGAGAAAGG - Intergenic
1079840942 11:25398491-25398513 TTTCATAGTCACAATGAGCAAGG - Intergenic
1083370218 11:62172744-62172766 TTTCAGATTTCTAAAGAGGATGG - Intergenic
1084306173 11:68285153-68285175 TTTAAAATTCCTAATGAGGATGG + Intergenic
1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG + Intronic
1090438029 11:126703015-126703037 TTTCAGAGTGGCAGGGAGGATGG + Intronic
1090503141 11:127281432-127281454 TTTCACAGTCACATTGAAGAGGG - Intergenic
1091343567 11:134838065-134838087 GTTCACAGTCCCACTGAGCAGGG + Intergenic
1092372697 12:7930358-7930380 TCTCAGAATCCAAGTGAGGAGGG - Intronic
1093338696 12:17943486-17943508 TAGCAGAATCCCAATGAGGGAGG + Intergenic
1095940896 12:47726122-47726144 TTTCAGATTCCTTATGAGGCAGG + Intergenic
1097564180 12:61247934-61247956 TTTCAGCCTCCAGATGAGGAGGG + Intergenic
1102232515 12:111273341-111273363 CTTCAGCTTCCCAGTGAGGAAGG - Intronic
1104097773 12:125574409-125574431 TTTCAGATTCCCAACGTGGAAGG + Intronic
1106493739 13:30254416-30254438 TTTCAGTGTCCTATTGAGGCAGG + Intronic
1106618228 13:31350119-31350141 TTTCAGTATGCCCATGAGGAGGG - Intergenic
1107280310 13:38726038-38726060 ACTCAGAGTTCCCATGAGGAGGG + Intronic
1110523436 13:76507370-76507392 TTTCAGAGTAACAAGGAGAAGGG + Intergenic
1110831486 13:80036845-80036867 TTACAGAGTTCTAATGAGAATGG - Intergenic
1121106579 14:91283715-91283737 TGTCAGAGGCCCCATGAGGATGG + Intronic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1124239935 15:28020403-28020425 TGCCTGAGTCCCACTGAGGACGG + Intronic
1124814617 15:32976913-32976935 TTGCAGAGTCACAAGGATGAAGG - Intronic
1126637017 15:50789443-50789465 TGTCAGAGTGTCAATTAGGATGG - Intergenic
1126646711 15:50882199-50882221 TTTCTGGGTCCCAATGTGGGGGG + Intergenic
1128479325 15:68023704-68023726 TTTCAGCCTCCAAATGAGGAGGG + Intergenic
1128734257 15:70043749-70043771 TCTCAGAGTACCAAGGAGTAGGG + Intergenic
1130436085 15:83901337-83901359 TTCCAGAGACCAAAGGAGGAAGG + Intronic
1131031597 15:89190700-89190722 TCTCACAGTTCCATTGAGGAAGG + Intronic
1132187249 15:99811708-99811730 TTACAGAGTTCCACTGAGGCCGG - Intergenic
1134800967 16:17084242-17084264 TTTCAGTGAACCAATGAGAAGGG - Intergenic
1135175775 16:20227458-20227480 TTACAGAGTCCCTATCAAGATGG + Intergenic
1135621769 16:23962116-23962138 TTTCAGAGTCCTACTCAGGCAGG - Intronic
1139062813 16:63275181-63275203 TTTCAAAACACCAATGAGGAGGG - Intergenic
1140070518 16:71645349-71645371 TTTCCGACTCCCAATCATGAAGG - Exonic
1141253836 16:82382742-82382764 TTTCTGAGTAACAATGGGGAGGG + Intergenic
1141575099 16:84958634-84958656 TTTTAGAGTTCAAATTAGGATGG + Intergenic
1144738788 17:17569614-17569636 TTACGGGGTCCCAGTGAGGAAGG + Intronic
1147350616 17:39840099-39840121 TTTCAGAGTCCCAAAGAAACTGG + Intronic
1149857992 17:60101474-60101496 TTTGAGAGTCCGAAAGATGATGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155340610 18:24810791-24810813 TTCCAAAGTCCCCACGAGGAAGG - Intergenic
1155516223 18:26626114-26626136 GTTCAGTGTCCCATTAAGGAAGG - Intronic
1156099095 18:33572368-33572390 TTTCATAGCCCCAGTGAGGCTGG - Intergenic
1157342644 18:46793053-46793075 ATTCATGGTCCTAATGAGGAGGG + Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1160591955 18:79950097-79950119 TTTCAGAGGCCCAGTGGGGAGGG + Intronic
1161890543 19:7032933-7032955 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161890908 19:7037800-7037822 ATTCAGAGTAGGAATGAGGATGG + Exonic
1161892628 19:7051661-7051683 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161892991 19:7056261-7056283 ATTCAGAGTAGGAATGAGGATGG + Exonic
1162645029 19:12042569-12042591 TTGCAGAGTCCCAATCAAGGAGG - Intronic
1166735679 19:45082964-45082986 TTTCAGTGTCCCAGTAAGTAAGG + Intronic
1166931569 19:46304357-46304379 TTTCTGAGTCCTAAGGAGGCGGG - Intronic
1167009578 19:46798183-46798205 CTTCAGACTCCCAATTAGGTGGG - Intergenic
1167256106 19:48430075-48430097 TGTCAGAGTCACAATGTGGGAGG - Intronic
1167598725 19:50441165-50441187 TTTCGAGGTCCCAATGAGGTAGG + Intronic
1167976947 19:53235325-53235347 ATTAAGTGTCCCAATGAGGTGGG + Intergenic
925600338 2:5602538-5602560 TTTCAGAATCCCATAGTGGAGGG + Intergenic
925723697 2:6852915-6852937 TTTGAAAGTACAAATGAGGAGGG - Intronic
926673319 2:15595998-15596020 TTTCAGCCTCCCAATTAGGTGGG + Intronic
928947990 2:36789427-36789449 TCTCAGGGTCCCAAGGAGGTGGG + Intronic
930546969 2:52780527-52780549 TTTCACATTTCCAATGAAGAAGG + Intergenic
930625600 2:53694098-53694120 TTACAAAATCTCAATGAGGAGGG + Intronic
930752493 2:54946463-54946485 TTTCAGAGTCCCATTTCTGATGG + Intronic
932948521 2:76265945-76265967 TTTCACAGTACCAAAGAGAATGG - Intergenic
937060337 2:118976137-118976159 TGTCAGAGTCCTAAAGAGAAGGG - Intronic
937320753 2:120959303-120959325 TTCCAGAGTCCACCTGAGGAGGG + Intronic
937373950 2:121322540-121322562 CCTCAGAGTCCCACTGAGTAGGG - Intergenic
938663376 2:133509692-133509714 TTTCATTGTCACAATGAGGGAGG + Intronic
939903598 2:147882041-147882063 TTTTAGAGTCCCAAAGAGAGTGG - Intronic
942486987 2:176450524-176450546 CTCCAGAGTGCCAATTAGGATGG - Intergenic
942781778 2:179652229-179652251 TTTCACAGTTTCAATGAGTATGG + Intronic
944444079 2:199772439-199772461 TGTCAGGGTCCCAAAGAGCAGGG + Intronic
946058818 2:216924125-216924147 TTTTACATTCCCAATGAGGTAGG + Intergenic
947910314 2:233796263-233796285 ATTCAGAGTCCCCACGCGGACGG - Exonic
1170488851 20:16849672-16849694 TTAAAAAGTCCCAATGAGGCTGG - Intergenic
1172661357 20:36571364-36571386 TTACAGTGTCCCAACAAGGAGGG - Intergenic
1178685484 21:34707500-34707522 GTTCAGACTCCGACTGAGGATGG - Intronic
1178737467 21:35166017-35166039 TTTCAGTGTCTCTGTGAGGAAGG - Intronic
1180745425 22:18085335-18085357 TGTCAGAGTCCTACTGGGGAGGG + Intronic
1181885874 22:26022107-26022129 TCTCAGAGTCACTATGAGGCAGG - Intronic
1182459046 22:30471515-30471537 TTTCAGGATCCCAAAGAGGAAGG + Intronic
1182947755 22:34340717-34340739 TCTCAGAGTCCCAAGGGGAAGGG - Intergenic
1183045874 22:35219663-35219685 TTGCAGAGTCACAGTGTGGACGG - Intergenic
950233970 3:11302304-11302326 TTTCTGAGTCCCTATTAGGATGG + Intronic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
950655121 3:14431778-14431800 TTTCTGAGTCCGAGTGAGGTGGG + Intronic
954459445 3:50617981-50618003 TTTGAGTGTCCCAGTGAGCAAGG + Intronic
955883184 3:63569714-63569736 TTTTTGAGTCTCAATGAGAAAGG - Intronic
955931044 3:64057217-64057239 TGCCAGTGTTCCAATGAGGATGG - Intergenic
956098041 3:65737915-65737937 TTTAGGAGTCCTAATGAGGCAGG - Intronic
956123679 3:65991428-65991450 TTTCATAGTACCATTGAGGAAGG - Intronic
956321578 3:68003292-68003314 TTTCAGAGGCACAATAAAGAAGG - Intergenic
956414464 3:69012790-69012812 TTCCACAGGCCTAATGAGGAAGG + Exonic
958763587 3:98338553-98338575 TTTCATAGTCCTAATGAGCAAGG - Intergenic
958896651 3:99836951-99836973 TCTCAGACTGCCAATAAGGAAGG - Intronic
959563973 3:107815523-107815545 TTTCAGTGTCCCAAGGAGGAAGG - Intergenic
961205329 3:125076838-125076860 ATCCAGAGACCCCATGAGGATGG - Intergenic
964549032 3:157866220-157866242 TTTCACAAACCCAATAAGGAGGG + Intergenic
966259391 3:177956902-177956924 TTTCAGAGATCCAAGGAGGAAGG - Intergenic
967923313 3:194628767-194628789 TTTCCGACTCCAAATCAGGACGG + Intronic
969368305 4:6713492-6713514 TTTCTGAGTTTGAATGAGGATGG + Intergenic
972253401 4:37329136-37329158 TTTCAGAGAAGCAAAGAGGAGGG - Intronic
972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG + Intronic
974103641 4:57443675-57443697 TCTCAGAGACCCAAGTAGGATGG - Intergenic
979324570 4:119363767-119363789 TTAGATAGTCCCAATGAGGAAGG + Intergenic
979476992 4:121169830-121169852 TTTCAGAGTTCCAACCAGGCGGG - Intronic
981138229 4:141237286-141237308 TTTCAGGGTTCCAATGGTGAGGG + Intergenic
983242409 4:165248467-165248489 TTAGATAGTCCCAATGAGGAAGG + Intronic
984951564 4:185011576-185011598 TCTCAGAGTGCCACAGAGGAGGG + Intergenic
985739676 5:1607462-1607484 TCTCAGAGACCCCATGAGGCAGG + Intergenic
988245091 5:28670083-28670105 TTCTAGAGTCCCAAAGAGAATGG + Intergenic
988684339 5:33513253-33513275 TTTCAGAGGGCCACTCAGGAAGG - Intergenic
989657424 5:43759938-43759960 ATTCATAGTCCTAATGAGAAAGG - Intergenic
989685475 5:44081582-44081604 GTTCAGAGAGCCAATGGGGATGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997441025 5:133908726-133908748 TTTCAGAATCCCCGTGAGGCAGG - Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
997767230 5:136516804-136516826 TTTCCCAGTGCTAATGAGGAAGG + Intergenic
998140221 5:139695763-139695785 TTGCAGGGTTCCAATGAGGGTGG + Intergenic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
1004591220 6:17053842-17053864 CTCCTGAGTCCCAAAGAGGAAGG - Intergenic
1010293756 6:74171102-74171124 TTTGAGAGTGTCAATAAGGAAGG + Intergenic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1018572250 6:165223998-165224020 TTTCAGTGTCACATTGAGAAAGG + Intergenic
1018848964 6:167574090-167574112 TTTCTGGGTCCCAATGAGTCTGG - Intergenic
1020438200 7:8188869-8188891 TTTCAGTGACGCAAAGAGGAGGG + Intronic
1022208137 7:28182177-28182199 TTTCATGGGCCCAATGAGGGTGG + Intergenic
1022224617 7:28350123-28350145 TTTCAGAGTCAAAATGGGAAAGG + Intronic
1022387836 7:29918144-29918166 CTTCAGAGTCACATTGAGCATGG + Intergenic
1023629569 7:42150610-42150632 TGTCAGAGCCCCCCTGAGGAAGG - Intronic
1029433109 7:100544980-100545002 TTTAATAGTCCCTAAGAGGAAGG - Intronic
1029959937 7:104680106-104680128 CTTCAGAGTCGCAGAGAGGAAGG + Intronic
1030976759 7:116134502-116134524 TTTCAGAGACCCAAAGGGAAGGG - Intronic
1037041603 8:14243063-14243085 CCTCAGATTCCAAATGAGGAGGG + Intronic
1038022480 8:23562033-23562055 TTCCAGAGCCCCATTGAGCAGGG - Intronic
1041429400 8:57761941-57761963 TATCACAGTCCCATCGAGGATGG - Intergenic
1043941504 8:86201073-86201095 TTGCAGGGTCCCAGTGACGATGG - Intergenic
1045552276 8:103183257-103183279 TGTCAGAATCCCAAAGATGATGG + Intronic
1047805593 8:128356164-128356186 TTTCATGGTCAGAATGAGGAAGG + Intergenic
1049371614 8:142270695-142270717 TTCCAGAGTTCCAGTGAGCAGGG + Intronic
1052432214 9:28381162-28381184 TTCCAGAGTCCTAGTGTGGAAGG + Intronic
1053607343 9:39673870-39673892 CTTCAAAGTCACCATGAGGAAGG - Intergenic
1053865192 9:42430223-42430245 CTTCAAAGTCACCATGAGGAAGG - Intergenic
1054246190 9:62668539-62668561 CTTCAAAGTCACCATGAGGAAGG + Intergenic
1054560312 9:66703072-66703094 CTTCAAAGTCACCATGAGGAAGG + Intergenic
1059247500 9:112861350-112861372 TTACAGCGTCCTAATTAGGAAGG - Intronic
1059785314 9:117575773-117575795 TTTCAGAGGCCCAGGGAAGAGGG + Intergenic
1061973469 9:134056758-134056780 TCCCAGAGTCCCAGTGGGGAGGG + Intronic
1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG + Intergenic
1188074666 X:25760236-25760258 TGTCAGAGCACCAGTGAGGAAGG - Intergenic
1188779078 X:34257882-34257904 ATTCATGGTCGCAATGAGGAAGG - Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1194174061 X:90625105-90625127 TTTCAGAGTGCCAAGGCCGACGG - Intergenic
1194428104 X:93764606-93764628 TTTCACAGTCACAATGCTGAGGG - Intergenic
1197603651 X:128560139-128560161 TTACAGGGTCCCCATGGGGAAGG + Intergenic
1198026443 X:132712316-132712338 CTTCAGAGATCAAATGAGGAAGG - Intronic
1199857430 X:151771815-151771837 TTTCAGAGACCTCAAGAGGATGG - Intergenic
1200520285 Y:4202806-4202828 TTTCAGAGTGCCAAGGCTGACGG - Intergenic