ID: 972640245

View in Genome Browser
Species Human (GRCh38)
Location 4:40918737-40918759
Sequence CAGAGAAAAAATAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1712
Summary {0: 1, 1: 0, 2: 4, 3: 143, 4: 1564}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972640245_972640248 23 Left 972640245 4:40918737-40918759 CCTCCTTCCTTATTTTTTCTCTG 0: 1
1: 0
2: 4
3: 143
4: 1564
Right 972640248 4:40918783-40918805 TTGTTTTTTTTAACAGAGACAGG No data
972640245_972640249 24 Left 972640245 4:40918737-40918759 CCTCCTTCCTTATTTTTTCTCTG 0: 1
1: 0
2: 4
3: 143
4: 1564
Right 972640249 4:40918784-40918806 TGTTTTTTTTAACAGAGACAGGG 0: 1
1: 30
2: 677
3: 7277
4: 32641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972640245 Original CRISPR CAGAGAAAAAATAAGGAAGG AGG (reversed) Intronic
900862958 1:5246077-5246099 GAGGGAGAAAAGAAGGAAGGAGG - Intergenic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901419676 1:9142555-9142577 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
901441932 1:9283273-9283295 AAAAGAAAAGAAAAGGAAGGGGG + Intergenic
901479180 1:9512600-9512622 CAGAGGAGAACAAAGGAAGGGGG - Intergenic
901543508 1:9937544-9937566 CAGAAAAAAAAAAAGGCAGCTGG + Intronic
901582601 1:10257474-10257496 CAAAAAAAAAAAAAGGAAAGAGG + Intronic
901788265 1:11638904-11638926 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
902276509 1:15343810-15343832 CAGAGAAGAAAAAAGGAAGTCGG - Intronic
902335448 1:15751853-15751875 AAAAAAAAAAAAAAGGAAGGTGG + Intergenic
902727866 1:18349342-18349364 CAGAAGAAAAATAAGGATGATGG + Intronic
902934678 1:19756248-19756270 CAAAAAAGAAAAAAGGAAGGTGG + Intronic
902954432 1:19915401-19915423 GAGAGCAAAAATACAGAAGGTGG + Intergenic
902959369 1:19951629-19951651 CAGAGAAAAAATGAAAAAGAAGG + Intergenic
903004919 1:20292193-20292215 AAAAAAAAAAAGAAGGAAGGAGG - Intronic
903116589 1:21183388-21183410 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
903141173 1:21340012-21340034 CACATAAAAAATTAGGAGGGGGG - Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903253009 1:22070411-22070433 CAGAGGACAACAAAGGAAGGAGG - Intronic
903600931 1:24539233-24539255 CAGAAAAAAAAAAAGGCATGAGG + Exonic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903959221 1:27046256-27046278 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
904100828 1:28025691-28025713 CAGATAACAAATAAGAATGGTGG + Intronic
904247959 1:29201566-29201588 CAGATAAAATGTAAGGCAGGTGG + Intronic
904266722 1:29322572-29322594 CTGAGGCAAAATGAGGAAGGTGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904505533 1:30949764-30949786 GAGTAAAAAAATATGGAAGGTGG + Intronic
904531287 1:31171360-31171382 CTCAGAAAAAAAAAAGAAGGGGG - Intergenic
904810033 1:33157484-33157506 CTGACAAAGAATAAGGAAGGGGG - Intronic
904904849 1:33888317-33888339 CAAAGTAATAATAATGAAGGAGG + Intronic
905323938 1:37137192-37137214 AAGAGAAAAGCTAAGGCAGGTGG + Intergenic
905453819 1:38073991-38074013 CAAAGAAAAAGCAAGGGAGGTGG + Intergenic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905536389 1:38725570-38725592 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905728493 1:40276367-40276389 CAGAGAAACAGCCAGGAAGGAGG + Intronic
906308368 1:44735792-44735814 CAAAAAAAAAAAAAAGAAGGTGG - Intergenic
906445218 1:45890521-45890543 GAAGGAAAAAATAAGGAAGGAGG - Intronic
906590556 1:47021155-47021177 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
906784207 1:48600079-48600101 CAGAAAAAAAATTAAGAAGGAGG + Intronic
906786613 1:48621449-48621471 TAGAAAAAAATTATGGAAGGAGG - Intronic
906809296 1:48809878-48809900 CAGAATAAAACTGAGGAAGGAGG - Intronic
906883708 1:49621396-49621418 CAGAGGAGAACAAAGGAAGGAGG + Intronic
907177465 1:52538364-52538386 CTGAGAAAAAAAAAGGGAGCTGG + Intronic
907226240 1:52949643-52949665 CAGAGGAGAACAAAGGAAGGAGG + Intronic
907265010 1:53253455-53253477 CAGATAAAATATAAGTAAAGGGG + Intronic
907418639 1:54331769-54331791 CAGAGAAGCAACAAGGAGGGTGG + Intronic
907584201 1:55601764-55601786 AAGAAAAAAAATAAAGAGGGTGG - Intergenic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907800106 1:57756431-57756453 CAGAGAATAGATAAGAAAGTGGG + Intronic
907861597 1:58358915-58358937 GAGAGAGAAAGAAAGGAAGGGGG - Intronic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
908856200 1:68432610-68432632 GAGAGAATAAGAAAGGAAGGTGG + Intronic
909161455 1:72155906-72155928 TGGAGAAAAAGTAAGGAAGCAGG + Intronic
909443420 1:75723046-75723068 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909463765 1:75949184-75949206 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
909615953 1:77607923-77607945 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
909818160 1:80023918-80023940 CAAAGTAAAAATAAAAAAGGTGG - Intergenic
909857004 1:80547664-80547686 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909948482 1:81690674-81690696 CAGAAAAAAAGTAAGGCAGGTGG - Intronic
909973402 1:82018182-82018204 CAAAGAGAAAAGAAGGAAGGTGG - Intergenic
910059167 1:83068133-83068155 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
910117810 1:83751751-83751773 CAGAGAAATAGAATGGAAGGAGG + Intergenic
910826992 1:91419920-91419942 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
910905287 1:92170919-92170941 CAGATATATAATGAGGAAGGAGG - Intronic
910997795 1:93127805-93127827 AAAAGTAAAAATAAGGTAGGGGG - Intronic
911090619 1:94014298-94014320 CAATGAAAAAGGAAGGAAGGAGG + Intronic
911117476 1:94260729-94260751 CAAAGAAAAATGAAGGAAGTTGG + Intronic
911122749 1:94312427-94312449 CAAAAAAAAAAAAAAGAAGGAGG - Intergenic
911636295 1:100239474-100239496 CATAGAAAAAACATGGAAGATGG + Intronic
911833943 1:102592160-102592182 CTGAGAAAAAATAAAGATGATGG + Intergenic
912046587 1:105466380-105466402 GAGAGAAAAAAAAAGGCAGAAGG + Intergenic
912240532 1:107903135-107903157 TAGAGAAAAAATGAGGTAGCAGG + Intronic
912438973 1:109683942-109683964 CAGAGGAGAACAAAGGAAGGGGG - Intronic
912441495 1:109702387-109702409 CAGAGGAGAACAAAGGAAGGGGG - Intronic
912608900 1:111022629-111022651 CATAGAATAAATTAGGGAGGAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913041100 1:115024738-115024760 CTGATAAAAAATATGGTAGGTGG - Intergenic
913116228 1:115699933-115699955 TAGAGAAGAAATAAGGAGGTAGG + Intergenic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
913488560 1:119356803-119356825 CAGAGGATAACAAAGGAAGGAGG + Intergenic
913697970 1:121346321-121346343 AAGAGAGAAAATAAGCAAGCCGG + Intronic
914139581 1:144933730-144933752 AAGAGAGAAAATAAGCAAGCCGG - Intronic
914264670 1:146028111-146028133 CAACAAAAAAATAATGAAGGGGG - Intergenic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
914754501 1:150554986-150555008 CAGAAAAAAAAAAAAAAAGGTGG - Intronic
914882825 1:151560759-151560781 CACTGGAAAAATAAGGAAGTTGG - Intronic
914974198 1:152344041-152344063 CAGAGAAATCTTAAGGAAAGAGG - Intergenic
915092452 1:153436047-153436069 CAAAAAAAAAAAAAAGAAGGAGG + Intergenic
915183097 1:154080359-154080381 CAAAAAAAAAAAAAGGAAGAAGG + Intronic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
916152148 1:161804670-161804692 TAGAAAAAAAAAAAGGCAGGGGG - Intronic
916316895 1:163459009-163459031 CGGAGAAAGAATTAGGAAAGTGG + Intergenic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
916604966 1:166332703-166332725 CAGAGAGAAAATTAGGAGGTAGG - Intergenic
916732184 1:167576090-167576112 CAGAGGAAAAATGAAGAATGAGG + Intergenic
916941222 1:169680691-169680713 CAGAGGAAATATAACAAAGGAGG + Intronic
917077377 1:171219518-171219540 CAGAGGAGAACAAAGGAAGGGGG - Intergenic
917077866 1:171224516-171224538 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
917098486 1:171423240-171423262 AAAATAAAAAATAAGGCAGGAGG + Intergenic
917352952 1:174097049-174097071 AAGAGAGAAAGTAAGGGAGGAGG - Intergenic
917721133 1:177787622-177787644 CAGATAAGAAATAAAGAGGGTGG + Intergenic
917981962 1:180275144-180275166 CACAGCAAAAATAAAAAAGGAGG - Exonic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
918153980 1:181826741-181826763 AAAAGAAAAAATAGAGAAGGGGG - Intergenic
918273330 1:182924970-182924992 GAAAGAAAAAAAAAGGAAGAAGG + Intronic
918300838 1:183202387-183202409 CAAGGATAAAAGAAGGAAGGGGG + Intronic
918421260 1:184366294-184366316 CAGAGGAAGAGCAAGGAAGGAGG - Intergenic
918711826 1:187740672-187740694 CTTAGAAATAATTAGGAAGGTGG + Intergenic
918930343 1:190847220-190847242 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
918984868 1:191610895-191610917 TAGTTAAAAAATAAGAAAGGGGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919205077 1:194411587-194411609 CAGAGAAAAAATACAGAAAATGG - Intergenic
919293638 1:195666273-195666295 CAGAGAGACAAAGAGGAAGGTGG + Intergenic
919469264 1:197958427-197958449 GAGAGAGAAAATAGGTAAGGAGG + Intergenic
919651487 1:200153765-200153787 AAGAAAAAATAAAAGGAAGGAGG + Intronic
919669120 1:200322611-200322633 CAAAGAAAAGGAAAGGAAGGTGG - Intergenic
919708138 1:200698683-200698705 AAGAGAAAAAAAAAAGAAGATGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920061075 1:203227316-203227338 CAAAGGAAAAGAAAGGAAGGAGG + Intronic
920131012 1:203731857-203731879 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920485366 1:206364971-206364993 AAGAGAGAAAATAAGCAAGCCGG + Intronic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920618060 1:207513808-207513830 AAGAAAGAAAATAAGGAAAGAGG - Intronic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920684675 1:208100355-208100377 CAAAGAAAAAAAAAAGGAGGAGG + Intronic
920776376 1:208941869-208941891 AGGAGAAAAATCAAGGAAGGAGG - Intergenic
920800983 1:209187144-209187166 CAGACAAAAAAAGGGGAAGGTGG + Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921035590 1:211375529-211375551 AAGAGAAACACCAAGGAAGGTGG + Intergenic
921110082 1:212027406-212027428 CAGAGATAAGATTAAGAAGGAGG + Intronic
921342107 1:214144603-214144625 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
921349886 1:214224339-214224361 AAGAAAAAAAAAAAGGAAGGAGG + Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921953828 1:220961191-220961213 CTCAGAAAAATTAAGGAATGTGG + Intergenic
921969688 1:221134433-221134455 AAGAGAAAAAAGATGGGAGGTGG - Intergenic
922168776 1:223137822-223137844 CATAAAAGAAAGAAGGAAGGAGG - Intronic
922238680 1:223740516-223740538 CAGAGGAGAACAAAGGAAGGAGG + Intronic
922781281 1:228255029-228255051 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
923027121 1:230213719-230213741 CAGAGAAGAAAAAACGTAGGAGG - Intronic
923042766 1:230331651-230331673 GAGAGAAAAAAAAAAGGAGGAGG - Intronic
923211012 1:231804452-231804474 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
923276003 1:232396930-232396952 GAAAGAAAAAAAAGGGAAGGAGG + Intergenic
923309212 1:232719315-232719337 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
923371570 1:233319196-233319218 CAGTGAAAAAATGAGGGATGAGG - Intergenic
923428849 1:233900406-233900428 AAGAGACAACATAAGGAATGAGG + Intergenic
923498260 1:234543446-234543468 GAGAAAAACAAAAAGGAAGGAGG - Intergenic
923650007 1:235865331-235865353 CAGAGAAAAAGCACGGAAGAGGG - Intronic
923822614 1:237462274-237462296 CAGAGAGAAAACCAAGAAGGTGG + Intronic
923986174 1:239385590-239385612 GAAAGAAAAAGGAAGGAAGGAGG - Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924931351 1:248735293-248735315 TAGAAAAAAAATAAGTCAGGCGG - Intronic
1063014308 10:2059946-2059968 CAAAGAAAGAATAAACAAGGCGG + Intergenic
1063026976 10:2189488-2189510 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1063045490 10:2387979-2388001 CAAATAAAAAATAAGAAAGGTGG - Intergenic
1063049430 10:2430816-2430838 AAGAAAGAAAATAAGGAAGGAGG + Intergenic
1063128719 10:3159046-3159068 CATTGAAAAAAAAAGGAACGGGG + Intronic
1063181165 10:3601699-3601721 CAGAAATAGAATGAGGAAGGAGG + Intergenic
1063184436 10:3638005-3638027 CAGAGAAAGAATAAGAAATCTGG - Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063284258 10:4666087-4666109 CATAGGAAAAAGAATGAAGGTGG - Intergenic
1063440291 10:6067455-6067477 TGCAGAAAAAAAAAGGAAGGAGG + Intergenic
1063553484 10:7055608-7055630 CAAAGAAAAAACAGGCAAGGGGG + Intergenic
1064019832 10:11800081-11800103 AAGAAAAATAATAAGGAAAGCGG - Intergenic
1064221375 10:13443410-13443432 CAGAGACAAGAAAATGAAGGCGG + Intronic
1064291860 10:14042295-14042317 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1064421731 10:15196687-15196709 AAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1064463307 10:15555692-15555714 CAAAAAAAAAAAAGGGAAGGTGG - Intronic
1064834995 10:19516735-19516757 AAGAGAAAGAACAAGGAAGAAGG - Intronic
1064861642 10:19833057-19833079 AGTAGAAAAAATAAGGAAGTTGG + Intronic
1065090385 10:22227338-22227360 AAGAAAAAAAAAAAGGTAGGTGG - Intergenic
1065095124 10:22272798-22272820 CAAACAAAAAAAAAGGAGGGTGG - Intergenic
1065360040 10:24880993-24881015 AAGAGAGAAAGGAAGGAAGGAGG - Intronic
1065497279 10:26342089-26342111 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1065575747 10:27116366-27116388 CAGATAAAAAATAAGCAAAGAGG + Intronic
1065638579 10:27755811-27755833 CAGAGACAAAATAACCAAAGAGG - Intergenic
1065698832 10:28404904-28404926 AAAAAAAAAAAGAAGGAAGGCGG + Intergenic
1065745369 10:28836188-28836210 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1065845801 10:29742220-29742242 CAGAGAGAAACCAAGGAAGCTGG - Intergenic
1065944574 10:30594951-30594973 AAGAGAAGATATCAGGAAGGAGG + Intergenic
1066239778 10:33522362-33522384 AAGAGAACAAACAAGCAAGGTGG + Intergenic
1066369203 10:34805980-34806002 AAGACAAAAAAAAAGGAAGAAGG + Intronic
1067009039 10:42692233-42692255 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
1067798714 10:49341290-49341312 CACAGAAAAAAGAAAGAAAGAGG + Intergenic
1067833538 10:49623922-49623944 CACAGGAAGAACAAGGAAGGAGG - Intronic
1068201429 10:53788634-53788656 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1068233510 10:54202319-54202341 AAGAGAAAAAAAAAAGAGGGAGG + Intronic
1068262360 10:54599384-54599406 CTGACAAAAAATAAGTAATGGGG + Intronic
1068272078 10:54741472-54741494 CAGAAAAAAAATGAAGAATGGGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068579331 10:58721226-58721248 GAGAGAAAAACCATGGAAGGGGG - Intronic
1068851138 10:61742464-61742486 CAAAGAAAAAAAAAGGCAAGTGG + Intronic
1068879975 10:62037651-62037673 AAGAAAAATAATAAAGAAGGGGG - Intronic
1068895512 10:62195552-62195574 AAGACAAAAAGGAAGGAAGGAGG + Exonic
1068960366 10:62861170-62861192 CAGAGACAAACACAGGAAGGGGG - Intronic
1069180017 10:65347285-65347307 CATAGCAAAAAGAAGGAAAGAGG + Intergenic
1069213636 10:65792476-65792498 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1069281342 10:66658495-66658517 CAGTGAAAATATAAGAGAGGAGG + Intronic
1069533196 10:69233897-69233919 CAAAAAAAAAAAAAGGAATGGGG + Intronic
1069696260 10:70387704-70387726 TATAGCAAAAATCAGGAAGGTGG - Intergenic
1070013570 10:72501638-72501660 AGGAGAAAAAATAAAGAAAGAGG + Intronic
1070072603 10:73104201-73104223 CAGACAAAAAGTAAAGAAGAGGG + Intergenic
1070548821 10:77474632-77474654 GAGAGAAAAAAAAAAGAATGTGG - Intronic
1071409737 10:85377354-85377376 CAGAGAGAGAATAAGGAGGGAGG + Intergenic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072111341 10:92323035-92323057 CTGAAAAAGAATAAAGAAGGTGG - Intronic
1072248236 10:93561615-93561637 CAGAGGAAAAATAAGAAAACCGG + Intergenic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072946800 10:99817528-99817550 AAGAGAAAAAGTGAGGATGGTGG + Intronic
1073625495 10:105091569-105091591 GAGATGAAAAGTAAGGAAGGAGG - Intronic
1073704714 10:105970143-105970165 AAGAGAAAGAAGAACGAAGGAGG + Intergenic
1073834970 10:107430711-107430733 CAGACAAAAATTACGGAAGCAGG - Intergenic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1073967601 10:109009371-109009393 CAGAGAAAATATAATGAATAAGG - Intergenic
1074105622 10:110387883-110387905 AAGAGAAAAAAAAAGAAACGAGG + Intergenic
1074255655 10:111799789-111799811 CATAGAAAAAATAAACAAGTTGG + Intergenic
1074400409 10:113137013-113137035 AAGAAAAAAAAAAAGGCAGGTGG - Intronic
1074599267 10:114897200-114897222 CAGAGAAGAACAAAGGAAGGAGG - Intronic
1074675765 10:115848933-115848955 AAAAGATAAAATAAGCAAGGAGG - Intronic
1074874127 10:117601156-117601178 AAAAGAAAAAATAAAGAAGGAGG - Intergenic
1075490383 10:122862747-122862769 CAAAGAAAATATAAGGCAGAAGG - Intronic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076409916 10:130241216-130241238 CAGAGAAAAAATATGAACAGAGG - Intergenic
1076430264 10:130396954-130396976 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1076479701 10:130777070-130777092 TAGGGAGAGAATAAGGAAGGTGG + Intergenic
1077789732 11:5425055-5425077 CAGAGAAAAAATAAAACATGAGG - Intronic
1077984415 11:7336604-7336626 CTGAGAAAAAACAAGCAATGGGG - Intronic
1078073792 11:8138831-8138853 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1078115169 11:8441153-8441175 CACAGAAAAACTAAGGTACGTGG + Intronic
1078221878 11:9358105-9358127 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1078672988 11:13381476-13381498 GGGAGAAAGAATAAGGAATGGGG + Intronic
1078718129 11:13858976-13858998 CAGAGCAGAAGCAAGGAAGGGGG + Intergenic
1078949577 11:16115123-16115145 GAGAGAAAAAGTAAATAAGGAGG + Intronic
1079030303 11:16981686-16981708 AAGAGAAAAATGAAGGAATGAGG + Intronic
1079042376 11:17070737-17070759 AAGACAGAAGATAAGGAAGGAGG + Intergenic
1079217179 11:18524341-18524363 CACATAAAACATAAGGCAGGTGG + Intronic
1079481739 11:20888242-20888264 AAGAGAAGAAAATAGGAAGGAGG + Intronic
1079881489 11:25932863-25932885 CAAAAAAAAAAAAAAGAAGGGGG - Intergenic
1080068631 11:28051242-28051264 CAGACAAAGAATAATGAAGAAGG + Intronic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080316141 11:30951026-30951048 TAAAGAAAAAATAAGGGAGTGGG + Intronic
1080365826 11:31573005-31573027 CTCAAAAAAAGTAAGGAAGGAGG + Intronic
1080492030 11:32775780-32775802 AAGAGATAAAATAAGAAAGTAGG - Intronic
1080519690 11:33057086-33057108 CAGTGAAAAAAAAAAGGAGGGGG - Intronic
1080680766 11:34473675-34473697 GAGAGAAGAAAAAAGGAAGAAGG - Intergenic
1080796915 11:35573335-35573357 TAGAGAAAAACTAAGGAAACAGG - Intergenic
1080962904 11:37181002-37181024 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1081130316 11:39371284-39371306 CACAGAAAAAGTAAAAAAGGAGG + Intergenic
1081318016 11:41655194-41655216 CAGAAAGAAAAAAAGGAAAGAGG - Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1081578295 11:44333594-44333616 CAGAAAAAAAATAAGGAGCAGGG - Intergenic
1081824997 11:46041270-46041292 AAGATAAAAAGTAAGGAGGGTGG + Intronic
1081907261 11:46677942-46677964 CAGAAAAAAAAAAAAAAAGGTGG + Exonic
1082820030 11:57538454-57538476 GAGAGAATAAGAAAGGAAGGTGG + Intergenic
1082830144 11:57610928-57610950 AAGAGAAAAAAAAAAGAAGAAGG - Intronic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1083216314 11:61222524-61222546 GAGAGAAAAAAAAGGGAAGAAGG - Intronic
1083219196 11:61241350-61241372 GAGAGAAAAAAAAGGGAAGAAGG - Intronic
1083538566 11:63494225-63494247 CTGAGGAAGAATAAGTAAGGAGG - Intergenic
1083539136 11:63499866-63499888 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1083607768 11:63989014-63989036 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
1084213995 11:67637558-67637580 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1084392336 11:68885791-68885813 CCGACAAAAAAAAAGGCAGGGGG - Intergenic
1084415479 11:69030184-69030206 GAGAGAGAAAAAAAGAAAGGAGG - Intergenic
1084485702 11:69446909-69446931 CAGAAAAAAAAAAAAGAATGTGG - Intergenic
1085005535 11:73085500-73085522 AAGAGAAAAATTAAGGGAGAAGG - Intronic
1085473687 11:76774367-76774389 AAGAGGAAAAAAATGGAAGGTGG - Intergenic
1085543122 11:77290864-77290886 AAGACAAAAAATAAAGAAGCTGG + Intronic
1085595646 11:77806778-77806800 GAGTGAAAAAACAAGGGAGGAGG + Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085806193 11:79638656-79638678 GAGAAAAACAATAAGGAGGGAGG + Intergenic
1086187104 11:84031513-84031535 CAGAGAGAAAACAATGAAGTTGG + Intronic
1086221784 11:84454077-84454099 CAGGGAAAAAATAATTCAGGAGG + Intronic
1086539059 11:87885846-87885868 CAAAGAATAAATAGGGATGGGGG + Intergenic
1086585573 11:88447801-88447823 GAAAGAAAAAAAAAGGGAGGCGG + Intergenic
1086741405 11:90373801-90373823 CAGAGTGAAAATAAGTAATGAGG - Intergenic
1086772812 11:90790543-90790565 GAGAGAGAAAGTCAGGAAGGTGG + Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1087028264 11:93673945-93673967 AAGAAAAAAAAAAAAGAAGGGGG - Intronic
1087176090 11:95097195-95097217 AGGAGAAAAAGCAAGGAAGGAGG + Intronic
1087344423 11:96952625-96952647 CAGAGAAAATATAAGAAATGCGG - Intergenic
1087406992 11:97743088-97743110 AAAAGAAAAAAAAAGAAAGGGGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087707139 11:101506019-101506041 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1087965386 11:104406493-104406515 CAGACCAAAAATAAAGAGGGAGG + Intergenic
1087995571 11:104803475-104803497 CAGAGAAAATAAAAGCAAGAAGG + Intergenic
1088102845 11:106174084-106174106 CAGAGGAGAACCAAGGAAGGAGG + Intergenic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088297197 11:108312310-108312332 CAGAAAAAAACTAATGAAGGTGG - Intronic
1088306238 11:108411007-108411029 CAAAGAAAGTAAAAGGAAGGGGG - Intronic
1088412659 11:109552440-109552462 CAGAAAAAAAATAAATAAGGAGG + Intergenic
1088438394 11:109841148-109841170 AAGAGAAGAAGGAAGGAAGGAGG + Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088535972 11:110861877-110861899 CAGAGAAAAATTAAACAAGTGGG - Intergenic
1088593356 11:111421910-111421932 CAGACAAAAAAAAAGGCAGAAGG + Intronic
1089005895 11:115090546-115090568 AAGACATAAAACAAGGAAGGAGG + Intergenic
1089255378 11:117191275-117191297 CAAAAAAAAAAAAAAGAAGGGGG + Intronic
1089558529 11:119330528-119330550 GAGAGAAAAAAAAAGAAAGAAGG - Intergenic
1090106416 11:123857325-123857347 CACAGAAAAAAAAAAAAAGGGGG - Intergenic
1090337160 11:125978402-125978424 CAGAGAAAAAGAAAAGAAGAAGG + Intronic
1090564589 11:127974732-127974754 AAGAGAAATAAAAAGTAAGGCGG + Intergenic
1090779914 11:129998740-129998762 CACAGAAAAATTTTGGAAGGTGG + Intronic
1090818852 11:130322513-130322535 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1091214017 11:133889085-133889107 CAGAGACAAAGAAAGGATGGAGG + Intergenic
1091423141 12:361190-361212 CAGAAAAAAAAAAATGGAGGGGG - Intronic
1091853531 12:3720365-3720387 GAGAGAGAAACGAAGGAAGGGGG + Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1091918294 12:4284713-4284735 AAGAAAAAAAAAAAGAAAGGAGG - Intronic
1091979248 12:4852372-4852394 CAGAGGAAAATCAAGCAAGGGGG + Intergenic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092585253 12:9893700-9893722 CAAAGAAAAAAAAGGGAGGGAGG - Intronic
1092697239 12:11186323-11186345 CAGAAATAAAAAAAGCAAGGAGG + Exonic
1092868165 12:12782556-12782578 AAGTCAAAAAATAAGGCAGGAGG + Intronic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093039821 12:14365348-14365370 TAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1093068099 12:14679888-14679910 ATGAAAAAAAAAAAGGAAGGAGG - Intronic
1093076671 12:14766094-14766116 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1093291758 12:17333410-17333432 AAGAGAAAAAACACGCAAGGGGG - Intergenic
1093437675 12:19155000-19155022 CAGAAAGAAAATGAGGAAAGGGG + Intronic
1093566387 12:20610026-20610048 AAGAGAAAAAATAAGTAAATGGG + Intronic
1093812169 12:23504385-23504407 CACAGGAAAAATAAGCAAAGTGG + Intergenic
1093932761 12:24970629-24970651 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1094026103 12:25960658-25960680 GAGGAAAAAAATGAGGAAGGGGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094158755 12:27367576-27367598 CAGAAAAATAGAAAGGAAGGGGG - Intronic
1094346939 12:29480766-29480788 CAGAGATAATATAAAGAAGGAGG - Intronic
1094661744 12:32475899-32475921 CAGAGGAAATATAAAGAAGTTGG - Intronic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095169079 12:39011962-39011984 CTTAGAAAAAAAAAGGAAAGAGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095750370 12:45703980-45704002 CATACAAAAAAAAAGGAAAGAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096663861 12:53149085-53149107 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1097126500 12:56780525-56780547 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1097577241 12:61410074-61410096 CAGAGAAAAGATATTGAAAGTGG + Intergenic
1097667360 12:62495416-62495438 AAGAGTAAGAATAGGGAAGGAGG + Intronic
1097729090 12:63107343-63107365 CAGAGGAAAAATCAAGACGGAGG - Intergenic
1098014527 12:66090417-66090439 CAGAGAAAAGATAGAGAAAGAGG + Intergenic
1098086318 12:66848206-66848228 GAGAGAAAAGAAAGGGAAGGAGG - Intergenic
1098211640 12:68172392-68172414 CAGAGAAGAAACATGGAAGATGG - Intergenic
1098383234 12:69891623-69891645 GAAAGAAAAAGAAAGGAAGGAGG - Intronic
1098486275 12:71025567-71025589 CAGAGCAAAAATACAGATGGAGG + Intergenic
1098706703 12:73700917-73700939 GAGATAAAAATTAAGGAATGGGG + Intergenic
1098791836 12:74834119-74834141 AAGAGAAAAAGAAAGAAAGGAGG - Intergenic
1098873832 12:75846165-75846187 CAGAGAAGAAATAAAGGACGTGG - Intergenic
1099055311 12:77833111-77833133 CAGAAAAAGAATTGGGAAGGAGG - Intronic
1099115368 12:78617722-78617744 AAAAGAAAAAAGAAAGAAGGGGG + Intergenic
1099211377 12:79793209-79793231 CAGCCAAACAATCAGGAAGGGGG + Intronic
1099223119 12:79937083-79937105 CAGGGAAAAAACAACCAAGGAGG + Intergenic
1099241584 12:80145321-80145343 CTGAGAAAAAACAAGCAACGGGG - Intergenic
1099275129 12:80565482-80565504 AAGAAAAAAAATAGGGGAGGAGG - Intronic
1099303938 12:80931955-80931977 CGGAGAAAGATTAAGGAAGAAGG - Intronic
1099643349 12:85319376-85319398 AAGAAAGAAAATAAGTAAGGAGG - Intergenic
1099670201 12:85681503-85681525 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1100036160 12:90254562-90254584 AAGTGAAAAAATATGGATGGGGG + Intergenic
1100174296 12:92011935-92011957 CAGAAAGGAAAAAAGGAAGGAGG + Intronic
1100286257 12:93169528-93169550 AAGAGAGAAAGAAAGGAAGGAGG + Intergenic
1100375259 12:94009046-94009068 CAGATACAAAATAAAAAAGGTGG - Intergenic
1100412998 12:94340857-94340879 GAGAGAGAAAATAAGAGAGGAGG + Intronic
1100519228 12:95357409-95357431 TAAATGAAAAATAAGGAAGGAGG - Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1100817730 12:98401838-98401860 CAGAAAAAAAAAAAAGAATGGGG + Intergenic
1101035865 12:100705828-100705850 CAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1101199033 12:102415611-102415633 GAGAGAAGAAGGAAGGAAGGAGG - Intronic
1101435061 12:104657556-104657578 CAGAGAAAAAACATGGGAGCGGG - Intronic
1101502514 12:105317164-105317186 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1101535961 12:105616710-105616732 CAAAGAAAAGAAATGGAAGGAGG - Intergenic
1101549636 12:105750057-105750079 CAAAGTGATAATAAGGAAGGAGG - Intergenic
1101752467 12:107593761-107593783 CAGAGCAACAAGAGGGAAGGTGG - Intronic
1101784017 12:107865907-107865929 CTGACAAAAAATAAGCAATGGGG + Intergenic
1101983205 12:109425617-109425639 CAAAGAAACACAAAGGAAGGTGG + Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102094656 12:110227754-110227776 GAGAGAGAAAAAAAGGAAGGAGG + Intergenic
1102099744 12:110269337-110269359 CAGATAAAAAGGAAGGAAGGAGG - Intergenic
1102101889 12:110285554-110285576 CTGAGAAAAATAAAGCAAGGGGG + Intronic
1102243539 12:111340834-111340856 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1102780215 12:115557790-115557812 AACAGAAAAAAAAAGAAAGGAGG + Intergenic
1103245775 12:119455939-119455961 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1104062407 12:125279611-125279633 AAGAGAGAATATAAGGAAGCTGG + Intronic
1104152828 12:126100929-126100951 AAGAAAAAAAGGAAGGAAGGAGG + Intergenic
1104188339 12:126454144-126454166 CAGAGGAGAACAAAGGAAGGCGG + Intergenic
1104233518 12:126908751-126908773 CAGATGACAGATAAGGAAGGAGG + Intergenic
1104455738 12:128910922-128910944 AATAAAAAAAATAAAGAAGGTGG - Intronic
1104956517 12:132469235-132469257 TGGAGAAAAAGTAAGGGAGGGGG + Intergenic
1105037482 12:132937056-132937078 CAAAGAAAATATATGGAAGGTGG + Intronic
1106308188 13:28532058-28532080 AAGAGAAAGAAAAAGAAAGGGGG + Intergenic
1106609920 13:31268875-31268897 CAGAGAAAGAAAAAAGAAAGAGG - Intronic
1106825571 13:33516940-33516962 CAGAAAAAAAAAAAAAAAGGAGG + Intergenic
1107311385 13:39082212-39082234 AATAGAAAATATAAGAAAGGGGG - Intergenic
1107625039 13:42272965-42272987 CAGAGAAAAAAAATGAAAGCTGG - Intronic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108020493 13:46123157-46123179 CATAGTAAATGTAAGGAAGGTGG + Intergenic
1108036595 13:46296640-46296662 GAGAGAAAGAATCAGAAAGGCGG - Intergenic
1108048013 13:46401670-46401692 GAGAGAGAAAAAGAGGAAGGAGG - Intronic
1108075838 13:46678946-46678968 CTCTGAATAAATAAGGAAGGAGG - Intronic
1108242675 13:48483058-48483080 CAGAGAAAAACAAAGCAAAGAGG + Intergenic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108412172 13:50160755-50160777 CAGTAAAAAGATAAGGAATGGGG - Intronic
1108742169 13:53349573-53349595 CAGAAAAATAACATGGAAGGAGG - Intergenic
1108794730 13:54017705-54017727 CACACACAAAACAAGGAAGGAGG + Intergenic
1108830005 13:54465455-54465477 CAGGGAAAGAATAAACAAGGAGG + Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109314082 13:60729298-60729320 AAGACAAAAATTAAGGAAGTGGG - Intergenic
1109464156 13:62706744-62706766 CAGAGAAGAGAAAAAGAAGGTGG - Intergenic
1109745161 13:66614954-66614976 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1109765209 13:66886355-66886377 CAGAGTTAAAATCAGAAAGGGGG + Intronic
1109793931 13:67285469-67285491 CTGAGAAGAAATAAGAAGGGAGG + Intergenic
1109959488 13:69612438-69612460 CAAAGAAAATATTAAGAAGGTGG + Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1109991215 13:70060053-70060075 CAGAGAATACATAAGGAACTTGG + Intronic
1110021784 13:70482520-70482542 AGGAGGAAAAATAAGAAAGGTGG + Intergenic
1110378791 13:74825447-74825469 CAGAAAGAAAAAAAGGGAGGGGG - Intergenic
1111030813 13:82595800-82595822 CTGAGCAAAAATAAGAAAGCTGG + Intergenic
1111255920 13:85668753-85668775 CAGAAAAGAAGCAAGGAAGGGGG + Intergenic
1111354733 13:87083485-87083507 CAGAGAAAAAATTAGAAGGCAGG - Intergenic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111457148 13:88499721-88499743 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
1111694058 13:91601379-91601401 TAGAGATAAAATAAGGGAGAAGG + Intronic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1111836758 13:93397756-93397778 CAGAGAAAAAAAAAAAGAGGAGG - Intronic
1111860497 13:93698821-93698843 GAGAGAAAAAAGGAAGAAGGAGG - Intronic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1112027009 13:95420392-95420414 AAGAAAAGAAAAAAGGAAGGTGG + Intergenic
1112119136 13:96390735-96390757 CCCAGAAAGAGTAAGGAAGGGGG - Intronic
1112126514 13:96474157-96474179 CAGAGGAAAAAAATTGAAGGAGG - Intronic
1112136475 13:96584028-96584050 AAGAGAAATAAAATGGAAGGGGG - Intronic
1112251088 13:97781107-97781129 AAGAAAAAAAAAAAGGAGGGAGG + Intergenic
1112349827 13:98623638-98623660 CAGATACCAAATAAGGAACGTGG - Intergenic
1112518556 13:100077274-100077296 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1112533718 13:100229595-100229617 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1113159272 13:107361577-107361599 TAGAGAAGAAATAATGCAGGAGG + Intronic
1113165732 13:107439597-107439619 GAGAGAAAGAATATGGAAAGGGG - Intronic
1113221422 13:108107971-108107993 GAGAGAGAAAGAAAGGAAGGAGG + Intergenic
1113283253 13:108814375-108814397 TAGGGAAAAATTAAGGCAGGAGG - Intronic
1113299030 13:108996309-108996331 CAGAGAAAAATTGTGAAAGGAGG + Intronic
1113636512 13:111922714-111922736 CAGAGCAAAAATACTGGAGGTGG - Intergenic
1113898873 13:113784750-113784772 GAGAGAAAAGACAAGGCAGGTGG + Intronic
1114011106 14:18369570-18369592 CAAAAAAAAAATGATGAAGGAGG - Intergenic
1114133821 14:19823846-19823868 AAAAAGAAAAATAAGGAAGGAGG + Intronic
1114192285 14:20449020-20449042 GAAGAAAAAAATAAGGAAGGAGG + Intronic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114331480 14:21641563-21641585 GAAAGAATAAAAAAGGAAGGAGG - Intergenic
1114479283 14:23022040-23022062 CAGAGAGAAAACATGGAACGAGG + Intronic
1114878443 14:26752517-26752539 CAGAGAGAAAATATGGCAGTGGG - Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115048199 14:29024068-29024090 CTGACAAAAAACAAGGAATGGGG - Intergenic
1115064684 14:29243624-29243646 CACAGACAAAATAAGAAAGCTGG + Intergenic
1115101393 14:29705150-29705172 CAGGGATAAAATAAGGATAGTGG - Intronic
1115108147 14:29785878-29785900 CAAAAAAAAAAAAAGGAAAGTGG + Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115283621 14:31692938-31692960 CAGGGAAAAAAAAAAGAATGTGG - Intronic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115599095 14:34938508-34938530 CAAAGAAAAAAAAGGGCAGGGGG - Intergenic
1115715666 14:36100153-36100175 AGGAAAAAAAAAAAGGAAGGTGG - Intergenic
1115726535 14:36223303-36223325 CAGAGGAAGGATAAGGAAAGAGG + Intergenic
1115779563 14:36754395-36754417 GATAGAAAAAATAAGGTGGGTGG + Intronic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1115821366 14:37215597-37215619 CAGAGAACAAATAAAGTAGGTGG + Intronic
1115962536 14:38851823-38851845 CAGAAAAAAAAAAAAAAAGGTGG + Intergenic
1116169300 14:41379278-41379300 CAAAGAAATAATAAAAAAGGGGG + Intergenic
1116312025 14:43340066-43340088 GAAAGAGAAAATAAAGAAGGAGG + Intergenic
1116649157 14:47566898-47566920 AAGAAAAAAAAAAAGGAAGATGG - Intronic
1116785281 14:49281247-49281269 TAGAAAGAAATTAAGGAAGGAGG + Intergenic
1117175639 14:53143618-53143640 CAGAGGACAACAAAGGAAGGAGG + Intronic
1117180276 14:53184231-53184253 CAGAGGAGAACAAAGGAAGGTGG + Intergenic
1117202831 14:53410062-53410084 CAGAGAAAAAAGAAGTTATGTGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1118266723 14:64301734-64301756 CAGAGAAAAATCAAAGAAGTTGG - Intronic
1118313938 14:64713757-64713779 CAGAGAAAAAAAAAGGAAATGGG - Intronic
1118449512 14:65887126-65887148 CAAAGAAAAAAAAAAAAAGGTGG + Intergenic
1118473978 14:66100220-66100242 CAGAGAGAAAATTATGAAAGTGG + Intergenic
1118555732 14:67018819-67018841 CAGAAAAAAAATAAAGATTGTGG - Intronic
1118788631 14:69068080-69068102 CATAAAAAAGATAATGAAGGAGG - Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119135582 14:72215653-72215675 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1119146745 14:72323519-72323541 CAAAGGAAAATTAAGAAAGGGGG + Intronic
1119448735 14:74689428-74689450 CATAGAGAATAAAAGGAAGGAGG - Intronic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119793091 14:77370948-77370970 CAGAAAAAAAAAAAGGTCGGGGG + Intronic
1119794004 14:77379382-77379404 CAAAAAAAAAAAAAGAAAGGAGG - Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120005859 14:79357226-79357248 CAGAAAGAAAATAATGATGGAGG - Intronic
1120288174 14:82532333-82532355 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1120640203 14:87001160-87001182 CAGAAAGAAACTAAGGAGGGAGG - Intergenic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121078310 14:91087624-91087646 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1121083138 14:91125005-91125027 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1121624604 14:95374946-95374968 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624635 14:95375049-95375071 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121788263 14:96679477-96679499 CTGTGAAAAAATCAGGAAGGAGG - Intergenic
1122366958 14:101200032-101200054 CAAAGAAAAAAAAAAGATGGCGG + Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122547943 14:102535057-102535079 CAGAGAAAAAAAAAAGGGGGGGG + Intergenic
1122578493 14:102756519-102756541 GAAAGAAGAAATAAGGAAGGAGG - Intergenic
1122896871 14:104762512-104762534 CAGAAAAAAAATGAGGAAAATGG + Intronic
1123576892 15:21679433-21679455 AAAAAGAAAAATAAGGAAGGAGG + Intergenic
1123613514 15:22121901-22121923 AAAAAGAAAAATAAGGAAGGAGG + Intergenic
1123776557 15:23586333-23586355 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1123792224 15:23733250-23733272 CAGATAAAAATTAAGAAAGGAGG - Intergenic
1123832298 15:24152935-24152957 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1123847597 15:24318625-24318647 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1123866638 15:24526008-24526030 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1124238295 15:28008459-28008481 CAGAGGACAACAAAGGAAGGAGG - Intronic
1124469930 15:29975266-29975288 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1124607474 15:31180795-31180817 CAGAGAGAAAATAAAGAAATAGG + Intergenic
1124656418 15:31512665-31512687 CAGAGGAGAATAAAGGAAGGAGG + Intronic
1124718374 15:32088926-32088948 CAAAGAAAAAATTAGTAAGTTGG - Intronic
1124815846 15:32991172-32991194 CCGAGAGAAAATAAAGAATGAGG - Intronic
1124972103 15:34497237-34497259 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1125082592 15:35692939-35692961 CATAGAAAATATATGGAAGCAGG + Intergenic
1125108104 15:35997621-35997643 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1125175131 15:36812297-36812319 CAAAGATTAAATAAGGAAGATGG + Intergenic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125670579 15:41469520-41469542 CAAAAAAAAAAAAAGGAACGTGG - Intronic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1126020643 15:44397566-44397588 AAGAGAAAAAAGAAGTAATGAGG - Intronic
1126108298 15:45161427-45161449 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1126347567 15:47712336-47712358 TAGAAAAAAAATAAGGATTGAGG + Intronic
1126572303 15:50165037-50165059 AAAAGAAAAAAAAAGGAAAGAGG - Intronic
1126684209 15:51233191-51233213 TAGAAAAAGAATAGGGAAGGAGG - Intronic
1126737068 15:51741090-51741112 CTGAGGAAGAATTAGGAAGGAGG + Intronic
1126840815 15:52715663-52715685 GGGAGAACAAAAAAGGAAGGAGG + Intergenic
1126932634 15:53671932-53671954 AAGAGAAAAAAAAGGGAAGAGGG + Intronic
1127047347 15:55041136-55041158 CTGAGCAAAAATAAGAAAGCTGG - Intergenic
1127118543 15:55751029-55751051 CAGAGAGAAAATTAGGAATAAGG + Intergenic
1127164099 15:56225986-56226008 CAGAGAAAAAATATAAAAAGAGG + Intronic
1127517823 15:59713421-59713443 AAGAAAAAGAAAAAGGAAGGAGG - Intergenic
1127599152 15:60517978-60518000 CTGAGAAGAAATATGCAAGGTGG - Intronic
1127769517 15:62219638-62219660 AAAAGAAAAAAAAAGGAAAGTGG + Intergenic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128244558 15:66124266-66124288 CAGAGAATGAATAAAGAAGCGGG + Intronic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128424328 15:67524381-67524403 CAAAGAAAAAAAAAGGCAAGTGG - Intronic
1128596670 15:68957991-68958013 CAGAGAAGAATCAAGGAAGGAGG + Intronic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1129495125 15:75972634-75972656 CTGACAAAAAATAAGTAAGGGGG - Intronic
1129943027 15:79514857-79514879 TAAAGAAAAAAAAAAGAAGGAGG - Intergenic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1130521680 15:84666417-84666439 CACACAAAAAAGAAGGAAGCAGG + Intergenic
1130698509 15:86155489-86155511 CAGATAAAAAGTCAGGAGGGTGG + Intronic
1130879117 15:88039910-88039932 CAGAGGAGAACCAAGGAAGGAGG + Intronic
1130975745 15:88772820-88772842 CAGGGAATGAGTAAGGAAGGGGG + Intergenic
1131010309 15:89012009-89012031 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1131081751 15:89542461-89542483 CAGAGAAAAACGAAAGAAGAAGG - Intergenic
1131126169 15:89859248-89859270 AAGAAAAAAAGGAAGGAAGGAGG - Intronic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131499686 15:92950007-92950029 CAGTGGAAAACAAAGGAAGGGGG + Intronic
1131625314 15:94112300-94112322 CAGAGTAAATGTAAGGAAAGCGG - Intergenic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1131744591 15:95433347-95433369 TATAGAAAAAAAAATGAAGGAGG - Intergenic
1131789539 15:95949127-95949149 CACAGAAATAATAAGACAGGAGG - Intergenic
1131913154 15:97231504-97231526 AAGAGAGGAAAGAAGGAAGGAGG + Intergenic
1132004982 15:98218701-98218723 CAGCGACAAAATAGGGAAGCTGG - Intergenic
1202985760 15_KI270727v1_random:413678-413700 AAAAAGAAAAATAAGGAAGGAGG + Intergenic
1132825977 16:1905821-1905843 CAGAAAAAAAAAAAGCAAAGTGG - Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133526423 16:6610085-6610107 CAGAAATAAAATAAGAACGGAGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133591572 16:7249317-7249339 TAGAGAATAAATAAGATAGGAGG + Intronic
1133665833 16:7966841-7966863 CTGAGAAAAAGTAAGGAACACGG - Intergenic
1133783764 16:8959414-8959436 CAGAGAAAAAATTAATAATGAGG + Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134268271 16:12710454-12710476 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135521514 16:23182190-23182212 AAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1135560750 16:23474862-23474884 CAGGGAAAAAAAAAAAAAGGTGG + Intronic
1135686719 16:24503702-24503724 CAGAGATAAATGAAGGAGGGAGG + Intergenic
1135731258 16:24896934-24896956 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1135739428 16:24960818-24960840 AAGAAAAAAAAAAAGGCAGGGGG + Intronic
1135898787 16:26435502-26435524 AAGAAAAAAAATATGGAAGGAGG - Intergenic
1135904667 16:26500259-26500281 GAGAGAAAAAAAAAAGAAGAAGG + Intergenic
1136476592 16:30517461-30517483 CAAAGAAAAAAAAATCAAGGGGG + Intronic
1136490752 16:30606491-30606513 AAGAAAAAAAAAAAGAAAGGTGG - Intronic
1136638845 16:31544733-31544755 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1136666174 16:31815070-31815092 TAGAGGAGAAAAAAGGAAGGAGG + Intergenic
1136677415 16:31923929-31923951 CAGCCAGAAGATAAGGAAGGGGG + Intergenic
1136926152 16:34376354-34376376 CACACACAAAATAATGAAGGAGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1136978422 16:35035453-35035475 CACACACAAAATAATGAAGGAGG - Intergenic
1137254258 16:46761913-46761935 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1137411806 16:48234919-48234941 CAGAGAAAGAATCAGGAACCTGG - Intronic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137772915 16:51031573-51031595 GAGAGAAAGAAAAAGGAAAGAGG + Intergenic
1137882238 16:52062087-52062109 AAGACCAAAAATAAGCAAGGGGG + Intronic
1137892911 16:52181027-52181049 AAGAAAAAAAATAGGCAAGGAGG + Intergenic
1137919677 16:52474726-52474748 AAGAAAAGAACTAAGGAAGGAGG + Intronic
1137942061 16:52698079-52698101 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1137977208 16:53042038-53042060 TGAGGAAAAAATAAGGAAGGAGG - Intergenic
1138243595 16:55448713-55448735 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
1138501665 16:57449079-57449101 CAAAGAAAAAATGAGGGAGGAGG + Intronic
1138645208 16:58419657-58419679 GAAAGAAAAAAAAAGGAAGGGGG + Intergenic
1138875617 16:60945192-60945214 CAGAGAATAAATAAGGTCAGTGG - Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1139494374 16:67305643-67305665 GACAGAAAAAAAAAGGGAGGGGG - Intronic
1139732042 16:68954255-68954277 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1140120601 16:72080131-72080153 AAAAAAAAAAAAAAGGAAGGTGG - Intronic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140297531 16:73724080-73724102 CAGACAAAAGAATAGGAAGGAGG - Intergenic
1140320657 16:73948539-73948561 CAAAGCAACAATAAGGAAGGTGG - Intergenic
1140419175 16:74803659-74803681 CATCAAAAAAATAGGGAAGGAGG - Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140828345 16:78728047-78728069 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1141066316 16:80916747-80916769 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
1141210512 16:81975077-81975099 AGGAGAAAAAATAAGCAAGCTGG + Intergenic
1141289654 16:82706051-82706073 AAGAGAGAGAATAAGGAAGAAGG - Intronic
1141334987 16:83146207-83146229 AAAAGAAAAGAAAAGGAAGGAGG + Intronic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1141710718 16:85697444-85697466 CAGACAAAAAATAAGAATAGGGG + Intronic
1142112012 16:88337995-88338017 CAGAGGAAAAATAGAGAAAGTGG - Intergenic
1142235250 16:88919158-88919180 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142318193 16:89362834-89362856 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142322368 16:89392019-89392041 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142441293 16:90099584-90099606 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
1142441662 16:90102383-90102405 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1142670794 17:1486503-1486525 AACAGAAAAAAAAAGGAGGGAGG - Intronic
1142828029 17:2526538-2526560 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143142443 17:4748795-4748817 GAGAGAAAAGATGAGGAGGGAGG - Intergenic
1143361203 17:6372767-6372789 CAGAGAGAAAAAAAAGAAGGAGG + Intergenic
1143433572 17:6905358-6905380 CAGAGAACCATTAAGGAAAGTGG - Intronic
1143481713 17:7230976-7230998 GAGAGGAGAAATAAGGAAAGGGG - Intronic
1143882426 17:10039909-10039931 AAGAGAAAAGACCAGGAAGGTGG - Intronic
1143914176 17:10276611-10276633 CAGAGAAAAAGTGAGGAGTGGGG - Intergenic
1143999945 17:11044428-11044450 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1144023214 17:11255316-11255338 AAGAGAAAAATGAAGGGAGGAGG + Intronic
1144297195 17:13887307-13887329 CAGAGAAAAAGAAAGAAAGAAGG + Intergenic
1144653999 17:17024112-17024134 CAAAGAAAAAAAAAAAAAGGTGG - Intergenic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145223990 17:21112579-21112601 AAGAAAAAAAAGAAGGCAGGAGG - Intergenic
1145322591 17:21775015-21775037 TACAGAAGAAATAAGGAAGAGGG - Intergenic
1145828364 17:27894354-27894376 AAGAGAAAAAAAAAGAAAAGAGG - Intronic
1145940336 17:28740292-28740314 AAAATAAAAAATAAAGAAGGAGG + Intronic
1145965679 17:28915179-28915201 TAAAGGAAAAATAAGGGAGGGGG + Intronic
1146587969 17:34099235-34099257 AAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146587994 17:34099466-34099488 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146956085 17:36937042-36937064 CAAAAAAAAAAAAAGGAAGGAGG + Intronic
1146982610 17:37179222-37179244 CAGAGATAAGAAAGGGAAGGGGG + Intronic
1147127839 17:38384588-38384610 CAAAGAAAAAAAAAAGAAGCTGG - Intronic
1147394593 17:40131998-40132020 GAGAGAAAAAGAAAGGGAGGAGG - Intronic
1147880686 17:43651558-43651580 AAAAGAAAAGAAAAGGAAGGGGG + Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148319007 17:46733342-46733364 AAAAGAAAAAAAAAAGAAGGTGG - Intronic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148411754 17:47473253-47473275 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1148505246 17:48122020-48122042 CAGTGAAAGAAAAAGCAAGGAGG - Exonic
1148554299 17:48569062-48569084 CCGAGAAAAAAAAAGAGAGGGGG - Intronic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1149282424 17:55122500-55122522 CAGAGATAAATGAAGGAATGTGG + Intronic
1149751656 17:59151959-59151981 CAAAGAGAAAATAATGATGGGGG + Intronic
1149796803 17:59528513-59528535 AAAAGAAAAAATAAAGAAAGAGG - Intergenic
1150169389 17:62976872-62976894 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1150202302 17:63370164-63370186 AAAAGAAAAAAAAAGAAAGGAGG - Intronic
1150402532 17:64870813-64870835 GAAAGAAAATAGAAGGAAGGGGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151463262 17:74268422-74268444 CTGAGAAAGAATAAAGAAGCAGG + Intergenic
1151484509 17:74389927-74389949 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1153090998 18:1342674-1342696 AAGAGGGAAAATAAGGAAGGAGG - Intergenic
1153397876 18:4645344-4645366 CAGACAAAACATATGGGAGGGGG + Intergenic
1153567091 18:6429553-6429575 CAGAGAGAAAAAAATGAAGGAGG - Intergenic
1153639523 18:7144727-7144749 AAAGAAAAAAATAAGGAAGGTGG + Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153756763 18:8291855-8291877 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1154020442 18:10660131-10660153 CAGAGAAAGAATTAGAAAGAGGG - Intergenic
1154136695 18:11786002-11786024 CAGGTAAGAAATAATGAAGGAGG - Intronic
1154332778 18:13443233-13443255 GGGAGAAAAAATGACGAAGGTGG - Intronic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1154395277 18:13981887-13981909 AAAAGAAAAAAGAAAGAAGGTGG - Intergenic
1155400695 18:25435907-25435929 CCTAGAAAAAATACAGAAGGTGG - Intergenic
1155444574 18:25897719-25897741 CAGATAAAAAAGAATGAAAGAGG - Intergenic
1155723946 18:29055238-29055260 CTGTAAAAAGATAAGGAAGGGGG + Intergenic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1156197845 18:34795792-34795814 CAGACTAACAATAAGGAAGGGGG + Intronic
1156251351 18:35355558-35355580 CAGAGAAAATAAAAGCAATGGGG + Intergenic
1156610688 18:38720396-38720418 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1156617895 18:38809686-38809708 CAGAGAGCAAATAATGAAGCAGG - Intergenic
1156795547 18:41041108-41041130 CAGAGAAATAAAAATGAAAGAGG - Intergenic
1156985172 18:43342259-43342281 CAGAGAAAGGATCAGGAATGGGG - Intergenic
1157154192 18:45248977-45248999 AAGAGAAAAATTATGGAACGTGG - Intronic
1157305697 18:46515863-46515885 CAGGGACAAAATAGGGAAGCTGG - Intronic
1157379429 18:47198597-47198619 GAGAGAAAAACTGAAGAAGGGGG + Intergenic
1157462696 18:47914782-47914804 CATCTGAAAAATAAGGAAGGGGG - Intronic
1157967460 18:52224346-52224368 GAGAGAAAGAGAAAGGAAGGGGG - Intergenic
1158080110 18:53579819-53579841 AACAAAACAAATAAGGAAGGTGG - Intergenic
1158760053 18:60374198-60374220 AAGAGAAAAAATAAGGCAAGAGG - Intergenic
1159212178 18:65338523-65338545 GAAGGAAGAAATAAGGAAGGAGG - Intergenic
1159259563 18:65995014-65995036 AAGAGCAAAAATAAGCAAGTAGG - Intergenic
1159324047 18:66892718-66892740 GGCAGAAAAAATAAGGAAAGAGG + Intergenic
1159557368 18:69959473-69959495 CTTAGAAAAAAAGAGGAAGGAGG - Intronic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159833956 18:73313324-73313346 CATAGAAAAGACAAGGAAGATGG - Intergenic
1160236853 18:77092701-77092723 GAAGGAAGAAATAAGGAAGGGGG + Intronic
1160320126 18:77883196-77883218 CCGACAAAAAATAAGCAATGAGG - Intergenic
1160354615 18:78216433-78216455 CCTAGAAAGAAAAAGGAAGGAGG - Intergenic
1160483248 18:79262130-79262152 GAGAGAAAAAGCAAGGAAAGGGG - Intronic
1160765869 19:807557-807579 AAGAAAAAAAATAGGGAAAGGGG - Intronic
1161476573 19:4489251-4489273 CAAAAAAAAAAAAAGAAAGGTGG - Intronic
1161897799 19:7095665-7095687 AAAAAAAAAAAGAAGGAAGGAGG + Intergenic
1161918771 19:7250559-7250581 TAAAGAAAAAGGAAGGAAGGAGG + Intronic
1161999794 19:7736499-7736521 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1162265975 19:9574659-9574681 CAGAGGAGAAGAAAGGAAGGAGG + Intronic
1162281415 19:9700819-9700841 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1162334098 19:10049659-10049681 GAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1162397572 19:10426000-10426022 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1162730548 19:12715862-12715884 CAAAGAAAAAAAAAAGGAGGGGG - Intronic
1162826195 19:13253738-13253760 CTCAAAAAAAATAAGGAAGCCGG - Intronic
1162826580 19:13255985-13256007 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1162865342 19:13541744-13541766 GAAAGAAAAAGTAAGGGAGGAGG + Intronic
1162994100 19:14322701-14322723 AAGAGAGAAATAAAGGAAGGAGG - Intergenic
1163326939 19:16610683-16610705 CATAGAAATTATAAGGATGGTGG - Intronic
1163339282 19:16694238-16694260 CAGCGAAAAAAAAAAAAAGGCGG + Intergenic
1163511520 19:17738321-17738343 CAAAAAAAAAAAAAGGAATGGGG + Intergenic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1163932334 19:20408198-20408220 TAGAAAAAAAATAAACAAGGAGG + Intergenic
1163946305 19:20538367-20538389 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1163973087 19:20819458-20819480 CAGAGGAGAATGAAGGAAGGAGG + Intronic
1163984850 19:20936620-20936642 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1164014127 19:21237050-21237072 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1164044921 19:21529015-21529037 CAAAGAAAACCTAAGGAAGAAGG - Intronic
1164230814 19:23286584-23286606 TAGAAAAAAAAAAAGGAAGAAGG + Intergenic
1164324418 19:24179438-24179460 GAGAGAAAAAGGAGGGAAGGAGG + Intergenic
1164523066 19:28993584-28993606 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1164861676 19:31566706-31566728 AAAAGAAAAAAGAGGGAAGGAGG + Intergenic
1164999858 19:32752172-32752194 AAAAGAAAAAATGAAGAAGGGGG - Intronic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1166164372 19:40976990-40977012 GAGAGAAAGGAAAAGGAAGGAGG - Intergenic
1166411627 19:42559404-42559426 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1166533649 19:43557806-43557828 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1167319515 19:48787640-48787662 CAGAGGAGAACAAAGGAAGGGGG + Intergenic
1167391975 19:49201303-49201325 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1167429135 19:49444228-49444250 AAGAGAAAGAAAAAGGAAGGAGG - Intergenic
1167429146 19:49444306-49444328 AAGAGAAAGAAAAAGGAAGGAGG - Intergenic
1167675475 19:50882024-50882046 AAGAGAAAAAACAAGGTAGCTGG + Intergenic
1167913865 19:52724911-52724933 GAAAGAAAAAATAAGAAAGCAGG - Intronic
1168439678 19:56353268-56353290 TAGAGAAAGAATATGAAAGGTGG + Intronic
925219636 2:2127725-2127747 CTGAGCAAAGATGAGGAAGGAGG + Intronic
925221976 2:2149100-2149122 AAGGAAGAAAATAAGGAAGGAGG - Intronic
925660299 2:6195228-6195250 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926595405 2:14784582-14784604 CTGAGAAAAAACAAGCAATGGGG - Intergenic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926902843 2:17774775-17774797 CAGAGAAAAAAAAAAAAATGGGG + Intronic
927142177 2:20137880-20137902 GAGAGAATGAATAAGGCAGGAGG - Intergenic
927149867 2:20189333-20189355 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
927175857 2:20406970-20406992 AAAAGAAAAAGGAAGGAAGGAGG - Intergenic
927426680 2:22988903-22988925 CTGAGAAAAAACAAGCAATGGGG + Intergenic
927720887 2:25381281-25381303 CAGACAAGAAAGAAGGCAGGAGG - Intronic
927810982 2:26180036-26180058 CAGAGGAAAAATGTGGAGGGGGG - Intronic
928081303 2:28314966-28314988 AAAAGAGAAAAGAAGGAAGGTGG + Intronic
928301269 2:30127383-30127405 AAGAAAAAAAAAAAGGAAGGAGG + Intergenic
928316656 2:30251688-30251710 CTAATAAAAAATAAGAAAGGTGG + Intronic
928331067 2:30358386-30358408 AACAGAAAAGATAAGGAAGAGGG - Intergenic
928529138 2:32172949-32172971 CAGAGAAATAGGAGGGAAGGCGG - Intronic
928705322 2:33943620-33943642 AAGAGAGAAAAGAAGGAAGTGGG + Intergenic
928737511 2:34309292-34309314 CTGAGAAAAAAAAAGCAATGGGG - Intergenic
929479968 2:42296338-42296360 CAAAAAAAAAGTAAGAAAGGAGG + Intronic
929929974 2:46246419-46246441 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
930190961 2:48459142-48459164 CCAAAAAAAAATAAGTAAGGAGG - Intronic
930197360 2:48522873-48522895 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
930204976 2:48578573-48578595 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
930226662 2:48800985-48801007 AAGAAGAAAAATAAGGAAAGAGG - Intergenic
930814639 2:55581899-55581921 CCGAGAAAAAAAAAAGAAGAAGG + Intronic
930984129 2:57564249-57564271 CAGATAAAAAATAGTGAAGTGGG + Intergenic
930997752 2:57741724-57741746 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
931362641 2:61591233-61591255 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931451751 2:62373217-62373239 CAGAGGAGAACAAAGGAAGGTGG + Intergenic
931561714 2:63568720-63568742 CAGAGGAGAACAAAGGAAGGAGG + Intronic
931658652 2:64535499-64535521 CAAAGAATAAGTAAGGAAAGTGG - Intronic
931738770 2:65222945-65222967 AAAAGAAAAAAAAAGGAAAGAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932208153 2:69902248-69902270 AGGAGAAGAAAGAAGGAAGGAGG - Intronic
933034158 2:77371425-77371447 CAGAGAAAATTTGAGGAAAGGGG - Intronic
933105121 2:78315386-78315408 CAGAAAAAAATTAATTAAGGAGG - Intergenic
933121921 2:78548765-78548787 CACAGAAAAGCTAAGGAAAGGGG + Intergenic
933260046 2:80122355-80122377 GAGAGAGCAAAAAAGGAAGGGGG - Intronic
933360907 2:81282628-81282650 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
934033087 2:88065280-88065302 CAGAAAAAAAAGAGGGAAGGGGG - Intergenic
934509838 2:94928761-94928783 CAAAAAAAAAAAAAGGAGGGGGG + Intergenic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
934865343 2:97804630-97804652 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
935044742 2:99470653-99470675 CAGAGGAGAACAAAGGAAGGAGG - Intronic
935094390 2:99930519-99930541 GAGAGAAAAAGAAAGGGAGGAGG - Intronic
935439719 2:103077788-103077810 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
935774621 2:106461912-106461934 CTCAAAAAAAAAAAGGAAGGGGG - Intronic
935787202 2:106560025-106560047 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
935869266 2:107427364-107427386 CAGAGATGGGATAAGGAAGGTGG - Intergenic
935899944 2:107780817-107780839 AAGAAAAAAAATCAGGAAGTTGG + Intergenic
935905445 2:107834005-107834027 CAAAAACAAAAAAAGGAAGGGGG + Intronic
935991809 2:108725727-108725749 CTCAAAAAAAAAAAGGAAGGGGG + Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936127235 2:109799242-109799264 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
936217462 2:110572243-110572265 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936426603 2:112426819-112426841 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936690877 2:114887061-114887083 AAGAGTAGAAATAATGAAGGTGG - Intronic
936768452 2:115882720-115882742 CAGAGAAAAAATGTAGAAGTGGG - Intergenic
936769994 2:115900745-115900767 AAGAGAAAAAATAAGAGAAGGGG - Intergenic
936805580 2:116327925-116327947 CATAGAAATGATAAAGAAGGGGG + Intergenic
936887774 2:117333834-117333856 AAGAGAAAAAAAAAGGAAAATGG + Intergenic
938208469 2:129443715-129443737 CAGACAAACAACAAGGCAGGTGG - Intergenic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938971254 2:136435026-136435048 GAGAGACAAATTAAGGATGGCGG - Intergenic
939379346 2:141414250-141414272 AAAAGAAAAAGGAAGGAAGGAGG + Intronic
939418754 2:141937701-141937723 CAAAGAAAAAATAAACAAGCGGG - Intronic
939647476 2:144718283-144718305 CAGAGAAGGAATGAGGAAGGAGG + Intergenic
939673048 2:145037502-145037524 AAGAGAGAAAATAGGGAAGAAGG - Intergenic
939686073 2:145202394-145202416 AAGAGAGAAAATAAGAGAGGAGG - Intergenic
939833187 2:147097091-147097113 AAAAGAAAAAAAAAGGAAGGGGG - Intergenic
939874297 2:147559160-147559182 AAGAGAAAAAAAGAAGAAGGTGG - Intergenic
939888608 2:147708705-147708727 CCTAAAAAAAATTAGGAAGGGGG - Intergenic
940085108 2:149850439-149850461 CAGAGAAAAGAAAAACAAGGAGG + Intergenic
940558868 2:155267809-155267831 CATACAAGAAATAACGAAGGAGG + Intergenic
940669771 2:156652535-156652557 GAGAGAGAAAATAAGGAAGTGGG - Intergenic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940965525 2:159833121-159833143 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
941127945 2:161609442-161609464 AAAAAAAAAAACAAGGAAGGGGG - Intronic
941198299 2:162477477-162477499 CAGAGATAGAATAGAGAAGGAGG + Intronic
941445495 2:165593642-165593664 CAGAGATAATATAACTAAGGGGG + Intronic
941454582 2:165700287-165700309 CAGAGAAAAAAAAAGAAATTTGG + Intergenic
941592279 2:167434712-167434734 AAGGGAAAAAATAAGGGGGGGGG - Intergenic
941692364 2:168514296-168514318 CAGAGACACACTAAGGAAGGGGG - Intronic
941910297 2:170757932-170757954 TATAGAAAAATTAAGGAAGATGG + Intergenic
941943911 2:171073878-171073900 GAAAGAAAAAAAAAGGAGGGGGG - Intronic
942184848 2:173415267-173415289 AAGAAAAAAAGGAAGGAAGGAGG - Intergenic
942354948 2:175100746-175100768 CAGAGGAGAACAAAGGAAGGAGG - Intronic
942636383 2:178011258-178011280 GAGCAAAAAAATAGGGAAGGTGG + Intronic
942638793 2:178038474-178038496 CATATAACCAATAAGGAAGGTGG + Intronic
942658999 2:178244303-178244325 AGGAGAAAAAATAAGAGAGGAGG - Intronic
942692164 2:178597362-178597384 CATAGAATAAAAAAGTAAGGAGG + Intronic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942900017 2:181104608-181104630 CGGAGGAAAAGTAAGAAAGGCGG - Intergenic
943117264 2:183689380-183689402 CAGAAAAAAAAAATGGCAGGAGG - Intergenic
943363437 2:186947378-186947400 CAGAAAAAAAAAAAGAAACGCGG - Intergenic
943633433 2:190279828-190279850 CAGAGGAGAACAAAGGAAGGAGG - Intronic
943742284 2:191422823-191422845 CAAAAAAAAAATATGGGAGGGGG - Intronic
943826525 2:192401157-192401179 CAGAGAAAAAAAAAAAAAAGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944138954 2:196434034-196434056 TAGAGAAAAATCAAGAAAGGAGG - Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944400841 2:199324330-199324352 CAGAAAAAAAATAAGTAAATGGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
945237469 2:207644841-207644863 CAAAGAACAAATGAGGATGGGGG + Intergenic
945395081 2:209307076-209307098 CAGAAAAAAAATTAGGTATGTGG + Intergenic
945744075 2:213699214-213699236 AACAGAAAAAATAAAGAATGTGG - Intronic
945825159 2:214712803-214712825 CAAAGAAAAAAAAGGGAGGGTGG - Intergenic
946088996 2:217203912-217203934 CAAAGAGAAAATTAGGAAAGTGG - Intergenic
946443494 2:219717436-219717458 GGCAGAAAAAATATGGAAGGAGG + Intergenic
946601512 2:221365087-221365109 TAGAGAGAAAATAGGGAAGAGGG + Intergenic
946962491 2:224999515-224999537 AATAGAGAAAATAAGGAAAGAGG - Intronic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947922024 2:233885363-233885385 AAGAGGGAAAATAATGAAGGAGG - Intergenic
948042971 2:234918756-234918778 TAGAGAATAAATCAGGTAGGAGG + Intergenic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
948303430 2:236927519-236927541 AAGAGAAAAATAAAAGAAGGGGG - Intergenic
948960315 2:241329804-241329826 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1168745578 20:236896-236918 CAAAAAAAAAAAAAGAAAGGAGG + Intergenic
1169036392 20:2455910-2455932 CAGAGGAAAGAAAAGGAAAGGGG + Intergenic
1169425691 20:5495606-5495628 TGGAGAAGAAATAAGGAAGCTGG - Intergenic
1169541636 20:6606131-6606153 AAGAGAAAGAAAGAGGAAGGGGG - Intergenic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1170190749 20:13642412-13642434 GAAAGAAAAACTAAGGAAGCAGG - Intergenic
1170209972 20:13838564-13838586 GAAAGAAAAGAAAAGGAAGGTGG - Intergenic
1170253159 20:14308830-14308852 GAAAGAAAAAATAAAGATGGAGG + Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170436925 20:16339907-16339929 GAGAAAAAAATGAAGGAAGGAGG - Intronic
1170709443 20:18777115-18777137 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1170781595 20:19430423-19430445 AAGAGAAAAAATAGGGAGGGAGG + Intronic
1170943494 20:20868708-20868730 CAGACTAAAAATAAAAAAGGAGG + Intergenic
1171230132 20:23477657-23477679 CAGAGAAACAAATAGGAAAGTGG - Intergenic
1172142039 20:32729617-32729639 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172460991 20:35118615-35118637 CATTGAAAAAATCAGCAAGGTGG - Exonic
1172538767 20:35694984-35695006 CTGAGATAAAATAAGGTGGGTGG - Intronic
1172543134 20:35737560-35737582 CAAAGAAAAAATAAAGACAGAGG + Intronic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1172887925 20:38244219-38244241 GGGAGAAGAAATAAGGATGGGGG + Intronic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173472417 20:43334072-43334094 CAGAGGAAAACAAAGGAAGGAGG - Intergenic
1173613027 20:44384777-44384799 CAGAGAGACTATAAGTAAGGGGG + Intronic
1173850596 20:46215668-46215690 GAAAGAAAAAGAAAGGAAGGAGG + Intronic
1173885513 20:46454390-46454412 GATAGAAAAAGTAAGGAAAGTGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174447329 20:50598904-50598926 CAGAAAAAAAAAAAAAAAGGAGG + Intronic
1174507776 20:51027814-51027836 AAAAGAAAAAAAAAGTAAGGAGG - Intergenic
1174525661 20:51168663-51168685 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1174589795 20:51635838-51635860 GAGGGAAAAAGGAAGGAAGGAGG + Intronic
1175050394 20:56150334-56150356 GAGAGAAAAAGAAGGGAAGGAGG + Intergenic
1175120957 20:56715989-56716011 GAAAGAAAAATAAAGGAAGGAGG + Intergenic
1175655972 20:60771359-60771381 CTGAAAAAAAATAAGGGAGCAGG - Intergenic
1176079269 20:63263678-63263700 AAGAAAAAAAATAAAAAAGGTGG + Intronic
1176522613 21:7836153-7836175 GAGAAAAAAATTAAGGAAAGAGG - Intergenic
1176956721 21:15113441-15113463 CAGAGATAAAATAATGGAAGTGG - Intergenic
1176957369 21:15121544-15121566 CAGAGACTAAATGAGGAAAGAGG + Intergenic
1177604269 21:23358419-23358441 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1177890394 21:26797699-26797721 AAGAGAAAAAAAAAGGGCGGGGG - Intergenic
1177916743 21:27098249-27098271 CACAGAAAAAATAAATAAGGAGG - Intergenic
1177960755 21:27663154-27663176 CTGACAAAAAATAAGAAATGGGG + Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178365939 21:31988841-31988863 CCGAGAAAGAAAAAGGAAGGAGG - Intronic
1178455295 21:32744275-32744297 AAGAAAAAAAAAAAGGAGGGGGG + Intronic
1178459684 21:32791513-32791535 GAAAGAAAAAATAAGGAAAAGGG - Exonic
1178477997 21:32954797-32954819 GAGAGAAAAAAAAAGGGAGGGGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178656633 21:34466165-34466187 GAGAAAAAAATTAAGGAAAGAGG - Intergenic
1178761981 21:35411845-35411867 GAGTAAAAAAATCAGGAAGGGGG + Intronic
1178763838 21:35430475-35430497 AAAAGAAAAAGGAAGGAAGGAGG - Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179111877 21:38454139-38454161 TAGATAAAAAATAAGGAAAAGGG - Intronic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179291746 21:40024133-40024155 CTGAGAAAAAACAAGCAATGGGG - Intronic
1179299409 21:40092821-40092843 CAGATAGAAAATAAGTAAGTTGG - Intronic
1179505992 21:41841074-41841096 CACAGAGAAAATAGGGAAGGAGG + Intronic
1179651554 21:42812657-42812679 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1180435600 22:15300374-15300396 CAAAAAAAAAATGATGAAGGAGG - Intergenic
1180659660 22:17455083-17455105 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1181380014 22:22494684-22494706 CATAGAAATAATCTGGAAGGTGG - Intronic
1181381777 22:22510220-22510242 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1181809091 22:25392585-25392607 CAGAGAAAAGCAAAGCAAGGAGG + Intronic
1181886169 22:26023972-26023994 CAGACAAGAAATAGGAAAGGAGG + Intronic
1181985020 22:26794398-26794420 CAGAAAAAAAAAAAAGAAGTAGG + Intergenic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1182031667 22:27163821-27163843 CAGAGAAACAATGGGGTAGGTGG - Intergenic
1182074418 22:27485324-27485346 TAGAGAAAAAAAAAGGAAACAGG - Intergenic
1182131606 22:27857039-27857061 TAGACTAAAAATAAGGAATGAGG + Intronic
1182167353 22:28189386-28189408 CAAAGAAATCCTAAGGAAGGGGG + Intronic
1182430598 22:30296817-30296839 GAAAGAAAAAATAAATAAGGAGG + Intronic
1182915869 22:34029938-34029960 CACAGAAAAAAGAAGGTAGATGG - Intergenic
1183032327 22:35115470-35115492 AAGAAAAAAGAAAAGGAAGGTGG + Intergenic
1184040085 22:41937840-41937862 CAAAGAAAAAAAAAGGAGTGGGG - Intergenic
1184216724 22:43072452-43072474 AAGAGAGAAAATAAAGATGGTGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185252183 22:49809118-49809140 CAGAGGAAAAATAAAGAAAAAGG + Intronic
949148161 3:729801-729823 GAAAGAAGGAATAAGGAAGGAGG - Intergenic
949266958 3:2169149-2169171 AAGAGTAATAATAAGGAAGCTGG - Intronic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949726855 3:7058852-7058874 CAGAGGAGAACAAAGGAAGGAGG + Intronic
949736892 3:7183328-7183350 GATAGAAAAAATAATGAAGCTGG + Intronic
949768222 3:7550357-7550379 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
949965865 3:9355675-9355697 GGGAGAAAAATTAAGCAAGGTGG - Intronic
950084140 3:10245299-10245321 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
950378691 3:12593087-12593109 CAAAAAAAAAAAAAGGAAGGAGG - Intronic
950443679 3:13023957-13023979 TAAAGAAAAAACAAGGAATGGGG - Intronic
950582141 3:13869576-13869598 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
950956881 3:17063304-17063326 CTAAAAAAAAAGAAGGAAGGAGG - Intronic
951144236 3:19207082-19207104 GTTAGTAAAAATAAGGAAGGAGG + Intronic
951742695 3:25941827-25941849 AGGAGAAAAGATAAGGAGGGAGG - Intergenic
952032601 3:29162335-29162357 CAGATAATAAATAAAGAAGCAGG + Intergenic
952238854 3:31509184-31509206 AAGAAATAAAAGAAGGAAGGAGG + Intergenic
952344166 3:32468549-32468571 TAAACAAAAAATAGGGAAGGAGG - Intronic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
952640996 3:35595903-35595925 AAAAGAAAAATTAAGGAAAGGGG + Intergenic
952710055 3:36421107-36421129 CAGAGAGGAAAAAAGGAAGGAGG - Intronic
952749431 3:36813444-36813466 CACAGTAAAAATGAGGTAGGCGG + Intergenic
953186532 3:40643060-40643082 CAGGGAAAAAAAAAGCAAGTGGG - Intergenic
953395738 3:42568234-42568256 AAGAGAAAAGGTAAGGAGGGAGG - Intronic
953636071 3:44666055-44666077 AAGAGAAAAAACATGGAAAGGGG - Intergenic
954363137 3:50133001-50133023 CAGAGAAGAAAGAAGAAACGAGG - Intergenic
954659656 3:52220325-52220347 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
954971080 3:54652232-54652254 CAGCGGAAAAAAAGGGAAGGAGG + Intronic
955068374 3:55551944-55551966 CAGAAAAAAAGAAAAGAAGGGGG - Intronic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
955417292 3:58704534-58704556 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
955455242 3:59113073-59113095 CAAAGAATAAATGAAGAAGGTGG + Intergenic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
955589589 3:60520960-60520982 AAGAGAAAAAAAAAGGAAAAAGG + Intronic
955697258 3:61649172-61649194 AATAGAAAAAGGAAGGAAGGAGG - Intronic
955704590 3:61715161-61715183 CAAAGAAAAAAAAAGCAAGCAGG - Intronic
956193046 3:66625291-66625313 AAGAGTAAAAATAAAGAAAGTGG + Intergenic
957251456 3:77776124-77776146 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
957467853 3:80618730-80618752 AAAAGAAAAACAAAGGAAGGAGG - Intergenic
957724923 3:84051628-84051650 CAGAGAAAATGTGAGAAAGGTGG - Intergenic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
958115305 3:89208480-89208502 AAGAGAAAAAGAAAGGAGGGAGG + Intronic
958117167 3:89234980-89235002 AAGAGAAAAAAGAAAGGAGGAGG - Intronic
958260602 3:91376202-91376224 CAAGGAAACAATAAGGAATGAGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958608922 3:96399093-96399115 TAGAGATAAAATAATGAAGAAGG - Intergenic
958643043 3:96833328-96833350 CACACAAAAAACTAGGAAGGAGG + Intronic
958712110 3:97729686-97729708 AAAAGAAAAAATAAGGCAGAAGG - Intronic
959392509 3:105793488-105793510 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
959795643 3:110425204-110425226 TATAGAAAGAATAAGGAATGTGG - Intergenic
959936664 3:112036566-112036588 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
960424335 3:117487721-117487743 CACATAAATAACAAGGAAGGGGG - Intergenic
960585535 3:119317695-119317717 GAGGGAAAAAGAAAGGAAGGAGG + Intronic
960789574 3:121413501-121413523 CACAGAAATAATAAGAAAGAGGG + Intronic
960825982 3:121785052-121785074 AAGAGAAAAATCAAGGAAAGGGG - Intronic
960891345 3:122451939-122451961 AAAAGAAAAAAAAAGGAAGAAGG + Intronic
961260227 3:125595833-125595855 AAAAAAAAAAAAAAGGAAGGCGG - Intergenic
961563442 3:127746890-127746912 CTGAGGAAAATTCAGGAAGGAGG - Intronic
961732873 3:128979981-128980003 AAGAGAAAAAGAAAGAAAGGAGG + Intronic
961951224 3:130751400-130751422 AAGGGAAAAAATAAGGCAAGGGG + Intergenic
962341139 3:134584636-134584658 CAGAGACATAATAAGAAAGAGGG - Intergenic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962651246 3:137494910-137494932 CACAGAAAAAGTAAGCAAGTAGG - Intergenic
962712524 3:138100022-138100044 CAAAAAAAAAAAAAGGATGGGGG - Intronic
963071060 3:141305670-141305692 CAGAGAAACACTAGGGCAGGAGG + Intergenic
963165441 3:142197193-142197215 AAGAGAAAAAAAAAAGAAAGTGG + Intronic
963200854 3:142584582-142584604 GAGAGAGAAAATGAGAAAGGTGG - Intergenic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963258076 3:143166199-143166221 CGGAGAAAAAGAAAGAAAGGAGG - Intergenic
963467809 3:145704577-145704599 CAAAGCAAAAATAAGGAATGGGG + Intergenic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
963667156 3:148202611-148202633 CAGAGGGCAAATGAGGAAGGGGG - Intergenic
963872068 3:150427794-150427816 AAGAGAAGAAGAAAGGAAGGAGG - Intronic
963897332 3:150701161-150701183 GAGAGAAGAAAGATGGAAGGAGG + Intronic
963935075 3:151044005-151044027 GGGAAAAAAAATAAGGAAAGGGG - Intergenic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
964585890 3:158301382-158301404 GATAAATAAAATAAGGAAGGTGG - Intronic
964866883 3:161271968-161271990 CAGAAAAAAAAAAAAGAAGAAGG - Intergenic
965413781 3:168366724-168366746 GAGAGAAAAAAAATGGAAGATGG + Intergenic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
965580035 3:170258056-170258078 CAGAGAAGATAAAAGGAAGTAGG + Intronic
965759673 3:172062308-172062330 CAAAAAAAAAAAAAAGAAGGAGG - Intronic
966033150 3:175376404-175376426 GAAAGAAAAAATAAGGAAAAAGG - Intronic
966395123 3:179494552-179494574 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
967389230 3:188939084-188939106 TACAGAAAAAGTAAAGAAGGTGG + Intergenic
967543025 3:190691275-190691297 GAGAGAGAAAGAAAGGAAGGAGG + Intergenic
967728321 3:192882730-192882752 CAAAGAAAAAAAAAGGAAACTGG - Intronic
967797502 3:193613551-193613573 CAAAAAAAAAACAAAGAAGGAGG - Intronic
968043602 3:195610125-195610147 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
968155180 3:196374952-196374974 AAGAAAGAAAAAAAGGAAGGAGG + Intronic
968361550 3:198150560-198150582 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
968361918 3:198153350-198153372 CAAACAAAAAAGAAGGAAGACGG + Intergenic
968455221 4:694593-694615 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
968769435 4:2494704-2494726 CAGAGGAGAATAAAGGAAGGAGG + Intronic
970001189 4:11367723-11367745 AAGAGAAAAAATGAGTAAGCGGG - Intergenic
970025158 4:11616163-11616185 CAGAGTAACAATCTGGAAGGAGG - Intergenic
970296867 4:14639910-14639932 CAAAGCAGAAATATGGAAGGTGG + Intergenic
971107809 4:23545983-23546005 CAGAGAAAGAACAAAAAAGGGGG - Intergenic
971317507 4:25579842-25579864 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
971423204 4:26492367-26492389 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971423253 4:26492661-26492683 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971600508 4:28585753-28585775 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972211499 4:36843314-36843336 GAAAGAAAAAGGAAGGAAGGGGG - Intergenic
972291583 4:37694663-37694685 CAGAGAGAAAATAAGAAAAGAGG + Intergenic
972383097 4:38537091-38537113 CACAGATAAAATAAAGGAGGGGG - Intergenic
972427800 4:38950741-38950763 AAGAGAAAAAAATACGAAGGTGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972790228 4:42364734-42364756 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
972820365 4:42694930-42694952 CATACAAAAAATGAGGGAGGGGG - Intergenic
973063595 4:45761397-45761419 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
973561922 4:52145379-52145401 TAAAGAAAAAATGGGGAAGGAGG - Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973646991 4:52960034-52960056 CAGAGAAAAAATTAAGACCGTGG - Intronic
973753635 4:54049783-54049805 GAGAGAAAAAATAAAAAAGTAGG + Intronic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974040902 4:56856682-56856704 GAGAGCAAAACTCAGGAAGGTGG + Intergenic
974073382 4:57146283-57146305 GAGAGAAAGGGTAAGGAAGGAGG - Intergenic
974369117 4:60991352-60991374 CAGAAAAAAAATTCGGGAGGTGG - Intergenic
974664346 4:64938317-64938339 CAGAGACAGAGTAAGGAGGGAGG - Intergenic
974733783 4:65901699-65901721 CAAAAAAAAGATCAGGAAGGAGG - Intergenic
974796102 4:66752293-66752315 CAGGAATAAAATCAGGAAGGAGG - Intergenic
974980799 4:68955099-68955121 CAGAGGAGAACAAAGGAAGGTGG - Intergenic
975007856 4:69312836-69312858 CAGAGGAGAACAAAGGAAGGAGG - Intronic
975058821 4:69970997-69971019 CAGAGGTAAAATTAGGAGGGGGG + Intergenic
975123183 4:70751750-70751772 AAAAGAAAAAATAGGTAAGGTGG - Intronic
975146371 4:70971930-70971952 TAGAGAAAGAAGAAAGAAGGAGG - Intronic
975425977 4:74228057-74228079 CAGAAAAAAAATCAGTAAGCTGG + Intronic
975450974 4:74526336-74526358 CAGAGAGAAAATGAAGAGGGAGG + Intergenic
975601399 4:76103821-76103843 CAAAAAAAAAAAAAGGCAGGGGG - Intronic
975877545 4:78860739-78860761 CTAAGAAAAAAGAAGGAATGTGG + Intronic
975905495 4:79206632-79206654 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
976066864 4:81197774-81197796 TAGTGAAAAAAAAATGAAGGAGG + Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976559525 4:86485620-86485642 CAGAGAAAGAATGAGAAAGCTGG + Intronic
976598665 4:86917624-86917646 AAGAGAAAGAGAAAGGAAGGAGG + Intronic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977080261 4:92518153-92518175 CAGAGAAAGAAAAAAAAAGGGGG - Intronic
977098745 4:92780534-92780556 CATTTAAACAATAAGGAAGGGGG + Intronic
977195828 4:94057670-94057692 AAGAGAAAGAAAAAAGAAGGAGG - Intergenic
977245366 4:94624367-94624389 CAGAGGAAATATTAGGAATGTGG + Intronic
977256221 4:94743155-94743177 ATGAGAAAAAAAAAGGGAGGAGG + Intergenic
977272898 4:94940009-94940031 TAGACAAAAACAAAGGAAGGGGG - Intronic
977429264 4:96911164-96911186 AAGAGAAAATATAAAGGAGGAGG + Intergenic
977803143 4:101262916-101262938 GACAGAAAAACAAAGGAAGGAGG + Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978077203 4:104546588-104546610 AAAACAAAAAAAAAGGAAGGAGG + Intergenic
978167672 4:105628221-105628243 CAGAGACCAAAAAAGGAAAGAGG - Intronic
978366439 4:107988049-107988071 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
978414003 4:108456696-108456718 AATAGAAAAAATAGGGAAGGGGG - Intergenic
978500521 4:109404256-109404278 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
978640635 4:110867178-110867200 CAGAGTTAAAGTAAGGCAGGGGG + Intergenic
978655944 4:111065500-111065522 GATAGAAAAAATAAGGAGGAGGG + Intergenic
978853686 4:113368787-113368809 TAAAGAAAATATAAGGAAGAAGG + Intronic
978930272 4:114302487-114302509 CAGATAAAAACAAAGAAAGGAGG - Intergenic
979092667 4:116505190-116505212 AAGAGAAAAAATCAGTATGGAGG + Intergenic
979338665 4:119493465-119493487 TAGAGAAAATAAAAGGTAGGGGG - Intergenic
979345839 4:119585830-119585852 TTGAGAAAAAATGAGCAAGGAGG - Intronic
979696718 4:123621186-123621208 CAGAGGAAAAATAATGGAGCTGG + Intergenic
979857250 4:125650188-125650210 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
979888799 4:126064152-126064174 CAGAGGAGAAAAAAGGAAGGAGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980096712 4:128499149-128499171 CCGAGGAAAAAGAATGAAGGTGG - Intergenic
980579214 4:134728048-134728070 AAGAGTAAAAATGAGGAAAGTGG + Intergenic
980786438 4:137562157-137562179 CAGGGAATAAATAAGGAATAAGG - Intergenic
980959584 4:139461627-139461649 CAGTGAAAGAATAGGGAAAGAGG + Intronic
981592287 4:146376922-146376944 CAGAGGAGAACAAAGGAAGGAGG + Intronic
981813981 4:148807491-148807513 GAGAGAACAAAAAAGGAAGAAGG + Intergenic
981893003 4:149761411-149761433 ATGAGCAAAACTAAGGAAGGAGG - Intergenic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982132322 4:152240983-152241005 AAGAGAAAAAAAAATGAAGGGGG + Intergenic
982142057 4:152333476-152333498 AAGAGAAAAAAAAAGAAAGAAGG + Intronic
982183917 4:152777542-152777564 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
982316070 4:154033458-154033480 CAAAAAAAAAAAAAGGATGGTGG + Intergenic
982373742 4:154663527-154663549 AAAAAAAAAAATAAGGAAGAAGG - Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982437082 4:155392172-155392194 CAGAGAGAGAAAGAGGAAGGAGG + Intergenic
982606934 4:157527474-157527496 CAAGGACAGAATAAGGAAGGGGG - Intergenic
982739997 4:159047398-159047420 CAGAGAAAATATAAAGAATCAGG - Intergenic
982753163 4:159187297-159187319 CAGAGAAAAAAAAGGGGAGGAGG - Intronic
982793206 4:159616224-159616246 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
982896793 4:160940640-160940662 CAGATAAAAAATTAAGAAAGTGG + Intergenic
983010124 4:162537095-162537117 AAAAAAAAAATTAAGGAAGGAGG + Intergenic
983139255 4:164127909-164127931 AAAAGAAAAAAAAATGAAGGGGG + Intronic
983538173 4:168879850-168879872 AAGAGAAAAAACAAGGGAGAAGG - Intronic
983801944 4:171942290-171942312 CAGAGAAAAATGAGGGGAGGAGG + Intronic
984345663 4:178521436-178521458 CTGACAAAAAATAAGTGAGGAGG + Intergenic
984476312 4:180239176-180239198 CTGAGAAAAAACAAGCAATGGGG + Intergenic
984540796 4:181034682-181034704 CAGAGACAAGGTAAGGAAGCAGG - Intergenic
984631458 4:182065486-182065508 GAGAGCAAAGATAAGGGAGGAGG + Intergenic
984804841 4:183742547-183742569 AAGAAAAAAAAAAAGGAAGAAGG - Intergenic
985050310 4:185984176-185984198 CAGAGAAACAATAAGAATTGTGG - Intergenic
985238410 4:187902174-187902196 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
985311783 4:188609495-188609517 GAGCGAGAAAAAAAGGAAGGAGG + Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
985851855 5:2394271-2394293 TAGAGAAAAAAAAATAAAGGAGG + Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
987183270 5:15388009-15388031 CAGGAAGAAAATAAGGAATGTGG + Intergenic
987397184 5:17435748-17435770 AAGAAAAAAAAAAAAGAAGGGGG + Intergenic
987447891 5:18043722-18043744 AAGAAAAAAAATGAAGAAGGAGG - Intergenic
987480656 5:18453070-18453092 AAGAGAAAAATGAAGCAAGGAGG + Intergenic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
987927818 5:24364776-24364798 CAGAGAGAAAATGAGGAGGTAGG + Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988385008 5:30551619-30551641 CAGAGAGAGAAAAAGGAATGGGG + Intergenic
988413142 5:30912266-30912288 CAAATGAAAAATAAGGAAGGTGG - Intergenic
988548717 5:32181130-32181152 CAGAGAAAAAAAAAGGAAACTGG + Intergenic
988570707 5:32362401-32362423 CAGAGACAAAGGAAGGAAGAGGG + Intronic
988780599 5:34517946-34517968 CACACATAAAAGAAGGAAGGTGG + Intergenic
988880084 5:35492774-35492796 CTGAGAAAAAAAATGCAAGGAGG - Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989322930 5:40158193-40158215 GAGAGAAAAAATAAGGAAAATGG - Intergenic
989398105 5:40980161-40980183 CAGAGTAAAAATCATGAAGGTGG - Intronic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989624018 5:43412409-43412431 CAGAGGAAAAGTAAGCCAGGTGG + Intergenic
990032822 5:51282653-51282675 CAAGAAAAAAATAAGGGAGGAGG - Intergenic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990688231 5:58332669-58332691 TAGAGCAAAGATAAAGAAGGGGG - Intergenic
990842593 5:60100435-60100457 AAGAGAAGAAGAAAGGAAGGAGG + Intronic
990939933 5:61191748-61191770 GAGAGAAAAAATAAGAAAATGGG + Intergenic
990949903 5:61288409-61288431 CAGAAAAGAATTCAGGAAGGAGG - Intergenic
991090732 5:62691359-62691381 TAGAGGAGAAAAAAGGAAGGAGG + Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991181631 5:63758154-63758176 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
991309319 5:65218086-65218108 CAGAGAACAAGAGAGGAAGGAGG + Intronic
991353625 5:65745914-65745936 GAGATAAGAAATAAAGAAGGAGG + Intronic
991605440 5:68396138-68396160 CAGTGGAAGAATGAGGAAGGGGG + Intergenic
991727860 5:69554228-69554250 CAGAAAAAAAATAGGGAGGCTGG - Exonic
991867097 5:71073648-71073670 CAGAAAAAAAATAGGGAGGCTGG + Intergenic
992150439 5:73897088-73897110 CAGAAGAAAAGAAAGGAAGGAGG - Intronic
992510990 5:77434696-77434718 CAAAGAAAAAAAAAGAAATGAGG + Intronic
993038939 5:82790278-82790300 CAGTGAAAAAATTAGGAAACAGG - Intergenic
993179940 5:84539829-84539851 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
993202507 5:84834330-84834352 CAGAGGAGAACTAAAGAAGGAGG - Intergenic
993262087 5:85670658-85670680 CACAGAAAAATGAAGCAAGGGGG + Intergenic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994321641 5:98401609-98401631 CAGAGCCAAAGTAGGGAAGGAGG - Intergenic
994432519 5:99685887-99685909 TAGGGAAAAATAAAGGAAGGTGG - Intergenic
994561147 5:101374714-101374736 CAGAGAAACAATAACAAAGAAGG + Intergenic
994608451 5:102002996-102003018 CAGAGATAAAATAAGTAGGATGG - Intergenic
995149809 5:108829701-108829723 AAGAAAGAAAAAAAGGAAGGAGG - Intronic
995416039 5:111914459-111914481 CAGAGGAGAACAAAGGAAGGAGG - Intronic
995505457 5:112855632-112855654 GAGAGAAAAATTAAGGAGGAGGG + Intronic
995666809 5:114551945-114551967 GAGACAAAAAATAAGCAATGGGG + Intergenic
996008825 5:118457589-118457611 CAGGGAAGAAATAAGGAAATGGG + Intergenic
996154976 5:120087592-120087614 ATGAGACAAAAAAAGGAAGGAGG + Intergenic
996317692 5:122179000-122179022 CTGAGAAAAAATAAGCAATGGGG - Intronic
996379736 5:122850813-122850835 CAGAGAAAGAGTGAGGAAAGAGG + Intronic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996994670 5:129680813-129680835 AAGAGAAAAAATCAGGATGATGG + Intronic
997020780 5:129999116-129999138 CAAAAAAAAAAAAAGGGAGGGGG - Intronic
997280346 5:132639672-132639694 GAGAGAACAAATAATGGAGGTGG + Intronic
997408529 5:133671739-133671761 CAGAGGAAAACAAAGGAAGGAGG + Intergenic
997464604 5:134078963-134078985 AAGAAAAAAAAAAAGGAGGGGGG - Intergenic
997535003 5:134613102-134613124 CAGAGGAGAACAAAGGAAGGAGG - Intronic
997764452 5:136486270-136486292 CAGAAAGAAACTAAGCAAGGGGG + Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997846928 5:137294986-137295008 CAGAGAAAAATAAAGGGAGAAGG - Intronic
998019743 5:138759474-138759496 AAGAGAAAAATGAAGGAAGTAGG + Intronic
998178783 5:139920589-139920611 CAGAGAAGAAATGAAGTAGGGGG + Intronic
998261303 5:140633738-140633760 CAAGGAAAAAAAAAGGAAGGGGG - Intergenic
998398637 5:141835975-141835997 CTGAGGAGAAATAAGGCAGGGGG - Intergenic
998715430 5:144878659-144878681 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
998770636 5:145540687-145540709 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
998821878 5:146064549-146064571 GAAAGAAAAAGAAAGGAAGGAGG + Intronic
998859973 5:146432985-146433007 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
999104326 5:149056694-149056716 CTGAGAAACAATAAGGAAGCTGG + Intronic
999346996 5:150832226-150832248 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
999524156 5:152384026-152384048 GAGAGAAAGAGAAAGGAAGGAGG - Intergenic
999580531 5:153033464-153033486 CAGAGAAGAACAAAGGAAGGAGG + Intergenic
999601195 5:153267193-153267215 AAGAGAAAGAATAGGGAAGAAGG - Intergenic
1000093078 5:157947074-157947096 CTCAGACAAAAAAAGGAAGGAGG - Intergenic
1000132201 5:158310276-158310298 AAGAGAAAAAGAAAGGAAGAAGG - Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000327933 5:160186459-160186481 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1000552096 5:162679682-162679704 AAGAAAAAAAATAAGTATGGTGG + Intergenic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1001126571 5:169024796-169024818 AAGAGACAAAATAAGGAAAAAGG + Intronic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1001330185 5:170756501-170756523 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001456634 5:171866723-171866745 CTAAGAAAATATAGGGAAGGAGG - Intronic
1001503369 5:172256101-172256123 GAGAGAAAAAAAAAGAAAGATGG + Intronic
1001735166 5:173991481-173991503 CACTGAAAAAATAAGTATGGAGG - Intronic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1002029930 5:176420414-176420436 GAGAGAAAAAGGAAGGAAAGGGG - Intergenic
1002117980 5:176979602-176979624 CAAAAAAAAAAAAAGAAAGGTGG + Intronic
1002130926 5:177081233-177081255 AAGAGGAAGAGTAAGGAAGGAGG + Intergenic
1002198520 5:177513940-177513962 CAGACAAAGAAATAGGAAGGAGG - Intronic
1002577689 5:180184989-180185011 CAGATAGAAAATCATGAAGGAGG + Intronic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1002899470 6:1398988-1399010 CAGAGAAAAGGCAAAGAAGGGGG + Intergenic
1002938938 6:1699265-1699287 AAGAAGAAAAATAAGGAAGATGG + Intronic
1003013115 6:2444902-2444924 CAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1003020685 6:2506374-2506396 AACAGAAAAAGTAAGAAAGGAGG - Intergenic
1003253528 6:4454660-4454682 CAGAGGAAAAAGAAAGAATGAGG + Intergenic
1003435769 6:6086577-6086599 CAGTGAAAAAATAAGGAAATAGG - Intergenic
1003466140 6:6381948-6381970 AGGAGATAAAAGAAGGAAGGAGG + Intergenic
1003475601 6:6479279-6479301 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1003619067 6:7681458-7681480 CAAAGAACAAATCAGGCAGGAGG - Intergenic
1003672921 6:8176477-8176499 AAGAAAGAAAAGAAGGAAGGGGG - Intergenic
1004038064 6:11943581-11943603 CAGATATGAACTAAGGAAGGAGG + Intergenic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004552997 6:16667778-16667800 GAGAGAAATAATAAGCAAAGGGG - Intronic
1004761533 6:18672130-18672152 CAGAGAAGAAAAAAGGGAGAAGG - Intergenic
1004795209 6:19075114-19075136 AAGAGAGAAAAAAATGAAGGAGG - Intergenic
1004943418 6:20585674-20585696 AAGAGAACCAATAAGCAAGGGGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005636678 6:27759469-27759491 AAAAGAAAAAAAAAGGAATGAGG - Intergenic
1006002250 6:30974286-30974308 CAAAAAAAAAAAGAGGAAGGGGG + Intergenic
1006179552 6:32146512-32146534 CACACCAAAAATAAGGCAGGAGG + Intergenic
1006193472 6:32223285-32223307 CAGAGAATAAACAGGAAAGGGGG - Intronic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006327329 6:33364548-33364570 AAGAAAAAAAAAAAGGAATGTGG - Intergenic
1007128069 6:39444231-39444253 AAAAGAAAAAAAAAGAAAGGTGG - Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007274197 6:40661446-40661468 CAGGGAAAAAATAAGGTTCGAGG + Intergenic
1007400037 6:41598183-41598205 AGGAGGAAAAATAAGAAAGGGGG - Intronic
1007403850 6:41621242-41621264 CAGAGAGAAAATGAGGGTGGGGG - Intergenic
1007681122 6:43634192-43634214 AAGAAAAAAAAAAAGGATGGAGG - Intronic
1007901918 6:45421400-45421422 CACAAAAAAAATGAGGAGGGGGG - Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1007913798 6:45541707-45541729 CAGGGCAGAAAAAAGGAAGGGGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008311362 6:49978788-49978810 CAGAGAAAAAAAAATCAAGTAGG + Intergenic
1008437308 6:51491691-51491713 TAGAGAAAAAATAAGGTAAGTGG - Intergenic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1008770766 6:54976756-54976778 GATAGAAAAAATAAAGATGGTGG + Intergenic
1008862890 6:56172067-56172089 CAGAAAAAAAAAAAAGAAGAGGG + Intronic
1008994614 6:57644178-57644200 CAAGGAAACAATAAGGAATGAGG - Intronic
1009183157 6:60543001-60543023 CAAGGAAACAATAAGGAATGAGG - Intergenic
1009200714 6:60741849-60741871 CAAAGATAAAATATGTAAGGAGG + Intergenic
1009303601 6:62059825-62059847 AGAAGAAAAAATAAGGAAGAAGG + Intronic
1009406365 6:63318422-63318444 AAGTGAAAGAATATGGAAGGAGG - Intronic
1009582504 6:65554395-65554417 AAGCCAAAAAATAAAGAAGGAGG - Intronic
1009950736 6:70392795-70392817 CAGAGATAAAATAAGAAAGGAGG + Intergenic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010097435 6:72063237-72063259 CAGAGCAGAAATAAGGTAAGGGG - Intronic
1010147835 6:72692783-72692805 AAGAGACAAAGTAATGAAGGAGG + Intronic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1010721169 6:79284658-79284680 AAAAAAAAAAAAAAGGAAGGTGG + Intergenic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011059247 6:83244853-83244875 CAGAGAAAAAATTATCAAAGAGG + Intronic
1011198297 6:84805330-84805352 GAAAGAAAACATTAGGAAGGTGG - Intergenic
1011287504 6:85740653-85740675 GAGAGAAAAAAAAATGTAGGAGG - Intergenic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1011931601 6:92721520-92721542 CAAAGAGAAATGAAGGAAGGGGG - Intergenic
1012031063 6:94064732-94064754 AAGAGAAAAAATAAAAAAAGAGG + Intergenic
1012100028 6:95071884-95071906 CAAAGAAAATAAAAGGAAGAAGG - Intergenic
1012234185 6:96793224-96793246 CAGAGAATAATAGAGGAAGGTGG + Intergenic
1012362311 6:98397801-98397823 AAGAGAAAAAAAAAGGGGGGGGG - Intergenic
1012488281 6:99746687-99746709 CAGATACAAAATATGTAAGGGGG - Intergenic
1012518899 6:100096664-100096686 GAGAGAAAAAAAAAGGTATGAGG + Intergenic
1012676379 6:102118240-102118262 AAGAGAAAAAGAAAGGAGGGAGG + Intergenic
1012777680 6:103519015-103519037 GAGAGAAAAAATTACAAAGGAGG - Intergenic
1012976251 6:105784095-105784117 GAGAGCAAAAATAAGAAAGGTGG - Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013032426 6:106347183-106347205 CAGAAAAAAAATATGTATGGTGG + Intergenic
1013155394 6:107488448-107488470 AAGAGAAGAAATCAGGAGGGAGG + Intergenic
1013377188 6:109529010-109529032 GAGAGATAAAAAAAGGAGGGAGG - Exonic
1013673069 6:112426811-112426833 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1014212339 6:118720180-118720202 GAGGGAAAAAGGAAGGAAGGAGG - Intergenic
1014565849 6:122946854-122946876 CAGAAAAAATATCTGGAAGGTGG - Intergenic
1014665911 6:124237270-124237292 CACAGAACAATTGAGGAAGGAGG + Intronic
1014815071 6:125926311-125926333 CAAAAAAAAAAAAAGGGAGGGGG + Intronic
1015018396 6:128442308-128442330 CAGAGATAAAATGATGAAAGAGG - Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015401883 6:132796541-132796563 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1015468356 6:133573784-133573806 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1015663103 6:135598478-135598500 CAGTGAAAAAATAGGCAAAGAGG - Intergenic
1015675252 6:135738941-135738963 CAGAGAAAAAAAAAAGCAGGAGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015820219 6:137252876-137252898 AAGAAAAAAAAAAAGGAAAGAGG - Intergenic
1016455434 6:144225615-144225637 AAGAGAAGAAAAAAGGAAGAAGG + Intergenic
1016536412 6:145111681-145111703 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1016546473 6:145229613-145229635 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1016665355 6:146633134-146633156 CGGAGAAAAATTGAGGCAGGGGG - Intronic
1016921603 6:149300429-149300451 CACAGATAAAATAAGGGAGTTGG + Intronic
1017539799 6:155389110-155389132 AAGAGAAAAAATAAAGAATTTGG + Intergenic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017654240 6:156612330-156612352 CAGAGAAAGAATATAGAAAGAGG + Intergenic
1017656245 6:156632721-156632743 TAATGAAAAAATAAGGATGGAGG - Intergenic
1017707171 6:157133971-157133993 TAAACAAAATATAAGGAAGGTGG - Intronic
1017726366 6:157278746-157278768 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1017921565 6:158877462-158877484 GAAAGAAAAAGGAAGGAAGGAGG - Intronic
1018136965 6:160788408-160788430 TAGAGGAAAACAAAGGAAGGAGG - Intergenic
1018193423 6:161331989-161332011 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1018542972 6:164903167-164903189 CAGAGAAGAAATAAGCATGTGGG - Intergenic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1018631258 6:165825165-165825187 AAAAGAAAAAAAAAGAAAGGGGG + Intronic
1019035981 6:169059000-169059022 CATAGAACAAAGAAGAAAGGTGG - Intergenic
1019253760 7:35372-35394 CAAACAAAAAAGAAGGAAGACGG - Intergenic
1019254135 7:38160-38182 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1019351938 7:558334-558356 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019888834 7:3928997-3929019 CTGAGAAAGAATAAGGAACAGGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1019916819 7:4138767-4138789 GAAAGAAAGAAGAAGGAAGGAGG + Intronic
1019946739 7:4335711-4335733 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1020103803 7:5411232-5411254 AAGAAAAAAGAAAAGGAAGGGGG + Intronic
1020161283 7:5773870-5773892 CAAAGAAAAAATAAGAAATTTGG - Intronic
1020299305 7:6782883-6782905 CAAAAAAAAACTAAGGAAGTGGG + Intronic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1021378862 7:19941752-19941774 CATAGAAGAACCAAGGAAGGGGG + Intergenic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1021595484 7:22312204-22312226 CAAAAAAAAAAAAAGGAATGTGG - Intronic
1021845938 7:24762681-24762703 CAGATAAACAATAAGGATAGAGG + Intergenic
1022029175 7:26476658-26476680 AAGAGAAAAAAAAAGGGGGGAGG - Intergenic
1022195286 7:28060014-28060036 AAGATGAAAAATATGGAAGGGGG - Intronic
1022448126 7:30486747-30486769 CAGAAAAAAAAGAAAGAAAGTGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022876163 7:34532872-34532894 AAGAGAAAAAAAAAGTAAGTGGG + Intergenic
1023297807 7:38734542-38734564 CAGAGAAATAAGGAGAAAGGGGG - Intronic
1023319858 7:38983387-38983409 CAAAAAAAAAAAAAGAAAGGAGG - Intronic
1023575188 7:41619748-41619770 AAGAGAAGAAACCAGGAAGGAGG - Intergenic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1024308237 7:47946013-47946035 CAAATAAAAAAAATGGAAGGGGG + Intronic
1024737171 7:52318206-52318228 AAGAGAAAAAAAAATGAAGCAGG - Intergenic
1025080830 7:55981053-55981075 CACAGAAGAAATAAGGAAGATGG - Intronic
1025111449 7:56220122-56220144 CAGAGAGAAAGAGAGGAAGGAGG + Intergenic
1025605060 7:63033798-63033820 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1025943962 7:66092464-66092486 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1026066262 7:67076109-67076131 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1026083172 7:67240445-67240467 AAGAGAAATAATAAGTATGGTGG - Intergenic
1026255631 7:68708860-68708882 CAGAGAAAAAATAAGCAAGCAGG - Intergenic
1026389668 7:69887862-69887884 AAGAGAAAAAAAAATGAAAGAGG - Intronic
1026638775 7:72106561-72106583 GAGAGAGAAAAAGAGGAAGGTGG + Intronic
1026638877 7:72106891-72106913 GAAAGAAAAAGGAAGGAAGGAGG + Intronic
1027591494 7:80124757-80124779 GGGAGAAAAAAGAAAGAAGGAGG + Intergenic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028055820 7:86241293-86241315 GAGAGAAAAAATAAAGAGGGAGG + Intergenic
1028070821 7:86448025-86448047 GAGAGAAAAAAAAAAGGAGGAGG + Intergenic
1028131604 7:87181988-87182010 CAGAGAAGAAATAAGTAACTTGG - Intronic
1028344759 7:89765691-89765713 AAAAGCAAAAATAAGGAAGTGGG - Intergenic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028467467 7:91169131-91169153 CAAAGAAAATGTAAGGAAAGTGG - Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028931625 7:96419549-96419571 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
1028975799 7:96912619-96912641 CAGAAAAAAAATGAGAAAGTTGG - Intergenic
1028977475 7:96930118-96930140 CAGAGAAAAAGTGAGGATAGAGG - Intergenic
1029497543 7:100904476-100904498 CAGGCAAAAAATAAAGAATGAGG - Intergenic
1029553773 7:101253344-101253366 GAAAGAAAAAGAAAGGAAGGAGG + Intergenic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029633768 7:101770104-101770126 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1030207817 7:106967711-106967733 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1030332519 7:108286475-108286497 AAGCGGAAAAAAAAGGAAGGAGG + Intronic
1030740181 7:113100284-113100306 GAGAAAAAAATGAAGGAAGGGGG - Intergenic
1030987498 7:116259796-116259818 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1031141948 7:117952165-117952187 CAGAGAGACACTGAGGAAGGAGG + Intergenic
1031302429 7:120079206-120079228 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1031559429 7:123220453-123220475 CAGAGAAACAATAAGATATGGGG + Intergenic
1031846143 7:126807580-126807602 GAGAGATAATATAATGAAGGGGG - Intronic
1031907163 7:127473308-127473330 CAGAAAGAAAAAAAGGAAGAAGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032362077 7:131265368-131265390 GAGAGAAGAAAGAAAGAAGGGGG - Intronic
1032511485 7:132475951-132475973 CAGAGAGAACATGAGGGAGGTGG + Intronic
1032629923 7:133638609-133638631 CAGAGAAGAAAAAAAGAAAGAGG - Intronic
1032815293 7:135467807-135467829 CAGAGAGAAAACAAGGAAGTTGG + Intronic
1032937685 7:136752286-136752308 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1033236315 7:139640640-139640662 GAAAAAAAAAATAAGGAAGAGGG - Intronic
1033324682 7:140367812-140367834 AAAAAAAAAAAAAAGGAAGGTGG - Intronic
1033382450 7:140835996-140836018 CAAAGTAATAATGAGGAAGGAGG + Intronic
1033811111 7:145012193-145012215 CAGAGAGAAAGCAAGGGAGGAGG - Intergenic
1033970429 7:147032724-147032746 GAGAGAAAAAGGAAGGAAGTTGG + Intronic
1033981587 7:147171288-147171310 CAGAGAGAAAATACCGAATGTGG - Intronic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034036154 7:147824724-147824746 TAAAGAAAAAAAAAGGAAGCTGG - Intronic
1034180281 7:149132170-149132192 GAGAGAGAATATAAGGAAGTCGG - Intronic
1034204507 7:149304059-149304081 CAAAAAAAAAAAAAGGGAGGGGG - Intergenic
1034756682 7:153628347-153628369 CAGAGAAAGAATTTGAAAGGTGG - Intergenic
1034823273 7:154236850-154236872 CAGTAAAAAAATAAGGAAACAGG + Intronic
1035057715 7:156046994-156047016 CAGACAGAAATGAAGGAAGGGGG + Intergenic
1035109980 7:156473367-156473389 CAGAAAAACTGTAAGGAAGGTGG + Intergenic
1035417132 7:158699085-158699107 TAGAGAAATAATAAAGCAGGTGG - Intronic
1035684772 8:1515124-1515146 CAAAGAGAAAACAAGGAAGGAGG + Intronic
1035765583 8:2102424-2102446 CAGAGATAAAAAAATGAAAGAGG + Intronic
1035943422 8:3930492-3930514 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036534084 8:9628509-9628531 GAGAGAAAAAAAAAAGCAGGAGG - Intronic
1036966626 8:13305980-13306002 CACAGAAAAAATAAGCAACAGGG - Intronic
1037193610 8:16158621-16158643 TAGAGAAAAAAAAAAGAAGCAGG - Intronic
1037550940 8:19970795-19970817 CAAAAAAAAAAAAAGGAAGGTGG - Intergenic
1037864488 8:22432446-22432468 GAGAGAGAGAAAAAGGAAGGAGG - Intronic
1038210676 8:25516745-25516767 CAAAAAAAAAAAAAGGCAGGGGG - Intergenic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038738261 8:30192323-30192345 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
1038806345 8:30795958-30795980 CAGAAAGAAAGGAAGGAAGGAGG + Intronic
1038839911 8:31174848-31174870 AAGAGAAAGAAAAAGAAAGGAGG - Intergenic
1039161590 8:34627595-34627617 CTGAGAAACAGCAAGGAAGGTGG - Intergenic
1039226118 8:35390123-35390145 CAGAGGAGAAGCAAGGAAGGAGG + Intronic
1039314536 8:36356734-36356756 CAGAGAGAAAGAAGGGAAGGAGG + Intergenic
1039524550 8:38202555-38202577 CAGAAAAAAAAAAAAAAAGGGGG - Intronic
1039565537 8:38549694-38549716 CAGAGAAAAAATGATGAAATGGG - Intergenic
1039961757 8:42253902-42253924 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1040013605 8:42682451-42682473 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040500802 8:48003350-48003372 CAGGGAAAACATAATGAAAGTGG + Intergenic
1041371647 8:57167152-57167174 GAAAGAAAAAATGAGGGAGGGGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041548617 8:59075762-59075784 GAGAGAGAAAGCAAGGAAGGTGG + Intronic
1041745293 8:61202045-61202067 TAGAGGAAAACAAAGGAAGGAGG + Intronic
1041828834 8:62129268-62129290 CAGGCAAAAAATAAGGCAGTTGG - Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041921059 8:63181742-63181764 GAGACAAAAAATAAAGAACGTGG - Intronic
1042068770 8:64907308-64907330 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1042123683 8:65515117-65515139 CAGAGTAAAATTAAGAAAGATGG + Intergenic
1042312015 8:67388311-67388333 AAGAGAAGAAATCAGAAAGGTGG + Intergenic
1042338383 8:67653004-67653026 CTGAGAAAAAACAAGCAATGGGG - Intronic
1042563992 8:70094834-70094856 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1042601735 8:70505667-70505689 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1042901320 8:73731294-73731316 CAGAGAAAAAAGAGCTAAGGGGG - Intronic
1043033694 8:75170205-75170227 GAGAGAGAGAACAAGGAAGGAGG + Intergenic
1043089424 8:75878692-75878714 GAGAGAAAAAATAGGGAATCTGG - Intergenic
1043126728 8:76405772-76405794 GAGAGAAAAAAAAGGGGAGGGGG - Intergenic
1043506271 8:80906441-80906463 GTGAGAAAGAATAAGGAAGAGGG - Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044257931 8:90087746-90087768 CAGAGATAAAATATGAAAAGTGG - Intronic
1044295613 8:90523727-90523749 CAGAGAAAAATAAAGCAAGAGGG + Intergenic
1044338296 8:91015832-91015854 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044516364 8:93143317-93143339 GAGAGAAAGAAAGAGGAAGGAGG - Intronic
1044518709 8:93172306-93172328 CAGAAAAAAAATTAGGGAGTCGG + Intergenic
1044968687 8:97598520-97598542 CAGACAATGAAAAAGGAAGGAGG - Intergenic
1044983710 8:97740121-97740143 AAAAGAAAAAAAAAGGCAGGGGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045441872 8:102221868-102221890 TAGAGAAAAAAGAAGGGAAGAGG - Intronic
1045593122 8:103621397-103621419 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1045755870 8:105541126-105541148 TAGATCAAAAATAAGAAAGGAGG - Intronic
1045922574 8:107548257-107548279 CAAAAAAAAATTAAGGTAGGTGG - Intergenic
1046057175 8:109092916-109092938 CAGTGAAAACATAAGAAAAGCGG - Intronic
1046098952 8:109592653-109592675 CAGAGAAATGATAAGCAAAGAGG + Intronic
1046161366 8:110370146-110370168 GAGAGAAAAAAAAAAGATGGAGG - Intergenic
1046181309 8:110652432-110652454 CAGTGAAAAAACAAAGAAAGAGG - Intergenic
1046427811 8:114078107-114078129 ATGAGAAAAAAAAAGGAATGAGG + Intergenic
1046427920 8:114080012-114080034 CAGAAAAAAAAAAAAAAAGGGGG - Intergenic
1046489004 8:114922929-114922951 CAATGAAAAAATAAGGGAGAAGG - Intergenic
1046623836 8:116556625-116556647 GAGAGAGAAAATAAGGATGAGGG + Intergenic
1046885588 8:119363522-119363544 CAGAGACAAAATGAGGAGGCAGG - Intergenic
1046987875 8:120410766-120410788 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
1047286304 8:123490039-123490061 CAGAGACAAAAAATGGAAAGTGG + Intergenic
1047665952 8:127091328-127091350 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1047857715 8:128930483-128930505 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1047866625 8:129031419-129031441 CAGAGCAAAAAAAAAGGAGGAGG - Intergenic
1047909496 8:129512070-129512092 CACAGAAACACTGAGGAAGGAGG + Intergenic
1048267820 8:133003212-133003234 AAGAAAGGAAATAAGGAAGGAGG + Intronic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1048634513 8:136281448-136281470 AAGAGAAAAAATAAAGAATTTGG + Intergenic
1048949176 8:139479434-139479456 CAAATACAAAATAATGAAGGTGG + Intergenic
1050162854 9:2736075-2736097 AAAAGAAAAAAAAAAGAAGGAGG - Intronic
1050175270 9:2863674-2863696 CAGAGCAAGAAAAAGTAAGGGGG - Intergenic
1050352015 9:4749205-4749227 GGCAGAGAAAATAAGGAAGGAGG + Intergenic
1050512435 9:6410289-6410311 TAGGGAAAAAGTAAGGAAGAGGG - Intergenic
1050716120 9:8528261-8528283 CAGAGAAAGAAGAAAGAAAGAGG + Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050795059 9:9528736-9528758 CAGATAAAAAGAAAGAAAGGAGG + Intronic
1050899079 9:10922316-10922338 CAGAGAAAAAATTAGAAACTTGG - Intergenic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051093937 9:13443487-13443509 CAGAGGCAAAGTAAAGAAGGGGG - Intergenic
1051183436 9:14435297-14435319 CACAGCAAAAATTATGAAGGTGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051531990 9:18114476-18114498 ATGCTAAAAAATAAGGAAGGAGG + Intergenic
1051675716 9:19556370-19556392 CAGACAAAAAATAAGAAACCGGG - Intronic
1051744635 9:20283738-20283760 AAGAGAAAAAAAAAGGGGGGGGG + Intergenic
1051853065 9:21531549-21531571 AAGAGAGAAATTAGGGAAGGAGG - Intergenic
1051942097 9:22520120-22520142 CAGAGAAAAAATAACTAATGAGG + Intergenic
1052242699 9:26293489-26293511 CAGAAAAAAAATAAACGAGGTGG + Intergenic
1052412094 9:28134828-28134850 CAGTGAAGAAATAGGGAACGTGG + Intronic
1052428239 9:28332583-28332605 CAGAAAAAAAAAAAGGCAGGGGG + Intronic
1052859519 9:33428414-33428436 GAGAGAGAAAGTAAGGAGGGGGG + Intergenic
1052918188 9:33939962-33939984 AGAAGAAAAAATAAGGTAGGAGG + Intronic
1053335940 9:37271367-37271389 AAGGGAAGAAATATGGAAGGGGG + Intronic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054763638 9:69024978-69025000 TGGAGAAAAAACAAGGAAGAGGG - Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055342912 9:75304251-75304273 CTGAGAAAAAACAAGCAATGGGG - Intergenic
1055515011 9:77024736-77024758 AAGAGAAGCAATGAGGAAGGAGG + Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1055768877 9:79694774-79694796 CAGAAAAAAAAAAAAGCAGGGGG + Intronic
1055870335 9:80869915-80869937 CAAAGAAAATATACTGAAGGTGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056373140 9:85979340-85979362 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1056798973 9:89678217-89678239 CAGAGACAAAAGGAGGGAGGGGG + Intergenic
1056912164 9:90711377-90711399 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1057136747 9:92695408-92695430 CATAGAATAAATCAGGGAGGAGG + Intergenic
1057357588 9:94344659-94344681 CAGAGAGAAAATAAACAAGTAGG - Intergenic
1057420440 9:94907866-94907888 CAGAGAGCAAATGAGGAAAGAGG - Intronic
1057466980 9:95323270-95323292 CAGAGCAAAAAAAAAAAAGGAGG + Intergenic
1057650165 9:96912966-96912988 CAGAGAGAAAATAAACAAGTAGG + Intronic
1058031898 9:100209360-100209382 CACATGAAAAATAAGGAGGGTGG - Intronic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058655416 9:107216174-107216196 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
1058914854 9:109555838-109555860 AAGGGATAAAAGAAGGAAGGGGG + Intergenic
1058977021 9:110134278-110134300 CTTAAAAAAAAAAAGGAAGGTGG + Intronic
1059066289 9:111088828-111088850 AAGAAAGAAAAAAAGGAAGGAGG - Intergenic
1059200785 9:112413988-112414010 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1059372569 9:113854597-113854619 GAGAGAAAAAAAAAAGAAGAGGG + Intergenic
1059481963 9:114598379-114598401 CAGGGAAAAAAAAAAGAATGGGG - Intergenic
1059682511 9:116599847-116599869 AAGAGAGAAAATAAGAAAAGGGG - Intronic
1059686326 9:116640422-116640444 AAGTGAAAAAATAAACAAGGAGG + Intronic
1059818437 9:117944874-117944896 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1060344648 9:122805624-122805646 CAGAGAACAAAAAGGGAAGGAGG - Intronic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1061470079 9:130817445-130817467 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1061567070 9:131447949-131447971 CAGGGAGTAAATGAGGAAGGAGG - Intronic
1062308123 9:135921048-135921070 GAGATAAATAATAAGGAATGCGG + Intergenic
1062746268 9:138214381-138214403 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1062746636 9:138217171-138217193 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185679146 X:1874000-1874022 GAGAGAAAAAAAAAGGAGAGAGG - Intergenic
1185703783 X:2251450-2251472 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186077582 X:5897906-5897928 GAGAGAGAAAAGAGGGAAGGGGG - Intronic
1186155727 X:6724509-6724531 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1186206734 X:7208661-7208683 AAGGAAAAATATAAGGAAGGAGG - Intergenic
1186359375 X:8823637-8823659 CACAGAAAGAAAAAGGCAGGGGG - Intergenic
1186639917 X:11444550-11444572 GACAGAAAGAATAAGGAAGAGGG - Intronic
1186643782 X:11484502-11484524 AAGAGAAAAAAGGAAGAAGGAGG + Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187042057 X:15607163-15607185 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1187188846 X:17013765-17013787 CTGAGGAAAAAAAAGGAAAGGGG - Intronic
1187189535 X:17020624-17020646 CAGAAAAAAAAAAAAGAAGCAGG - Intronic
1187277425 X:17828201-17828223 CAGAAAATTAATAAGAAAGGTGG + Intronic
1187334891 X:18373383-18373405 GAGTGAAAAAATAGGGAATGGGG - Intergenic
1187385487 X:18844662-18844684 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1187833603 X:23408134-23408156 CAGTAAAAGAATAAGGGAGGAGG - Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188157460 X:26757123-26757145 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1188207273 X:27375887-27375909 CAGAGGAAAACAAAGGAAGGAGG - Intergenic
1188688428 X:33098897-33098919 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1188740593 X:33774554-33774576 GAGAGAAAAAATAATGAAACTGG - Intergenic
1188896276 X:35672275-35672297 AAGATAAAGAAGAAGGAAGGTGG - Intergenic
1188916448 X:35917285-35917307 CAGACATAAAAAAAGGAACGAGG + Intergenic
1189061636 X:37759682-37759704 TAGAGAAGAAATGAGGAATGGGG + Intronic
1189197146 X:39162252-39162274 GAGAGAAGAAGGAAGGAAGGTGG - Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189416916 X:40823420-40823442 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1189582471 X:42421623-42421645 CAGACAAAAAACAAGCAATGGGG + Intergenic
1189620647 X:42833833-42833855 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1189782272 X:44526470-44526492 CAGTAAAAAAATAAAAAAGGGGG + Intronic
1189823304 X:44891828-44891850 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1189941252 X:46124085-46124107 CATATAACAAATAAGGAAGTTGG - Intergenic
1189964647 X:46360044-46360066 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1190241947 X:48663783-48663805 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
1190400368 X:50027457-50027479 CAGAGAAAGAATGAGCAAGCTGG - Intronic
1190480441 X:50871591-50871613 AAGAGAAAAAGTAGGGAAGGAGG - Intergenic
1190730184 X:53220759-53220781 CAGAGAAACTATAAGGGAAGTGG + Intronic
1190827119 X:54027920-54027942 TAGAAAAAAAAACAGGAAGGGGG + Intronic
1190962665 X:55267726-55267748 AATAGAAAAGATAAGAAAGGGGG - Intronic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1191101220 X:56730533-56730555 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1191261077 X:58322210-58322232 CCGAGAAAAAACTAGGAAGAGGG + Intergenic
1191594514 X:62927819-62927841 CAGGAATAAAATAAGGAATGTGG - Intergenic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1192236554 X:69299811-69299833 CAGAGATACAGTTAGGAAGGGGG + Intergenic
1192269714 X:69567182-69567204 TAGAGAGAAAATGAGGAAGGGGG + Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192531936 X:71895587-71895609 AAGAGAAAAGAAAAGGAAAGAGG + Intergenic
1192573958 X:72228039-72228061 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1192818162 X:74615522-74615544 AGGAGAAAAATCAAGGAAGGGGG + Intergenic
1193039135 X:76986458-76986480 TTGAAAAAATATAAGGAAGGGGG - Intergenic
1193501789 X:82285365-82285387 AATATAAATAATAAGGAAGGGGG + Intergenic
1193545514 X:82822601-82822623 AAGAGAAAAAGAAAGGAAAGAGG - Intergenic
1193678746 X:84490164-84490186 AAGAGAAAAAAAAAGGAGAGAGG - Intronic
1194437201 X:93882256-93882278 CAGAGAAACAATGAGGTAAGGGG + Intergenic
1194962777 X:100254919-100254941 CTGACAAAAAATAAGCAATGGGG + Intergenic
1195028273 X:100900359-100900381 TAGTGAAAAAATAAGGACTGGGG - Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1195785715 X:108519771-108519793 CAGGGAAAAAGTGAGGAAAGTGG - Intronic
1195796828 X:108658476-108658498 TAAAGAAAAAATAGAGAAGGAGG - Intronic
1196123711 X:112077849-112077871 AATAGAAAAGATAAGGCAGGTGG - Intronic
1196242818 X:113363646-113363668 AAGACAAGAAATAAGGAAAGAGG - Intergenic
1196467403 X:115986733-115986755 CTGAGAAAAAACAAGCAATGGGG + Intergenic
1196834495 X:119801932-119801954 GAAAGAAAAAAGAAAGAAGGAGG - Intergenic
1196874222 X:120143334-120143356 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1196949447 X:120862137-120862159 CTGACAAAAAATAAGCAACGGGG - Intergenic
1197192944 X:123669160-123669182 CAAAAAAAAAAAAAGGAGGGAGG + Intronic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197563646 X:128054169-128054191 CAAAGATAAAATTAGGCAGGTGG - Intergenic
1197800014 X:130339060-130339082 GAGAGAAAGAGAAAGGAAGGAGG - Intergenic
1197843937 X:130780575-130780597 TAGAGAAAATACAAAGAAGGGGG + Intronic
1197923091 X:131616741-131616763 GAGAGAGAAAACAAAGAAGGAGG - Intergenic
1198026442 X:132712313-132712335 CAGAGATCAAATGAGGAAGGTGG - Intronic
1198109645 X:133491704-133491726 CAGAAAAAAAAGTAGGAATGGGG + Intergenic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198736522 X:139791758-139791780 CAGAGACAAAGGAATGAAGGGGG + Intronic
1198827067 X:140710301-140710323 TAGAGAGAAAATGAGGAAGAGGG + Intergenic
1198840241 X:140848698-140848720 CAGATAAAAAACAAAGAAGGAGG + Intergenic
1198864282 X:141105038-141105060 AAAAGAAAAAAGAAGGGAGGAGG - Intergenic
1198874976 X:141214629-141214651 CGCAGCAAAAATAAGGGAGGTGG + Intergenic
1198898407 X:141482378-141482400 AAAAGAAAAAAGAAGGGAGGAGG + Intergenic
1199179662 X:144838606-144838628 AAGGGAAAAAGAAAGGAAGGAGG - Intergenic
1199989739 X:152979729-152979751 CAGAGAAAAAGCAAGGAAGCAGG - Intergenic
1200310643 X:155073339-155073361 TAGAAAAAAAAAAAGGAAGTGGG - Intronic
1200383289 X:155862394-155862416 CAAAGTCAAAATAAGGAAGTAGG - Intergenic
1200543083 Y:4483934-4483956 AATACAGAAAATAAGGAAGGGGG + Intergenic
1200882810 Y:8237040-8237062 AAAAAAAAAAATAAGGAAGGTGG + Intergenic
1200915187 Y:8565261-8565283 CACAGAAAAAATAAAGAAAATGG - Intergenic
1201470015 Y:14322795-14322817 GAAAGAAGAAAAAAGGAAGGGGG - Intergenic
1201578607 Y:15487806-15487828 AAGGAAAAATATAAGGAAGGAGG - Intergenic
1201676144 Y:16586715-16586737 CAGAGAGAGAAAAAGAAAGGGGG - Intergenic
1201690525 Y:16759864-16759886 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1202374414 Y:24220524-24220546 GAGAAAAAAAGGAAGGAAGGAGG + Intergenic
1202496366 Y:25449596-25449618 GAGAAAAAAAGGAAGGAAGGAGG - Intergenic