ID: 972643157

View in Genome Browser
Species Human (GRCh38)
Location 4:40943560-40943582
Sequence TCTCCATACCAAACTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972643152_972643157 14 Left 972643152 4:40943523-40943545 CCAGGATCCAACTGGGTGGGGAC 0: 1
1: 0
2: 1
3: 6
4: 117
Right 972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 136
972643151_972643157 15 Left 972643151 4:40943522-40943544 CCCAGGATCCAACTGGGTGGGGA 0: 1
1: 0
2: 2
3: 12
4: 99
Right 972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 136
972643154_972643157 7 Left 972643154 4:40943530-40943552 CCAACTGGGTGGGGACAGGAAGA 0: 1
1: 0
2: 1
3: 41
4: 259
Right 972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972643157 Original CRISPR TCTCCATACCAAACTCCTTG AGG Intronic
902241273 1:15090952-15090974 TCTCCATTTTAAACTCCTTGAGG - Intronic
906672782 1:47668888-47668910 TCTGTAGACTAAACTCCTTGAGG + Intergenic
912375905 1:109209785-109209807 TCCCCATTCCAACCTTCTTGTGG - Intergenic
912564687 1:110579258-110579280 TCTCCATGCCAGACACCCTGAGG + Intergenic
913254380 1:116940539-116940561 TCCCCATCCAAAATTCCTTGTGG - Intronic
918105132 1:181410298-181410320 TCTCCTTACCAAGCTCATTCTGG + Intergenic
919917427 1:202147391-202147413 TCTCCAGATCCAACTCCTCGGGG + Exonic
1063515972 10:6695649-6695671 TTTCCATTCCAAACTCTTGGTGG - Intergenic
1066333269 10:34448374-34448396 TTTCCACACCCAACTCCCTGTGG - Intronic
1066369623 10:34809466-34809488 TCTCCATCCCAAGCTGCTAGAGG - Intronic
1067535035 10:47102839-47102861 TCTCCAGACCAAACACCTTTGGG + Intergenic
1068812938 10:61277079-61277101 TGTCCATACTAAACTTTTTGAGG - Intergenic
1071246645 10:83772480-83772502 ACTCCACACCACAGTCCTTGAGG - Intergenic
1084312854 11:68326800-68326822 TCTCCACACCAGAGTCCTTGCGG + Intronic
1085114554 11:73919202-73919224 CCTCCAGTTCAAACTCCTTGAGG + Intronic
1087403585 11:97699955-97699977 CCCCCAGACCAAACTTCTTGGGG + Intergenic
1088329249 11:108633399-108633421 CCTATAGACCAAACTCCTTGTGG + Intergenic
1088716522 11:112554275-112554297 TCTCCTTACCAAATACTTTGAGG + Intergenic
1088994399 11:114983996-114984018 CCACCAACCCAAACTCCTTGAGG + Intergenic
1095287866 12:40437588-40437610 GCTAAATACCAAACTCCTTAAGG + Intronic
1096767245 12:53901824-53901846 TCTACAAACTAAACTCCTTGAGG + Intergenic
1097992978 12:65856105-65856127 CTTCCATAGCAAACTCCTTTGGG + Exonic
1098012739 12:66071653-66071675 TTTCCTCACCAAACTCCCTGAGG - Intergenic
1098181663 12:67853688-67853710 TATCTAAACCAAACTTCTTGTGG + Intergenic
1098422936 12:70323053-70323075 TGTCTATACCATTCTCCTTGAGG + Intronic
1100388222 12:94123331-94123353 TCTCCAGAGCAGGCTCCTTGTGG + Intergenic
1102016661 12:109652516-109652538 ACTCCATTCCAAACTCTTTATGG - Intergenic
1102582695 12:113900886-113900908 CATCCCTCCCAAACTCCTTGGGG + Intronic
1102795384 12:115684858-115684880 TCACAATACCTAACTCATTGAGG - Intergenic
1105547178 13:21359411-21359433 TTTCCATTCCAGACTCCTGGAGG + Intergenic
1108285888 13:48907527-48907549 TCTCCCCACCAAATTCTTTGAGG + Intergenic
1111586584 13:90290618-90290640 TCACCATACAACACTCCTTTGGG + Intergenic
1112281339 13:98065415-98065437 GCTGCATCCCAAACACCTTGGGG - Intergenic
1115877859 14:37880807-37880829 GCTCCATACCAAACAACCTGAGG + Intronic
1116486432 14:45454541-45454563 TCTCCATTCCCCACTCCTTTTGG + Intergenic
1122205372 14:100145568-100145590 TCTCCATTCCTAAGTCCTGGAGG + Exonic
1124516543 15:30371375-30371397 TCTCCATAAGAGACTCCTTTGGG - Intronic
1124726375 15:32159356-32159378 TCTCCATAAGAGACTCCTTTGGG + Intronic
1125464572 15:39938057-39938079 TCTCCTTAACAAACGACTTGGGG - Intronic
1126841488 15:52721461-52721483 GCTCCAAACCCAACTCCTTGAGG + Intergenic
1127844287 15:62856331-62856353 TCCCCAGACCAAACACCTTCAGG + Intergenic
1128531186 15:68449207-68449229 TCTCCACAACATACTCCTTTGGG + Intergenic
1128618852 15:69131944-69131966 TCTCCCTAGCAAAGGCCTTGAGG - Intergenic
1133060896 16:3174085-3174107 TCACCATACCAAACACCTGGAGG - Intergenic
1136237373 16:28923038-28923060 TCTTCATAACAAACTCTGTGAGG - Intronic
1137028788 16:35503007-35503029 TCTCCAGATCAAAGTCCTTCAGG + Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1141710920 16:85698572-85698594 GCTCCATGCCAAACTCCACGTGG + Intronic
1142221191 16:88856094-88856116 CCTCCTTCCCTAACTCCTTGTGG - Intronic
1142516179 17:430927-430949 TTTCCAAACCAAACCCCTTTCGG - Intergenic
1144461743 17:15464045-15464067 CCTCCATGCCATACTCCTAGAGG - Intronic
1149702873 17:58669921-58669943 ACTCCATCCCACGCTCCTTGAGG + Intronic
1156905704 18:42349222-42349244 TCTCCATGCTCAACCCCTTGTGG - Intergenic
1157983897 18:52415519-52415541 TCTAGATTACAAACTCCTTGAGG - Intronic
1158230593 18:55250189-55250211 TCTCCCTACCAGGGTCCTTGAGG - Intronic
1158696573 18:59709131-59709153 CCACCATACCAAACTTCTGGTGG - Intergenic
1159676689 18:71293097-71293119 TGTCCATACAATAATCCTTGCGG - Intergenic
1160382536 18:78471582-78471604 ACTAGATTCCAAACTCCTTGAGG + Intergenic
1162115476 19:8426759-8426781 TCTCCACTGCAAACTCCGTGTGG - Exonic
1167080129 19:47272369-47272391 CCTCCATACCAAATTCCTATTGG - Intergenic
1168322466 19:55518292-55518314 TGTCCCTTCCAACCTCCTTGGGG + Exonic
925378319 2:3404919-3404941 TCTCCAGACTAATCTTCTTGTGG - Intronic
926506704 2:13724908-13724930 TCTCCATACCAGTCTACTTCTGG - Intergenic
927330859 2:21861913-21861935 TCTCCAAGCCAAACTCCCTTAGG - Intergenic
927507740 2:23625582-23625604 TCTCCATTCAACACTCCCTGGGG + Intronic
930684339 2:54291484-54291506 CCTCTATTCCAAACTCCTTCTGG + Intronic
932627518 2:73309395-73309417 ACTCGACACCAAGCTCCTTGTGG + Intergenic
934789855 2:97049914-97049936 TCTTCCTTCCTAACTCCTTGGGG + Intergenic
934816614 2:97332625-97332647 TCTTCCTTCCTAACTCCTTGGGG - Intergenic
934821082 2:97375859-97375881 TCTTCCTTCCTAACTCCTTGGGG + Intergenic
935182093 2:100700603-100700625 TCTCCAAACCAACCCCTTTGTGG + Intergenic
936856962 2:116969963-116969985 TCTCAGTCCAAAACTCCTTGGGG - Intergenic
937511604 2:122601686-122601708 TCTCCATACCAGCCTACTTGTGG - Intergenic
937876195 2:126827231-126827253 CTTCCCTAACAAACTCCTTGAGG + Intergenic
944809280 2:203312152-203312174 TCTCCAAAACAGACTGCTTGTGG + Intergenic
945419619 2:209618359-209618381 TCACAATACAAAAGTCCTTGAGG + Intronic
1170803455 20:19609834-19609856 GCTCCAAACCAAACTCTTTGTGG - Intronic
1172473673 20:35220992-35221014 TCTACATAGCAAACTCCTGCTGG + Intergenic
1173802444 20:45902850-45902872 TCTCCAATCCAGACTCTTTGTGG + Intronic
1175461975 20:59158566-59158588 TCTCCAGCCCAAACTCCTCCAGG - Intergenic
1177552255 21:22639575-22639597 TCTCTATACCTAATTCATTGAGG - Intergenic
1179377494 21:40863925-40863947 TTCCCATTCCAGACTCCTTGGGG - Intergenic
1180584879 22:16879076-16879098 TCTCCTTACCTGACTCCTTTGGG + Intergenic
1182232177 22:28846645-28846667 TGTCCACACCGAACTCCTTGAGG - Intergenic
950785258 3:15428522-15428544 CCTCCAGACCAAGTTCCTTGTGG + Intronic
952311694 3:32196499-32196521 TCTCCATGCCCAGCTCCTTCGGG + Intergenic
953989120 3:47470368-47470390 TCTCCATCCCAAGCCCCTTTAGG - Intronic
959561145 3:107782871-107782893 TTTCCCTACCAAATTTCTTGAGG - Intronic
964530860 3:157666228-157666250 ACCCCATACAAACCTCCTTGTGG - Intronic
965552974 3:169988385-169988407 GCTCAATACCAACCTTCTTGAGG - Intronic
965665003 3:171083974-171083996 TCTACATATAAAACTCCTTTTGG + Intronic
968420614 4:481249-481271 TCTCCATCCCAATTTTCTTGGGG + Intronic
970780351 4:19730197-19730219 TCTTCATACCAAATTGCTTGCGG - Intergenic
972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG + Intronic
974688134 4:65258537-65258559 TCTCCAGTCCAAACTCCTAATGG - Intergenic
975096316 4:70461062-70461084 TCTCAATACTGAACCCCTTGGGG + Intronic
977123112 4:93129448-93129470 TCTCGATGCCAGAATCCTTGCGG - Intronic
979507980 4:121519777-121519799 TCTCCATACTAACATCCCTGTGG + Intergenic
981256973 4:142673465-142673487 TCTCTGTCCCAACCTCCTTGTGG - Intronic
983567946 4:169174545-169174567 TCTCCTTCCCAATCTCCTTTGGG + Intronic
983940642 4:173531496-173531518 TTTCCACACCGAACTCCTTCGGG - Intergenic
991343043 5:65633003-65633025 ACTCCTTTCCAAACTCCATGAGG - Intronic
991658136 5:68923645-68923667 TCTCCCTACCAACCTCCTGGTGG - Intergenic
995638088 5:114219026-114219048 TCACCACACTCAACTCCTTGTGG + Intergenic
996493846 5:124130456-124130478 ACTCTGTACCAAACTACTTGGGG - Intergenic
999827855 5:155291422-155291444 TCTTTACACTAAACTCCTTGAGG - Intergenic
1003404500 6:5817302-5817324 TTTCCATTCCAGACTCCTGGAGG - Intergenic
1005867355 6:29946084-29946106 CCTGCATACAAATCTCCTTGTGG + Intergenic
1006787891 6:36680037-36680059 TCTCCGTCCCAAACCCCTGGGGG + Intronic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1008644231 6:53496778-53496800 TCTACATACAAATCTCTTTGGGG - Intergenic
1009995199 6:70889001-70889023 GCTAGATACAAAACTCCTTGAGG + Intronic
1013186494 6:107764010-107764032 TCTTCATACAAAACTCCCTTGGG + Intronic
1013386923 6:109640773-109640795 TCTCCAGTTAAAACTCCTTGTGG + Intronic
1014369333 6:120584638-120584660 TAAACCTACCAAACTCCTTGTGG - Intergenic
1015575805 6:134669829-134669851 TCTCCACTCCCAACCCCTTGTGG + Intergenic
1017225798 6:152019981-152020003 ACTCAATAGTAAACTCCTTGAGG - Intronic
1027194691 7:76021632-76021654 ACCCCATTCCAAACTCCTTGGGG + Intronic
1029379530 7:100203918-100203940 TCTCCCTCCCAAACTCCCTTAGG - Intronic
1031237329 7:119192807-119192829 TCTCCAAACTAAAATCTTTGTGG + Intergenic
1031757687 7:125666501-125666523 TGTTCATATGAAACTCCTTGGGG + Intergenic
1032526722 7:132583410-132583432 CCTCCACACCATTCTCCTTGAGG + Intronic
1035247163 7:157570547-157570569 ACTTCATACCCAACTCCTTTTGG - Intronic
1036110907 8:5901077-5901099 TCTCCAAATCAACTTCCTTGAGG - Intergenic
1036404101 8:8439573-8439595 TCACCATACCCAACCCTTTGAGG - Intergenic
1037863558 8:22424647-22424669 TTTGCATACCAAATTCCTTCTGG + Intronic
1038148116 8:24917052-24917074 TCTCCTTAGAAAACTCCTGGAGG + Exonic
1044469388 8:92548675-92548697 TTTCCATACAAAACTCTCTGAGG - Intergenic
1045689839 8:104748909-104748931 CATCCATTCCAAACTCCTTGTGG + Intronic
1047742073 8:127814549-127814571 TCTCCCTAGCAAACCCTTTGAGG + Intergenic
1052411675 9:28129253-28129275 TCTCCTTAATAAACTCCTTTTGG + Intronic
1052546597 9:29888710-29888732 TAAGCATACCAAACTCCTGGGGG + Intergenic
1052664669 9:31479422-31479444 TCTCCATATTAAAATCTTTGAGG + Intergenic
1054929023 9:70617342-70617364 TCTCCATACCACTCTTCCTGTGG - Intronic
1055103545 9:72489823-72489845 TCTACATCCAAAACTCCTTTAGG + Intergenic
1057254463 9:93533892-93533914 TTTACATAGCAAACTCCTTCAGG + Intronic
1057859353 9:98627326-98627348 TCTCCCTACCAAGCTTCTGGTGG - Intronic
1059005748 9:110400175-110400197 TTTGCATACCTAAATCCTTGTGG + Intronic
1059194103 9:112354496-112354518 TCTCCATACCACCCCCCTGGGGG + Intergenic
1187393772 X:18903237-18903259 TCACCAGATCAAACTCCATGCGG - Intronic
1188561774 X:31476650-31476672 ATTCCAATCCAAACTCCTTGCGG - Intronic
1190795256 X:53735060-53735082 TCTGCATACCAAAGTGCTTAGGG + Intergenic
1192408453 X:70910371-70910393 TCTCCAAACCAAATGGCTTGAGG + Intergenic
1192921505 X:75712117-75712139 ACTTAATACCAAACTTCTTGGGG + Intergenic
1194762720 X:97813677-97813699 ACTCCAGTCCAAACTCCATGGGG + Intergenic
1199056013 X:143295715-143295737 TCTATATTTCAAACTCCTTGTGG - Intergenic
1200925281 Y:8648773-8648795 TCTGCATACCTTTCTCCTTGTGG - Intergenic
1200983630 Y:9284658-9284680 CCTGCATACCTCACTCCTTGTGG + Intergenic
1201191601 Y:11448269-11448291 TCTCCTTACCTGACTCCTTTGGG + Intergenic
1202126740 Y:21575030-21575052 CCTGCATACCTCACTCCTTGTGG - Intergenic