ID: 972644981

View in Genome Browser
Species Human (GRCh38)
Location 4:40959007-40959029
Sequence TATTGCTGTCACTCATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972644981_972644988 16 Left 972644981 4:40959007-40959029 CCACCTAATGAGTGACAGCAATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 972644988 4:40959046-40959068 AGGCAGGATTTATTTAGGTTTGG 0: 1
1: 0
2: 2
3: 16
4: 175
972644981_972644986 11 Left 972644981 4:40959007-40959029 CCACCTAATGAGTGACAGCAATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 972644986 4:40959041-40959063 ATACCAGGCAGGATTTATTTAGG 0: 1
1: 0
2: 1
3: 94
4: 255
972644981_972644983 -4 Left 972644981 4:40959007-40959029 CCACCTAATGAGTGACAGCAATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 972644983 4:40959026-40959048 AATACAACCTGTTCAATACCAGG 0: 1
1: 0
2: 0
3: 7
4: 133
972644981_972644989 20 Left 972644981 4:40959007-40959029 CCACCTAATGAGTGACAGCAATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 972644989 4:40959050-40959072 AGGATTTATTTAGGTTTGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 241
972644981_972644984 0 Left 972644981 4:40959007-40959029 CCACCTAATGAGTGACAGCAATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 972644984 4:40959030-40959052 CAACCTGTTCAATACCAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972644981 Original CRISPR TATTGCTGTCACTCATTAGG TGG (reversed) Intronic
902168076 1:14588691-14588713 TTGTCCTGTCATTCATTAGGAGG - Intergenic
905683398 1:39890942-39890964 TATTGCTGTCACTATGTAGCTGG + Intergenic
908754788 1:67459421-67459443 TGTTGCTGACACTCATTTTGTGG - Intergenic
912189761 1:107324200-107324222 TATTGCTGTTGCTCAGTAAGAGG - Intronic
914751154 1:150535919-150535941 AATTGCAGTCACTGATTATGTGG - Intergenic
918338699 1:183548631-183548653 TAATGCTGTCACTGAATAGCTGG - Intronic
924042888 1:240000731-240000753 TATTGCTATCACTTGTTTGGGGG + Intergenic
924187427 1:241509108-241509130 TTTTGCTGTCATTTATTAGCAGG - Intronic
924446192 1:244134097-244134119 TTTTGCTGTCATTAATTAGCGGG - Intergenic
1071213712 10:83374325-83374347 TATTGCAGTCACTCTGTTGGTGG + Intergenic
1078925942 11:15875165-15875187 AATTGCTGTAACTCAGGAGGTGG - Intergenic
1081070114 11:38601581-38601603 TAGTCCTGTCTCTCAGTAGGAGG - Intergenic
1081084993 11:38788300-38788322 TATTGCCAACACTCCTTAGGGGG + Intergenic
1087213301 11:95465821-95465843 TGTTGCTGTCACTCTATATGAGG + Intergenic
1090947287 11:131442332-131442354 TATTGCTGTCATCGATGAGGAGG - Intronic
1092109376 12:5948214-5948236 TGTTGTTCTCACTCATAAGGTGG - Intergenic
1093572511 12:20683237-20683259 TATTGCTGTCACCAAAAAGGGGG - Exonic
1096901869 12:54891546-54891568 TATTGATGTAACAGATTAGGAGG - Intergenic
1098838218 12:75446514-75446536 TATTGAAGTCACTCATTAGAAGG - Intergenic
1099806112 12:87521273-87521295 TATGGCTGTCACAAACTAGGGGG + Intergenic
1101958616 12:109231642-109231664 TATAGCTCTGACTTATTAGGGGG + Intronic
1108276238 13:48812611-48812633 TATTGCTCTCACTCATATGTGGG - Intergenic
1111390501 13:87588587-87588609 AATTGTTGTCACTCATAAGTGGG + Intergenic
1115824155 14:37246814-37246836 AATTGCTGGCATTCATTAGCTGG + Intronic
1117060937 14:51962830-51962852 GATTGCTGTGACTCATTATAAGG + Intronic
1119835967 14:77748979-77749001 TATTTCTGTAACTCAGTAAGTGG - Intronic
1120110803 14:80553314-80553336 TATTGTTCTCACTCATAAGTGGG - Intronic
1120831489 14:89001230-89001252 TATTGTTGTCCCTCATTTGGGGG + Intergenic
1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG + Intronic
1121459043 14:94059682-94059704 TAGTTCTGTCACTCCTTAGGTGG - Intronic
1125385105 15:39128948-39128970 TAGTGGAGCCACTCATTAGGTGG - Intergenic
1125458557 15:39886323-39886345 TACTGCTGACACTCAGCAGGAGG - Intronic
1125914186 15:43470641-43470663 TAATCCTGACACACATTAGGAGG + Intronic
1128543561 15:68552922-68552944 TCCTGCTGTCAGTCTTTAGGTGG + Intergenic
1131241331 15:90746107-90746129 TACTTCTTTCACTCATTAGCAGG - Intronic
1134415174 16:14037277-14037299 TATTGCTGGCGCTCAATAGATGG + Intergenic
1134796142 16:17038798-17038820 TATTCCTGGAACACATTAGGTGG + Intergenic
1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG + Intronic
1151981849 17:77516430-77516452 TCTTGTTGTCACTTATTAGTGGG - Intergenic
1154346308 18:13546200-13546222 AATGGCTGTCACTCATCAAGTGG + Intronic
1166402519 19:42493927-42493949 AATTGCTTTAACTCATGAGGCGG - Intergenic
926754753 2:16225833-16225855 TATGGGTGTAACTCATTAGTGGG + Intergenic
930959897 2:57249002-57249024 AATTACTGTCAATCATTTGGTGG + Intergenic
931759700 2:65405973-65405995 TCTTCCTGGCACTCATTTGGAGG + Intronic
934700379 2:96434883-96434905 TATTTATGACACTCATTAAGAGG - Intergenic
941525916 2:166607094-166607116 TACTGCCTTCACACATTAGGTGG - Intergenic
1173016730 20:39232740-39232762 TGTTGCTGGCACTCCTCAGGAGG - Intergenic
1174873809 20:54207365-54207387 TTTAGCTGTCACTCATAAGTGGG - Intergenic
1179371205 21:40807546-40807568 TATTGCACTCACTGATCAGGAGG - Intronic
1181983482 22:26782922-26782944 AATTGCTGTGACTCAGTGGGAGG + Intergenic
952391736 3:32886322-32886344 TATTGCATTCACTCAAAAGGAGG + Intronic
959201186 3:103249805-103249827 TATTGTTGTCACCAATTATGTGG + Intergenic
959941108 3:112082448-112082470 TGTTGTTTTCACTCATTTGGTGG - Intergenic
961321054 3:126076397-126076419 AATGTCTGTCACTCATTAGTGGG - Intronic
961797632 3:129421169-129421191 TGTTGCTTTCAGTCATTTGGGGG + Intronic
965288403 3:166845652-166845674 TCATGCTGTCACTCATAAGTGGG - Intergenic
966054564 3:175668513-175668535 AATTGCTGTTACTCATTCTGTGG - Intronic
969907220 4:10408441-10408463 TATTGCTGTCACCCACTAACTGG + Intergenic
971524747 4:27602941-27602963 TATTGCTATCACTCATTGCTAGG - Intergenic
971735668 4:30447267-30447289 TCTTGTTGTCACTCATTTGAAGG - Intergenic
972644981 4:40959007-40959029 TATTGCTGTCACTCATTAGGTGG - Intronic
973228653 4:47816803-47816825 TATGGCTGGCATTTATTAGGTGG - Intronic
980478093 4:133346756-133346778 TATTTCTGTAACTCATTATGAGG - Intergenic
983632766 4:169866447-169866469 TTTTGCTGTCAACAATTAGGTGG + Intergenic
984294416 4:177836166-177836188 TATTTCTGTCACTTAATAGTTGG + Intronic
985620974 5:955893-955915 TATGGCTGTCACTCATAGGAGGG - Intergenic
991041616 5:62182096-62182118 TATTCCCATGACTCATTAGGAGG - Intergenic
992017527 5:72590846-72590868 CATTGCTTTCACTCCTTAGAGGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994277872 5:97860939-97860961 TCTTGCTGTCACTTATAAGTGGG + Intergenic
998679584 5:144452163-144452185 TATTCCTGTCACTCTCTAAGAGG + Intronic
1000309141 5:160024742-160024764 TATTACTGTTACTCTTGAGGTGG - Intronic
1002588700 5:180271748-180271770 TCTTGCTGCCACTCATAAGAGGG + Intronic
1002800908 6:520822-520844 GATTGTTGGCACTCAATAGGTGG - Intronic
1004759643 6:18652254-18652276 TCTTGCTTTCAATCATTTGGGGG - Intergenic
1005613457 6:27549078-27549100 TATTGCAGTTGCTCATTTGGAGG + Intergenic
1005718324 6:28574940-28574962 TCTTTCTGTCACTCCTAAGGTGG - Exonic
1008449284 6:51631625-51631647 TATTTCTTTCACTCATTGGCTGG + Intronic
1008680852 6:53870469-53870491 CATTGCTGTAATTTATTAGGAGG + Intronic
1009395766 6:63198553-63198575 TATTGCTTTCAATAATTTGGAGG - Intergenic
1011896911 6:92239143-92239165 TATTGTTCTCACTCATAAGTGGG - Intergenic
1013931355 6:115537736-115537758 TATTTCTGTCTCTCATTAACTGG + Intergenic
1015991260 6:138945911-138945933 CATTGTTATCACTCATTAGAAGG - Intronic
1016802859 6:148184038-148184060 TGTTGCTGTCAGTCATTTGCTGG + Intergenic
1023972846 7:45004137-45004159 TCTTGCTGTCACTCAGGTGGTGG - Intronic
1026263316 7:68774430-68774452 TATTGTTGTCACTGACTAAGTGG - Intergenic
1028823494 7:95241640-95241662 AATTGCTGTGACTCCTGAGGAGG - Intronic
1035853147 8:2942093-2942115 CATTGCTCTCACTCATGAGTGGG + Intronic
1043254288 8:78113803-78113825 TATTCCTGTCACTAATTGGGGGG - Intergenic
1046868787 8:119180989-119181011 TTTTGCTGTCACACATCAAGTGG + Intronic
1052120292 9:24706263-24706285 TATTTTTGTCACTCTTTAAGTGG + Intergenic
1052243890 9:26310063-26310085 TATTGCAGACACTCATTAACTGG - Intergenic
1053640334 9:40069044-40069066 TAGTGCTGTCAGACATCAGGTGG - Intergenic
1053765801 9:41396429-41396451 TAGTGCTGTCAGACATCAGGTGG + Intergenic
1054321031 9:63665040-63665062 TAGTGCTGTCAGACATCAGGTGG - Intergenic
1054544414 9:66307582-66307604 TAGTGCTGTCAGACATCAGGTGG + Intergenic
1055737965 9:79353068-79353090 GATTGCTTTCACGAATTAGGTGG - Intergenic
1060428077 9:123523225-123523247 TGTTGCTGTCACACGTAAGGGGG - Intronic
1060702305 9:125767051-125767073 TGTTGCTGTCGCTCATCAGGTGG + Intronic
1061661596 9:132133823-132133845 TATTGCTGTCTCTCACAGGGTGG - Intergenic
1188300556 X:28502568-28502590 TATTGCTGTCACTCTTTTCTAGG + Intergenic
1188326783 X:28814098-28814120 GATTACCGTAACTCATTAGGAGG - Intronic
1189152159 X:38719902-38719924 TAGTCCTGTCTCTCATTGGGAGG + Intergenic
1190897568 X:54636003-54636025 TCTTGCTCTCAGTCCTTAGGTGG + Intergenic
1196137297 X:112223773-112223795 TATTGCTATGAATTATTAGGTGG - Intergenic
1196627959 X:117899392-117899414 TATTGTTTTCATTCTTTAGGAGG - Exonic
1197574738 X:128198299-128198321 ATTTGGTGTCACTCCTTAGGAGG - Intergenic
1198491250 X:137144059-137144081 TAGTGCTGTCACTCACTCTGGGG + Intergenic