ID: 972645178

View in Genome Browser
Species Human (GRCh38)
Location 4:40961105-40961127
Sequence GTAGCAGTCCACTAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972645178_972645181 0 Left 972645178 4:40961105-40961127 CCATCATATTAGTGGACTGCTAC 0: 1
1: 0
2: 1
3: 2
4: 72
Right 972645181 4:40961128-40961150 TGCCAGGCTTCTATGTGAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
972645178_972645180 -1 Left 972645178 4:40961105-40961127 CCATCATATTAGTGGACTGCTAC 0: 1
1: 0
2: 1
3: 2
4: 72
Right 972645180 4:40961127-40961149 CTGCCAGGCTTCTATGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972645178 Original CRISPR GTAGCAGTCCACTAATATGA TGG (reversed) Intronic
902268437 1:15285964-15285986 GTATGAATCCACTTATATGAGGG + Intronic
907743883 1:57193290-57193312 GTATGAGTCCACTGATATGTGGG - Intronic
907899363 1:58723366-58723388 GTTGAAGTCCCCTAATGTGATGG - Intergenic
1063731001 10:8697058-8697080 GCAGCAGACAACTAATAAGATGG + Intergenic
1067407695 10:46038034-46038056 GTATGATTCCACTTATATGAGGG + Intronic
1068798862 10:61116323-61116345 GTGGCTGTTCCCTAATATGATGG + Intergenic
1068888718 10:62126013-62126035 GTATGACTCCACTTATATGAAGG + Intergenic
1079023641 11:16928492-16928514 GTACCACTGCACTAACATGATGG - Intronic
1088334831 11:108692179-108692201 GTAGCAGTTGACTAACATTAAGG + Intronic
1095748707 12:45687834-45687856 GTAGCAGTAAGCTTATATGAGGG - Intergenic
1097574810 12:61378663-61378685 GAAGAAGACCACTTATATGAGGG - Intergenic
1102879079 12:116470430-116470452 GTGGTTGTCCACTATTATGAAGG + Intergenic
1111022979 13:82479128-82479150 GTTTCAGTACACTAAAATGAAGG + Intergenic
1111839916 13:93436705-93436727 CTTGCTGCCCACTAATATGATGG + Intronic
1115708773 14:36027010-36027032 GTATTAGTCCCCTTATATGAGGG + Intergenic
1121649319 14:95545442-95545464 GGAGCAGTGCTCTAATCTGATGG - Intergenic
1130242118 15:82203690-82203712 GTTGCAGACCACTTATATAAAGG - Intronic
1134088399 16:11374555-11374577 GTATGAGTCCACTTATTTGAAGG - Intronic
1137506316 16:49056916-49056938 GTAGGACTGCACTAGTATGAGGG - Intergenic
1138423973 16:56918092-56918114 GTAGCAGTCCCGTCATATGAAGG + Intergenic
1141924640 16:87160107-87160129 GGAGGAGTCCATTAATAAGAGGG - Intronic
1144024171 17:11262966-11262988 GCAGCAGGTCACTAATATCAGGG - Intronic
1144364989 17:14534748-14534770 GTATAAGTCCATTTATATGAAGG - Intergenic
1144377070 17:14654569-14654591 ATAGCAATTCAATAATATGAGGG - Intergenic
1149286315 17:55168962-55168984 GTAACAGTCCAGTCATATCATGG + Intergenic
1150630287 17:66875696-66875718 GGTGCAGTCCACCAATATCAGGG - Intronic
1153155828 18:2147799-2147821 GCAGCAGTACATTAATATAATGG - Intergenic
1155680304 18:28478936-28478958 GTAGCTTTCCCCTAATATCAGGG - Intergenic
1158102339 18:53843184-53843206 GTTGCACTCCTCTAATATGTTGG - Intergenic
1164551625 19:29217113-29217135 GTAGCAGAACACTGATATGCAGG + Intergenic
1167965682 19:53144485-53144507 GTAGCAATACAATAATATTAGGG + Intronic
927714967 2:25345909-25345931 GTAGGATTCCACTCATATGAGGG + Intergenic
927824079 2:26295316-26295338 GTAGGATTCCACTGACATGAGGG + Intergenic
929273771 2:40003025-40003047 GTACCACTGCACTAATAGGAGGG - Intergenic
938261253 2:129896527-129896549 GTAGGAGTACACAAACATGAGGG - Intergenic
944073547 2:195701028-195701050 GTAGAAGTCAAGTAAGATGAAGG - Intronic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1173740013 20:45393641-45393663 GTAACAGTACTCTAATATGCAGG - Intronic
1178424180 21:32466057-32466079 GTATGATTCCACTTATATGAAGG - Intronic
949164056 3:915762-915784 AAAGCAATCCACTAAAATGACGG + Intergenic
953706573 3:45235717-45235739 GCATGATTCCACTAATATGATGG + Intergenic
963309391 3:143691924-143691946 GTAGCAATCCAATAATATGATGG + Intronic
965616220 3:170595365-170595387 GTATGATTACACTAATATGAAGG - Intronic
970391986 4:15621639-15621661 GTATGATTCCACTTATATGAGGG + Intronic
970722546 4:19005125-19005147 GGAGCAGTACACTCTTATGATGG - Intergenic
972645178 4:40961105-40961127 GTAGCAGTCCACTAATATGATGG - Intronic
976714249 4:88106527-88106549 GTATGATTCCACTTATATGAGGG + Intronic
981356637 4:143796968-143796990 GTATGATTCCACTTATATGAGGG - Intergenic
981368171 4:143927568-143927590 GTATGATTCCACTTATATGAGGG - Intergenic
981377963 4:144037843-144037865 GTATGATTCCACTGATATGAGGG - Intergenic
994256233 5:97599888-97599910 GGAGCAGTCCAGAAACATGAAGG - Intergenic
1003718810 6:8677211-8677233 GTAAGATTCCACTTATATGAGGG - Intergenic
1007213539 6:40217767-40217789 AGAGCAGTCCACCAATCTGATGG + Intergenic
1007874296 6:45078414-45078436 CTTTCAGTCAACTAATATGAAGG - Intronic
1011749116 6:90437687-90437709 GTAGGATTCCACTTAGATGAGGG - Intergenic
1012756131 6:103232665-103232687 TTATCAGTCAACCAATATGATGG - Intergenic
1018040357 6:159916258-159916280 GTATGATTCCACTCATATGAGGG + Exonic
1026263499 7:68776240-68776262 GTATGATTCCACTTATATGAGGG + Intergenic
1027855319 7:83503794-83503816 GTGGCAGACAACTTATATGAGGG - Intronic
1029992769 7:104977056-104977078 GTAGCAGTTCAGTAATGTCAGGG - Intergenic
1030349060 7:108463008-108463030 GTATGATTCCACTTATATGAGGG - Intergenic
1044328594 8:90890090-90890112 GAAGCATTCAACTAATATAAGGG - Intronic
1045428430 8:102090053-102090075 TTAACAGTACACTAATATAAAGG + Intronic
1047271677 8:123366518-123366540 GTAGTAGTCCACTCAATTGATGG - Intronic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1051285932 9:15496222-15496244 GTAACAGTCCACTAACAACATGG - Intronic
1055549384 9:77417112-77417134 GAAACAGTCCATTAATATTAAGG - Exonic
1056402898 9:86245479-86245501 GTATGATTTCACTAATATGAGGG - Intronic
1058664876 9:107303607-107303629 ATAGGATTCCACTTATATGATGG - Intronic
1059047919 9:110891002-110891024 GAAGTATTCCACTAATATAAGGG + Intronic
1187016050 X:15330111-15330133 GTAACTGTCCACTATTATCAAGG - Intronic
1190479373 X:50860707-50860729 GTAAAAGTCCACTAGTATAAGGG - Intergenic
1190815041 X:53922444-53922466 GTTGCCATCTACTAATATGAGGG + Intergenic
1200082256 X:153583527-153583549 GTAGGATTCCACTTCTATGAGGG - Intergenic
1200179542 X:154141838-154141860 GTAAAATTCCACTTATATGAAGG - Intergenic
1200355475 X:155545596-155545618 GTAACAGACCACATATATGATGG + Intronic