ID: 972651754

View in Genome Browser
Species Human (GRCh38)
Location 4:41024631-41024653
Sequence TCCCTATGTTGAAGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 3, 2: 24, 3: 53, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972651754 Original CRISPR TCCCTATGTTGAAGGAGGGC TGG (reversed) Intronic
900895516 1:5480365-5480387 TCCCTGGGGTGAAGGAAGGCAGG + Intergenic
901020411 1:6252472-6252494 TCCCTGTGCAGATGGAGGGCAGG - Intronic
901198752 1:7454816-7454838 TCCCTGTGTTAAAGGAAGGTTGG + Intronic
901428101 1:9196298-9196320 CCCCCCTGTTGAAGGATGGCCGG + Intergenic
901442268 1:9285628-9285650 ACCCCATGGTGAAGGTGGGCAGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903036151 1:20493939-20493961 TCTCTATGGTCGAGGAGGGCTGG - Intergenic
905434561 1:37947616-37947638 GCCCTGTGTGGCAGGAGGGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916501192 1:165388629-165388651 TGCCGATGGGGAAGGAGGGCAGG + Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918242833 1:182635220-182635242 TCCCCATGTTGCAGGGAGGCGGG + Intergenic
919544562 1:198898798-198898820 TGCCTATGTTGAATGATGGACGG + Intergenic
919782555 1:201230152-201230174 TCCTGGAGTTGAAGGAGGGCAGG + Intergenic
924025929 1:239832995-239833017 ACCCCATCTTGAATGAGGGCTGG - Intronic
1062987812 10:1785648-1785670 GCCCTAAGCTGGAGGAGGGCGGG + Intergenic
1065048230 10:21763472-21763494 TCCCTCTGTGGAAGGGGGCCAGG + Intronic
1069594878 10:69664071-69664093 TCTATGTGTTGAAGGAAGGCTGG + Intergenic
1072048964 10:91684585-91684607 TCCCCATCTTCAAGGAGGGGTGG - Intergenic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074541322 10:114367451-114367473 GCCCTATGTTGAAGTAGGGGAGG - Intronic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075803258 10:125166348-125166370 TTCCTATGCTGCAGCAGGGCAGG + Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077706772 11:4494270-4494292 TCAATATGTTGAAGCATGGCAGG - Intergenic
1078086034 11:8233507-8233529 GCCCTATGAGGAAGGAAGGCTGG - Intronic
1079958563 11:26894294-26894316 TTCCAATGTTGAAGGTGGGTGGG + Intergenic
1080478761 11:32623660-32623682 GCCCTATGTTGAAGGATGAATGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083203163 11:61132170-61132192 GCCCGCTGTAGAAGGAGGGCTGG + Exonic
1083228468 11:61299982-61300004 CCCCTATGTGGAAGTGGGGCGGG - Exonic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1083492679 11:63024337-63024359 TTCATCTGTTGATGGAGGGCCGG - Intergenic
1084366833 11:68706936-68706958 TCCCAAGGGTGAAGGAGGCCAGG + Intergenic
1084775052 11:71369487-71369509 TCCCTATCTTTAAAGTGGGCAGG - Intergenic
1085121862 11:73972553-73972575 TCCTTATCTTGAAGGAAGCCTGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1092696059 12:11172381-11172403 TGGGAATGTTGAAGGAGGGCGGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096542152 12:52313887-52313909 TACCTACGTGGAAGGATGGCTGG + Intergenic
1096688979 12:53307859-53307881 CCCCTTTGTTGAAGGAAGGATGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098357957 12:69628942-69628964 TCCCTGTGAGCAAGGAGGGCAGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1113282143 13:108800013-108800035 TCCCCATGATGATGGCGGGCGGG - Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1117513321 14:56474252-56474274 GCCCTATGTTCAATGAGAGCTGG + Intergenic
1119630399 14:76227107-76227129 TCCCCAAATTGCAGGAGGGCTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125967889 15:43888773-43888795 TCCTTCTCTTCAAGGAGGGCTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130908993 15:88258085-88258107 TCCCGAGCTTGGAGGAGGGCAGG + Intergenic
1133711337 16:8404360-8404382 TCCCAATGTTCAAAGAGGGTGGG + Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1137605121 16:49781966-49781988 CCCAGATGTGGAAGGAGGGCTGG + Intronic
1139224246 16:65218618-65218640 TCAATATGCAGAAGGAGGGCAGG - Intergenic
1140427929 16:74876075-74876097 TCCCTCTGTTGTAAGAGGGAAGG - Intronic
1141498488 16:84426848-84426870 TCACTACGTAGAAGAAGGGCGGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147672087 17:42182208-42182230 ACCCTATGGGCAAGGAGGGCAGG + Intergenic
1150984261 17:70177545-70177567 TCCCTAAGGTGAAGGTGGGCTGG - Exonic
1151293487 17:73166431-73166453 CCCCTATGTAAAAGGGGGGCGGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1166816085 19:45547066-45547088 TTCCTATGGGGAAGGAGGGAGGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927391133 2:22596707-22596729 TCCTTAGGATGTAGGAGGGCTGG + Intergenic
927796451 2:26053235-26053257 TCATTATTTTGAAGGAGGACTGG - Intronic
929120600 2:38480976-38480998 TCCATATGTTGAAGGGGAGAAGG + Intergenic
929439650 2:41955189-41955211 GCCCAAAGGTGAAGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
930303003 2:49640520-49640542 TCCCTACTTTAAAGGAGGGCTGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933522667 2:83392800-83392822 TCCCTTTTTTGGAGGGGGGCGGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
933807651 2:86011896-86011918 TCCCAAGGATGAAGGAAGGCTGG - Intergenic
933903333 2:86864985-86865007 TCGTTCTGGTGAAGGAGGGCTGG + Intergenic
935777181 2:106483974-106483996 TCGTTCTGGTGAAGGAGGGCTGG - Intergenic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940854317 2:158717882-158717904 CCTCTATGTGGAAGGAGGGAAGG + Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
943247505 2:185473951-185473973 ACCCAATGCTGACGGAGGGCAGG - Intergenic
945213604 2:207410092-207410114 TCCCACGGTTGAAGGAAGGCAGG - Intergenic
946161623 2:217839285-217839307 ACCCTATGTTCAAGGAGCCCTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1168893795 20:1310384-1310406 GCCCTTTGCTGCAGGAGGGCGGG + Exonic
1170744898 20:19090630-19090652 TCCCTCTTTTGAAGAGGGGCAGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174539469 20:51277570-51277592 CCCCTATGTTAAAGCAGGGGAGG - Intergenic
1174580790 20:51570190-51570212 TCCCCATTTTGCAGGAGGGGCGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175719940 20:61279882-61279904 TCCGTATCTTCAAGCAGGGCAGG - Intronic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178160777 21:29911721-29911743 TTCCTATGATGGAGGAGGGAGGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1183515716 22:38264705-38264727 ACTCTATGTAGAAGCAGGGCAGG + Intronic
1183562150 22:38583677-38583699 TCCATATGGTGAAGCAGGGCAGG + Intronic
1184067216 22:42127702-42127724 CTCCTATGTTGGAGGAGGTCAGG + Intronic
1185135980 22:49072891-49072913 TCCTTATGGTGAAGCAGGGCAGG + Intergenic
1185399123 22:50606876-50606898 TCCCTGTGTCAAAGGAGGCCTGG - Intronic
949489570 3:4575633-4575655 ACCCTGTGTTGGAGGAGGGTAGG + Intronic
950654213 3:14426763-14426785 TCCCTACCTGGGAGGAGGGCTGG + Intronic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
956030773 3:65035208-65035230 TCCCAATATTCAAGGATGGCAGG - Intergenic
956099285 3:65750217-65750239 TCACTGTGCTGATGGAGGGCAGG + Intronic
957034455 3:75281092-75281114 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
958421108 3:93932814-93932836 ACCCTCTGTTCAAGGAGGGCAGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961078366 3:124002994-124003016 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
962479284 3:135784893-135784915 TCCTGATGTTGAAGTAGGGGTGG - Intergenic
964668910 3:159203901-159203923 TCCCTGTGTGGTAAGAGGGCAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
967440426 3:189501465-189501487 TCCCAATGTTGAACTGGGGCCGG + Intergenic
968001114 3:195207355-195207377 ACCCTCTGTTGAAGAAGGGCAGG - Intronic
970917067 4:21348436-21348458 TCCCTATGCTGTAGGAGCACAGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
985777552 5:1852634-1852656 TCCCCATGTAGAAGGACGGGAGG - Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
987912284 5:24163261-24163283 TCCCTTTGTCTAATGAGGGCTGG + Intronic
990837248 5:60035688-60035710 TCCCTATTTGGGAGGAGGGGTGG - Intronic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
996211914 5:120820330-120820352 TCAATATTTTGAAGGAGGGATGG - Intergenic
998054714 5:139064498-139064520 TGCCTATATTTAAGGAGGGTGGG - Intronic
999398855 5:151249144-151249166 TCCCTAAGGTGTAGCAGGGCTGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003509480 6:6767615-6767637 TCCCAATGTTGGAGGTGGGTGGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004292677 6:14382748-14382770 TGCCCATGCAGAAGGAGGGCAGG - Intergenic
1004720840 6:18266154-18266176 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007113596 6:39327949-39327971 TACCTATGTTGATGGTGGGATGG - Intergenic
1009911975 6:69941393-69941415 TCCATATATTGAAGGAGAGGTGG + Intronic
1010571768 6:77482066-77482088 TAACTATGTGGAAGGAAGGCTGG - Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1011636926 6:89383101-89383123 TCTATATCTTGAAGGAGGGGTGG + Intronic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018133760 6:160757804-160757826 TCCCTGTGATGCAGGAGGGGAGG - Intergenic
1018174074 6:161164042-161164064 TCCCTATGCTGCAGGTGGGATGG + Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1020804629 7:12773200-12773222 TTGCTATGTTTAAAGAGGGCTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1029975044 7:104825927-104825949 TACCTATCTTCAAGGAAGGCTGG + Intronic
1032582447 7:133115916-133115938 CCCCAATGTTGGAGGAGGGGCGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034101817 7:148457276-148457298 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1037373512 8:18205240-18205262 CCCCTATGATGAAGGGAGGCAGG - Intronic
1037992522 8:23330984-23331006 TCCCTCTGGTTGAGGAGGGCTGG + Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039558408 8:38493646-38493668 TCCCTCTGTGGAAGCAGGGAGGG + Intergenic
1039628219 8:39078483-39078505 TCCCTATTTTAAATTAGGGCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042677799 8:71341727-71341749 TCTTTATCTTAAAGGAGGGCAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043212472 8:77540355-77540377 TCCCGGTGTGGCAGGAGGGCTGG + Intergenic
1044656871 8:94557650-94557672 TCCCTCTCTTGAAGGGGGGGAGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1049143705 8:140981468-140981490 TCCCACTGTTGAAGCTGGGCAGG + Intronic
1050969208 9:11847097-11847119 TCCCTAAGGTGAAGGAGGCAGGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055780316 9:79814040-79814062 TCTCTATGATGAAGGAGGTAGGG + Intergenic
1056492304 9:87119831-87119853 TTCCTCTGTAGAAGGAGGGGAGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1057713370 9:97467350-97467372 TCCCAAAGTAGAAGGAGGGAGGG - Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061825848 9:133257735-133257757 GTCCAATGTTGAGGGAGGGCTGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190641917 X:52488260-52488282 TCCCTAGGCTGGAGGAGGCCCGG + Intergenic
1190645755 X:52524606-52524628 TCCCTAGGCTGGAGGAGGCCCGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195687001 X:107596656-107596678 TGCATATGTGGGAGGAGGGCAGG - Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1198261025 X:134965025-134965047 CCCCAATGTTGGAGGTGGGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic