ID: 972652165

View in Genome Browser
Species Human (GRCh38)
Location 4:41028755-41028777
Sequence TCATGAAATTAGAGTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972652165_972652168 11 Left 972652165 4:41028755-41028777 CCAGGATCACTCTAATTTCATGA 0: 1
1: 0
2: 2
3: 12
4: 162
Right 972652168 4:41028789-41028811 TCTCTCGATCCCAGCCACAAAGG 0: 1
1: 1
2: 1
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972652165 Original CRISPR TCATGAAATTAGAGTGATCC TGG (reversed) Intronic
904777662 1:32921146-32921168 TCATGAAATCACTGTGATCTAGG - Intergenic
909107126 1:71425531-71425553 GCATGAAATTGGAGTAATCCCGG - Intronic
911987604 1:104649237-104649259 TAATAAAATTAGAGAAATCCTGG + Intergenic
914922573 1:151857510-151857532 TCAAGAAAATAAAGTGATACAGG - Intergenic
917143627 1:171863793-171863815 TCTTGTAAGTAGAGTTATCCTGG - Intronic
917435938 1:175021353-175021375 TTAAGAAATCAGAGTGATCAGGG - Intronic
918326426 1:183415472-183415494 TCATGAAAATAGAGTGTTCATGG + Intronic
921494021 1:215814053-215814075 TTATAAAATTCGAATGATCCTGG - Intronic
1063615967 10:7600762-7600784 TCATGAAATTAGAGCCCTCATGG + Intronic
1065663387 10:28030536-28030558 TAATCAAATTAGAGTAATCTGGG - Intergenic
1069422287 10:68257746-68257768 TCAAGAAATCAGAGTGGGCCAGG + Intergenic
1072703494 10:97662433-97662455 ACCTGAAATTAAAGTGATACTGG - Intronic
1073895811 10:108156183-108156205 TCATGAAGTTAGAAGGAACCTGG + Intergenic
1077698815 11:4420566-4420588 TCATGAATTTAAAGTTATCATGG + Intergenic
1078680443 11:13470584-13470606 GAATGAACTTAGAGGGATCCTGG - Intergenic
1081375565 11:42354105-42354127 TTATGGAATTAGAGTGACACAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1087539746 11:99501301-99501323 TCATGAAATGAATGAGATCCAGG + Intronic
1090099279 11:123776874-123776896 AAATGAAATTAGAATGATCTGGG + Intergenic
1090602854 11:128390580-128390602 GCTGGAATTTAGAGTGATCCAGG + Intergenic
1093324961 12:17762024-17762046 TCATGAATGTTGAGTGATGCTGG - Intergenic
1095675200 12:44908642-44908664 GGATGAAATTAAAGTGATCCAGG + Intronic
1102683990 12:114710110-114710132 TCATCAATTTAGGGGGATCCTGG + Intergenic
1104091396 12:125520762-125520784 TCATGACAGTAGGGTTATCCTGG + Intronic
1106572413 13:30938858-30938880 TCTTGACATTGGAGTGTTCCAGG + Intronic
1109253315 13:60047462-60047484 TAATCAAATTAGAGTGATACAGG + Intronic
1110951550 13:81499070-81499092 TGATGAAATTTGAGTAGTCCTGG + Intergenic
1111286097 13:86094287-86094309 TCATGAAGTTAGAGTGACTAAGG - Intergenic
1111639514 13:90949063-90949085 TCATGAAGTTCCAGTGTTCCTGG + Intergenic
1112541245 13:100315612-100315634 TCATGAAATAAGAGTGCTTTTGG + Intronic
1113024818 13:105928994-105929016 TCCTGGAAATAGAATGATCCAGG - Intergenic
1113309263 13:109114178-109114200 TCAAGAAAAGAGAGTGACCCAGG + Intronic
1118149484 14:63174113-63174135 ACATGAAAGGAGAGTGATGCTGG + Intergenic
1119600051 14:75969677-75969699 TCATGCAAGTAGAGCTATCCTGG - Intronic
1120363627 14:83538464-83538486 ACATGAAATTATAGAGGTCCTGG - Intergenic
1120524300 14:85559893-85559915 ACATGAAGTGAGAGTGATCCAGG - Intronic
1121157189 14:91697122-91697144 TCATGAATTTAGAGTGAGACTGG + Intronic
1128687265 15:69696033-69696055 TAATTTAATTAGAGTGGTCCAGG - Intergenic
1129704339 15:77785843-77785865 ACATGAAGTTAGAGGGATCAAGG - Intronic
1131153449 15:90061043-90061065 TCATCAAATTACATTGATCACGG + Intronic
1132180520 15:99749431-99749453 TCATCAACTTAGAGTGTGCCAGG - Intergenic
1139458277 16:67101846-67101868 TCATAAGGTTAGAGTCATCCTGG + Intergenic
1144066150 17:11625872-11625894 TAATGACATCAGAGTGATCATGG + Intronic
1144777148 17:17790674-17790696 GCAGGAAATGAGAGTGATCTGGG + Intronic
1148619010 17:49020832-49020854 TCAAGAAATTATTGTCATCCTGG + Intronic
1150440535 17:65187784-65187806 TCAAGAGATTGAAGTGATCCTGG + Intronic
1155865270 18:30957081-30957103 TTATGAAATTATAGTCATTCTGG - Intergenic
1156751488 18:40462642-40462664 ACATGAAATTTGAGGGATACAGG + Intergenic
1158149124 18:54346966-54346988 AAATGAAATTATGGTGATCCTGG + Intronic
1158464705 18:57679958-57679980 TCACTTAATTAGAGTGAGCCGGG - Intronic
1160028468 18:75238430-75238452 ACATGAAATCACAGTGATCTGGG + Intronic
1164116094 19:22220301-22220323 TCTTGGTATTAGAGTGATACTGG + Intergenic
1164519476 19:28967577-28967599 TCAAAAAGTTAGAGAGATCCAGG + Intergenic
1167563961 19:50244456-50244478 GCAGGAAATCAGAGTGATCCTGG - Intronic
925591895 2:5518021-5518043 TCAGGAGAATAGAGTGAACCAGG - Intergenic
926030816 2:9586257-9586279 TCCTAAAATCAGAGAGATCCTGG - Intronic
927704956 2:25291223-25291245 TCCTGAAACTAGAGTCAACCTGG - Intronic
928005832 2:27560807-27560829 CCATGAATTTAAAGTGGTCCTGG - Intronic
931029830 2:58160739-58160761 TCATGAAATTACAGAAATACAGG - Intronic
932140756 2:69275547-69275569 GCTTTAAATTAGAGTTATCCAGG - Intergenic
933563735 2:83923160-83923182 AAATAAAATAAGAGTGATCCAGG - Intergenic
935357397 2:102215420-102215442 CTATGAAATTACTGTGATCCTGG + Intronic
937739178 2:125329431-125329453 TCATGAAATAAGAGTGCACAAGG + Intergenic
939070288 2:137531466-137531488 TCATTAAATGAGAGTGCTGCTGG - Intronic
940768324 2:157813904-157813926 ACATGACATTAGAATGAACCAGG + Intronic
945684291 2:212950420-212950442 GCTTGAAATCAGAGTGATCTGGG + Intergenic
946156591 2:217810765-217810787 TATTGAAATTAGAGTTATGCTGG - Intronic
948419935 2:237851797-237851819 TCATGTAATTAGATTGAGTCCGG - Intergenic
1169570896 20:6904085-6904107 TATTGAAATTAGAGTGCTTCAGG - Intergenic
1170221312 20:13944975-13944997 TCATGAAATTAAAATGAGACTGG + Intronic
1170232736 20:14068581-14068603 TTATGAAAGTAGAGACATCCAGG + Intronic
1177127369 21:17212238-17212260 TCATGAAAGCAGAGTCATCATGG + Intergenic
1179079574 21:38158398-38158420 TCATGCAAATAGAGTGAAGCCGG + Intronic
1179382187 21:40910143-40910165 TCAGGAGATAAGAATGATCCAGG + Intergenic
950954152 3:17033225-17033247 TTATGAATTAAGAGTGACCCAGG - Intronic
951137007 3:19116022-19116044 ATGTGGAATTAGAGTGATCCCGG - Intergenic
951320815 3:21242970-21242992 GCATGATATTAGGGTGATGCTGG + Intergenic
951509875 3:23488575-23488597 TTATGCAATTAGAATGATACCGG + Intronic
952810715 3:37400118-37400140 TCATGAAGTCAGAGTCATCATGG + Intronic
953364063 3:42326628-42326650 CCATGGCATTAGAGTGACCCTGG + Intergenic
953598136 3:44337320-44337342 GAATGAACTTAGAGGGATCCTGG + Intergenic
954995150 3:54874587-54874609 TCATGAACTTAGAATGGTACTGG - Intronic
956733601 3:72218637-72218659 ACATCAGATTAGAGTGATGCCGG + Intergenic
956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG + Intergenic
956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG + Intergenic
957391695 3:79581390-79581412 TCATCAAAGTAGAATAATCCTGG + Intronic
959366803 3:105470889-105470911 TCATGAATTTAAAGTAAACCAGG - Intronic
959908332 3:111734708-111734730 TCATGCAATTAGTCTGAGCCAGG + Intronic
962425041 3:135262237-135262259 TCAGGAAATAATAGTGATCGAGG + Intergenic
962773766 3:138639035-138639057 CCTTGAAATTAGAGTTATCACGG + Intergenic
963149347 3:142028461-142028483 TCTTGAAATCAGCGTGCTCCTGG + Intronic
963224689 3:142850446-142850468 TGATGACATTGGAGTGTTCCAGG - Intronic
970143510 4:13009139-13009161 TAATGAAATTAGAGAGTTACTGG - Intergenic
972249428 4:37284288-37284310 TCATGAAAGTAGAGTTATCCTGG - Intronic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
973555277 4:52075952-52075974 GAATGAACTTAGAGGGATCCAGG + Intronic
974316314 4:60286204-60286226 TCATGACAGTGGAGTGATTCAGG - Intergenic
974318991 4:60319505-60319527 TCATGTATTTATAGTGATGCTGG - Intergenic
976929601 4:90549448-90549470 TCATGAAAATAGAGTATTTCAGG + Intronic
977312963 4:95410284-95410306 TCATGCATTTAGAGTGGTACAGG - Intronic
977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG + Intronic
982122032 4:152151959-152151981 TCATGAACTTAGAGGAATTCTGG - Intergenic
984859749 4:184227513-184227535 TCATGGAATTAGAGTTCTTCTGG - Intergenic
987047506 5:14121695-14121717 TCATTAAATTATAGTGTTCTGGG + Intergenic
988127994 5:27067553-27067575 TCATGAAATTACAGAGGTCAAGG - Intronic
990212921 5:53500042-53500064 GCAGGAAAATAGAGTGAACCTGG - Intergenic
992173424 5:74126151-74126173 TCATGAAATTTGAGTGATCTAGG - Intergenic
992656271 5:78912992-78913014 TCATTAAATCAGAGGGATTCTGG + Intronic
995652015 5:114380371-114380393 CCATGAAATGAGAGAGAGCCAGG - Intronic
996646597 5:125825558-125825580 TCATGAAATAAGAGAGATTAAGG - Intergenic
1003817227 6:9855205-9855227 TTATAACATTAGAGTCATCCAGG - Intronic
1004152079 6:13130812-13130834 TTTTGGAATTAGAGTGATACTGG - Intronic
1007837821 6:44688842-44688864 TTTTGGAATTAGAGTGATACTGG + Intergenic
1008185050 6:48378444-48378466 TCATGCAAATAGAATGATGCTGG - Intergenic
1009435811 6:63617164-63617186 GCAGGAAATTAGAGGGATCCTGG - Intergenic
1009508438 6:64517111-64517133 TCATTAATTTGGAGTTATCCTGG + Intronic
1011927855 6:92670674-92670696 TCATGAAAATAGAGCCCTCCTGG - Intergenic
1012151056 6:95753859-95753881 TCATGAAATTTAGGTGATCTAGG + Intergenic
1013040250 6:106425936-106425958 TCATGAATTTAAAGTGAAACTGG - Intergenic
1013703898 6:112809411-112809433 GCATGAAATCAGAGTGTTACTGG + Intergenic
1014294092 6:119596969-119596991 TCATAAAATTAAAGAGATCTAGG + Intergenic
1017291365 6:152742458-152742480 TGATGAGAATAGCGTGATCCAGG + Intergenic
1017807226 6:157956186-157956208 TCACTAAATTAGAGTGGTACAGG - Intergenic
1017928806 6:158934865-158934887 TCATTAAATTTGAGGGATCAAGG - Intergenic
1018565798 6:165151404-165151426 CCACTAAATTATAGTGATCCAGG - Intergenic
1020673815 7:11154901-11154923 TCAAGAAATTAGAGTGACATAGG + Intronic
1020678104 7:11203885-11203907 TCATGCAATTAGGGTGAGCTGGG - Intergenic
1022231191 7:28414198-28414220 TCACAAAATTAATGTGATCCTGG + Intronic
1024171157 7:46788524-46788546 TCATCAAAATAGTGTGATACTGG - Intergenic
1024608154 7:51039544-51039566 TGATGAAAATAGTGTGTTCCAGG - Intronic
1025141779 7:56472642-56472664 CCATGAAATTAGCTTGATACAGG + Intergenic
1025611692 7:63080386-63080408 CCATGAAATTAGCTTGATACAGG - Intergenic
1025707922 7:63884094-63884116 CCATGAAATTAGCTTGATACAGG + Intergenic
1026424048 7:70271897-70271919 ACATGAAATTACATTGAACCTGG - Intronic
1027045363 7:74987566-74987588 TCAGGCAATTTGTGTGATCCAGG + Intronic
1028818598 7:95179029-95179051 TCTTGATATTAGGGTGATGCCGG - Intronic
1029387452 7:100252947-100252969 TCAGGCAATTTGTGTGATCCAGG - Intronic
1030757933 7:113312395-113312417 TCAAGAAGTTTCAGTGATCCAGG + Intergenic
1031469887 7:122156397-122156419 GCATGGAATTACAGTGAACCAGG + Intergenic
1032366444 7:131304643-131304665 ACATGAATTTTGAGTGATCCTGG + Intronic
1032445167 7:131976084-131976106 TAATGGGATTAGAGTGATCAGGG + Intergenic
1034845564 7:154441138-154441160 TCCTCAAAGCAGAGTGATCCAGG - Intronic
1038561143 8:28581224-28581246 GCATGAAATCACAGTCATCCAGG - Intergenic
1039049550 8:33480597-33480619 TGATGAAATTAGGGTGATAGAGG + Intronic
1039054994 8:33528896-33528918 TTTGGAAATTAGAGTTATCCTGG - Intergenic
1039840821 8:41291771-41291793 ACATGAAATTAGGTTAATCCAGG + Intronic
1042519230 8:69693026-69693048 TCATGAGTTTGGAGTGATGCTGG - Intronic
1043497477 8:80818073-80818095 TCATGTAACTAGAGAGATCTGGG - Intronic
1044139976 8:88638101-88638123 TCCTAACATTAGTGTGATCCAGG - Intergenic
1044323048 8:90827247-90827269 TGATTAAATTAGAGTGGTCAGGG - Intronic
1045270700 8:100658784-100658806 TCTTGAAAGTATGGTGATCCCGG - Intronic
1045762307 8:105625049-105625071 TCATTAAATTAGAGTTTTCTTGG - Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1048472427 8:134715066-134715088 TCAGGAAATTAGAGTTGTTCTGG + Intergenic
1048534981 8:135284744-135284766 TCATTAAATGAGTGAGATCCTGG + Intergenic
1048849876 8:138634783-138634805 CCATGCAATTAGAGTGATGTTGG - Intronic
1050125549 9:2353150-2353172 CCTTGAGATTAGAGTTATCCTGG - Intergenic
1052208048 9:25867525-25867547 TCATGAAATTATAGTGATGGTGG - Intergenic
1052613188 9:30802163-30802185 TCTTGAATTTAGAGTGCACCAGG + Intergenic
1054323021 9:63691702-63691724 TAATGAAAATAGTGTGATACTGG + Intergenic
1054964723 9:71010154-71010176 TCATGAAATTGGACTGGTCAAGG + Intronic
1055088892 9:72342617-72342639 CCTTGAAATTAGATAGATCCCGG - Intergenic
1056183612 9:84109699-84109721 TCAAGAAATTAAAGTTATTCTGG - Intergenic
1056499397 9:87192983-87193005 TCCTGAAAATAGACTAATCCAGG - Intergenic
1058591926 9:106574588-106574610 TCAAGAAATTGGAATGATCAGGG + Intergenic
1058731672 9:107856413-107856435 TCCTGAAATTAGGCTTATCCAGG - Intergenic
1061773046 9:132942599-132942621 CCATAAAATTAGAGTGCTTCAGG - Intronic
1062208749 9:135351721-135351743 ACATGAAGTTAGAGAGGTCCTGG + Intergenic
1185834269 X:3330336-3330358 TCATTAAGTTAGAGAGACCCTGG + Exonic
1189693206 X:43638050-43638072 GAATGAACTTAGAGGGATCCTGG + Intergenic
1194085475 X:89522005-89522027 TTTTGATATTAGAGTGATGCTGG + Intergenic
1197575968 X:128211886-128211908 TTATGATATTAGGGTGATACTGG - Intergenic
1199419924 X:147633341-147633363 GCATGAAATTAAAGTGATGATGG + Intergenic
1199585971 X:149416081-149416103 TCATGAAAATATTGTGATACTGG + Intergenic
1200438119 Y:3177874-3177896 TTTTGATATTAGAGTGATGCTGG + Intergenic
1202357157 Y:24063844-24063866 TCAGGAAGTGAAAGTGATCCGGG + Intergenic
1202513620 Y:25606270-25606292 TCAGGAAGTGAAAGTGATCCGGG - Intergenic