ID: 972652637

View in Genome Browser
Species Human (GRCh38)
Location 4:41033748-41033770
Sequence CCCTTTTATGTCATCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972652637 Original CRISPR CCCTTTTATGTCATCTGTGG TGG (reversed) Intronic
900107877 1:993105-993127 CCCGTGTCTGTCATCTGGGGAGG + Intergenic
902989316 1:20175149-20175171 CCTTTTTTTCTCATCGGTGGTGG - Exonic
903235610 1:21948829-21948851 CCCTTCTATTCCATCTCTGGAGG - Intergenic
906879176 1:49571744-49571766 CCCTTCTGTGTCATTTGTTGAGG + Intronic
906900350 1:49829297-49829319 GCCTTATAGGTCATGTGTGGAGG + Intronic
912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG + Intergenic
912563771 1:110570293-110570315 CCCTTCTGTGCCATCTCTGGGGG - Intergenic
919056465 1:192576265-192576287 CACTTTTATGTCTTTTGTAGTGG + Exonic
920812792 1:209302949-209302971 TCCTTTGCTGTCATCTGAGGTGG - Intergenic
923426244 1:233872762-233872784 GGCTTTTATGCCATCTGAGGTGG + Intergenic
923544320 1:234913213-234913235 CCCTTTGCTGCCCTCTGTGGGGG - Intergenic
1064144454 10:12816360-12816382 CCATTTAATGCCATCTGGGGGGG + Intronic
1068644398 10:59449820-59449842 GCCTGTTAGGTCATCTGTAGTGG - Intergenic
1077900396 11:6482705-6482727 CCATTTTCTGTCATCTGGGCAGG - Exonic
1080434780 11:32229713-32229735 CCCTTGTGTGCCCTCTGTGGCGG + Intergenic
1083352134 11:62037521-62037543 CACTTTTATGTCTTCTTTTGAGG + Intergenic
1083978576 11:66144975-66144997 CACTTTTATGTCATGTGATGAGG + Intronic
1091935027 12:4428218-4428240 CCCTTTCATGCCATCTCTGGGGG - Intronic
1092064288 12:5577221-5577243 CCATTTTATGTGATCTGGGTAGG + Intronic
1092882226 12:12896382-12896404 CACTTTTATGTCATCAGAGTTGG + Intronic
1093910994 12:24747445-24747467 CATTTTTATGACATCTTTGGAGG + Intergenic
1095955711 12:47804635-47804657 CCCTTTTCTATCTTCTTTGGAGG + Intronic
1097250461 12:57629900-57629922 CCCCTTTAGGCCAACTGTGGGGG - Intronic
1097494959 12:60319971-60319993 CCTTTGTATCTCTTCTGTGGGGG - Intergenic
1099949873 12:89290062-89290084 CCTTTTTATGTCATTTCTTGTGG - Intergenic
1101871679 12:108571040-108571062 CCATTTTAACTTATCTGTGGAGG - Intergenic
1104376810 12:128270218-128270240 CTCTTTTCTGAAATCTGTGGGGG + Intronic
1106402703 13:29445031-29445053 CCCATTTGTGACATCTCTGGTGG + Intronic
1106535384 13:30637251-30637273 CCCTTCTATGTCATTTTTGAGGG - Intronic
1108572172 13:51762456-51762478 TCCTTTTCTCTCATCTGTGTGGG + Exonic
1110345401 13:74441796-74441818 CATTTTTATGTCTTCTATGGAGG + Intergenic
1110429689 13:75409879-75409901 CCCTGCTATATCATCTCTGGAGG + Intronic
1110804962 13:79743895-79743917 CCTTTTTATTTCATCTGCAGTGG - Intergenic
1111716810 13:91888453-91888475 GCCTTTTCTCTGATCTGTGGTGG + Intronic
1112927959 13:104700405-104700427 CACTTTTATTTCATCTGTGTTGG - Intergenic
1112973037 13:105284254-105284276 CTATTTTACGTCATCTTTGGTGG + Intergenic
1114301925 14:21385927-21385949 GCCTTTTATGCCATTTGTGATGG - Exonic
1114937431 14:27558978-27559000 CCATTATAAGTCAGCTGTGGAGG - Intergenic
1119105669 14:71921291-71921313 CCCTTTTTTTTAATCTTTGGGGG - Intergenic
1121474587 14:94185640-94185662 CCCTTTTAAATCATCTGTTTGGG + Intronic
1121750195 14:96347689-96347711 CCATTTTATGTCTTCTTTTGAGG - Intronic
1124241879 15:28035127-28035149 CCATTTTATCTTCTCTGTGGTGG + Intronic
1124666138 15:31594600-31594622 CCTTTTTCTGTCATTTGTGTAGG - Intronic
1131652816 15:94420559-94420581 CCCTTCCAAGTCATCTGTGAAGG - Intronic
1132361198 15:101217393-101217415 CCATGTTCTGTCATCTGAGGGGG + Intronic
1138894667 16:61189161-61189183 CCCTTTTATGTCATTTATCAGGG - Intergenic
1139810629 16:69613685-69613707 ACCTTTAATGTTATCTGTGGAGG - Intronic
1140766053 16:78158375-78158397 CCATATTTTGTAATCTGTGGTGG - Intronic
1140973419 16:80035848-80035870 CCATTTTTTTTCATCTGTGTAGG - Intergenic
1144802228 17:17937529-17937551 CCTTTTTGTGTCACCAGTGGGGG + Intronic
1148057190 17:44806798-44806820 CCCCTTTATGTTCTCAGTGGTGG - Intronic
1149271718 17:54986456-54986478 CTCTTTTAAGTCATCTGTGCAGG + Intronic
1149342763 17:55703523-55703545 CCCTGTTATGTTATTTTTGGTGG + Intergenic
1159134840 18:64325675-64325697 GGCTATTATGTCATCTGTTGGGG + Intergenic
1160352853 18:78199886-78199908 CTCTTTTATTTTATCTGTGGTGG - Intergenic
1160917123 19:1502353-1502375 CCCCTTTAGGCCAGCTGTGGTGG - Intergenic
1164492636 19:28728520-28728542 CCGTTTTATTTCAGCTGTAGGGG - Intergenic
1164731859 19:30511640-30511662 CACTTTAATGTCTGCTGTGGGGG - Intronic
926831026 2:16962057-16962079 CCCTTTTATCTCATCTTTGGTGG - Intergenic
927885573 2:26716345-26716367 CCCTTGTATTTCATTTGTGCAGG - Intronic
931035375 2:58236023-58236045 TCCTTTTCTGTCCTCTGTGTTGG - Intronic
933099263 2:78230990-78231012 CCCTTTTATGTCATCTGCTAGGG - Intergenic
935481052 2:103590477-103590499 ACCTTTTATGCCATCTTTGAAGG - Intergenic
937939603 2:127274816-127274838 TCCTTCTATTTCATCTGTGTGGG - Intronic
938326232 2:130405815-130405837 CTCTTTTCTGTCATTTTTGGTGG - Intergenic
938363706 2:130715644-130715666 CTCTTTTCTGTCATTTTTGGTGG + Intergenic
939354915 2:141088903-141088925 CCCTTTTATGTTATCTCAGAGGG - Intronic
941262569 2:163316181-163316203 CCCTTTCAACTCATGTGTGGTGG - Intergenic
942041875 2:172074401-172074423 CATTTTAATGTCATCTGTGATGG + Intronic
943040857 2:182803430-182803452 CCCATTTGTTTCATCTGTGCGGG + Intergenic
943292919 2:186098309-186098331 CCACTCTATGTCATCTGTGAGGG - Intergenic
946995126 2:225382862-225382884 CTCATTTATGTCTTCTGTGTAGG - Intergenic
947198742 2:227595990-227596012 CCCTCTGCTGCCATCTGTGGTGG + Intergenic
947328413 2:229002594-229002616 CCCTTTTCTGTTATCTTTAGTGG + Intronic
947967369 2:234292420-234292442 CCCATATATGTCATCTGGGGTGG - Intergenic
948067603 2:235092731-235092753 GCCTTTTATTTCATCACTGGTGG + Intergenic
1172133353 20:32670885-32670907 CACTTGCATGTCATCTTTGGAGG - Intergenic
1173423003 20:42919169-42919191 TCCCTTTATGCCATCTCTGGGGG - Intronic
1173812246 20:45963189-45963211 CAGTTTTATGGCGTCTGTGGTGG + Intronic
1178769680 21:35491326-35491348 CCCTTTGATTTCAGCTGTGAGGG - Intronic
1179934498 21:44593411-44593433 CCATTTTGTGTCTTCTGTGCGGG - Intronic
1184947506 22:47813924-47813946 CCCTTTTAAATCATCTGAGGCGG + Intergenic
950959651 3:17092324-17092346 CACTTTTATTTGATCTGCGGGGG - Intergenic
954013246 3:47662373-47662395 TGCTTTTTTGGCATCTGTGGTGG - Exonic
957245795 3:77714212-77714234 GCCTTTTATGTCATCTACGTTGG + Intergenic
957258908 3:77875181-77875203 GCCTTTTTTGTCCTTTGTGGGGG - Intergenic
957459292 3:80496707-80496729 CCCTTGTAGGCCAGCTGTGGTGG + Intergenic
960900622 3:122550924-122550946 ACCTTTCCTGTCATCTGAGGAGG - Intronic
961158498 3:124701153-124701175 CGCATTTGTGTCATCTGTTGGGG - Intronic
966778887 3:183566424-183566446 CTCTTTTATCTCATCTGTGCTGG - Intergenic
967392669 3:188972567-188972589 CCCTTTGGTGTCTTTTGTGGTGG + Intronic
967835399 3:193958396-193958418 CCATTTTATCTCATCTTTAGTGG - Intergenic
968163947 3:196449193-196449215 ACCTTTTAGCTGATCTGTGGGGG - Intergenic
968380313 4:89529-89551 CGTTTTTATTCCATCTGTGGAGG + Intergenic
972263085 4:37430827-37430849 ACCATTTATGTCATCCGGGGTGG + Intronic
972652637 4:41033748-41033770 CCCTTTTATGTCATCTGTGGTGG - Intronic
972708879 4:41573989-41574011 CTCTTATATGCCATCTGTGAGGG + Intronic
973142568 4:46786914-46786936 CTCTTTTATGCCACGTGTGGAGG - Intronic
975830674 4:78365228-78365250 CCCTTTTGCATCATCTGTGGAGG + Intronic
980080912 4:128343000-128343022 CTCTTTGCTGTCTTCTGTGGTGG + Intergenic
985164355 4:187076839-187076861 ACCTCTTATGTCTCCTGTGGAGG - Intergenic
985503789 5:266127-266149 CCATTACATGTCAGCTGTGGAGG - Intergenic
992089779 5:73306673-73306695 TCTTTTTATGTTTTCTGTGGGGG - Intergenic
994223822 5:97228817-97228839 GACTTTTATTTCGTCTGTGGAGG + Intergenic
994320402 5:98387788-98387810 CACCTTTATGCCATGTGTGGTGG - Intergenic
994493046 5:100472895-100472917 CACTTTTATGTCTTCTTTTGAGG + Intergenic
994612494 5:102061501-102061523 CATTTTTATGTCCTCTTTGGAGG + Intergenic
995969347 5:117948774-117948796 CCCTTTTATATCACTAGTGGAGG + Intergenic
1001347377 5:170917014-170917036 CCCTTAGATCTCATTTGTGGTGG + Intronic
1004025024 6:11810110-11810132 CCCTTTTACGTCAGCTGTTGAGG - Intergenic
1006289912 6:33126771-33126793 CCCTTTTCTGCCTTCTGTGGAGG + Intergenic
1011562337 6:88633224-88633246 ACCTTTTATGTATTCAGTGGGGG - Intronic
1016275569 6:142348254-142348276 CCCTTTGATGTATTCTCTGGAGG - Intronic
1016280065 6:142406566-142406588 CCTTTATATGTCATGTGTAGAGG + Intronic
1016311902 6:142743030-142743052 CCCTAGTATGTCAACTGTGTTGG + Intergenic
1016521505 6:144951763-144951785 CCCTGTTAAGTCATCTCTTGCGG + Intergenic
1018370873 6:163166706-163166728 CATTTTTATGCCATCTGTGCTGG + Intronic
1018665193 6:166128717-166128739 ACATTTTATGTCTTCTGTGCTGG - Intergenic
1020800423 7:12725995-12726017 CCCATTTATTTCAGCTGTGTGGG - Intergenic
1022546032 7:31190034-31190056 TCCCTTTATGTCACCTGTGGGGG + Intergenic
1022681463 7:32550776-32550798 ACATTTTTTGTCCTCTGTGGAGG - Intronic
1022689806 7:32637713-32637735 CACTTTTATGTATCCTGTGGTGG - Intergenic
1027516389 7:79147515-79147537 CCCTCCTGTGTCATCTGTGCAGG - Intronic
1031233936 7:119147507-119147529 TCATTTTATGCCATGTGTGGTGG + Intergenic
1033411034 7:141117982-141118004 CCATTCTATGGCATCTGTGGTGG + Intronic
1034043633 7:147905353-147905375 CCCTCTTCTCTCCTCTGTGGTGG - Intronic
1037013318 8:13872232-13872254 CCATTTTATGCAATCTGTAGAGG - Intergenic
1038986126 8:32812402-32812424 CCCTTTTTTTTCTGCTGTGGTGG + Intergenic
1040124217 8:43718475-43718497 TCCTTTTATGGAATCTGTGAAGG + Intergenic
1044312959 8:90716246-90716268 CACTTGTATGTCTTCTTTGGGGG + Intronic
1047050405 8:121105407-121105429 CCCTCCTCTGTCATCTGTGAGGG + Intergenic
1047728152 8:127702527-127702549 CCCTTTTAAGTCCACTCTGGGGG - Intergenic
1048651499 8:136483630-136483652 ACCTCATATGTCATATGTGGTGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1054877700 9:70113694-70113716 CCCTTGTCTCTCTTCTGTGGAGG - Intronic
1059700108 9:116767664-116767686 CCCTGTTCTGTGATGTGTGGAGG - Intronic
1061295860 9:129676332-129676354 TCCTTATTTGTCATCTGGGGAGG + Intronic
1186104198 X:6188141-6188163 TCCTTTTATGTAAACTATGGTGG - Intronic
1186152948 X:6694635-6694657 CTCTTTTATTTAATCTTTGGAGG + Intergenic
1195681425 X:107549769-107549791 CCCTTTGCTCTGATCTGTGGAGG + Intronic
1197389033 X:125838336-125838358 CCCCTTGATGTCATCTATTGAGG - Intergenic
1201934420 Y:19392217-19392239 CCCTTTTATGACAACTTTGCTGG + Intergenic