ID: 972653827

View in Genome Browser
Species Human (GRCh38)
Location 4:41047234-41047256
Sequence CTGTTCTCCTATAAGGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972653824_972653827 6 Left 972653824 4:41047205-41047227 CCAACTGTAAGGTACTCGATACT 0: 1
1: 0
2: 0
3: 5
4: 32
Right 972653827 4:41047234-41047256 CTGTTCTCCTATAAGGTCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972653827 Original CRISPR CTGTTCTCCTATAAGGTCTA AGG Intronic
907409118 1:54272449-54272471 CTCTTCTGCTACAAGGGCTAAGG + Intronic
908965793 1:69761054-69761076 CTTTTCTGCAATAAGGACTAAGG - Intronic
909246803 1:73296713-73296735 CTGTTCTACTATATATTCTAAGG - Intergenic
914931083 1:151934132-151934154 CTGTACTCCTAGAGGCTCTAGGG + Intergenic
920367061 1:205453717-205453739 CTGATCTCCAATAAGCTCCAAGG + Intronic
921210282 1:212890253-212890275 CTGTTATACTATAATGTTTAGGG - Intronic
922984455 1:229855306-229855328 CTGTTTTCCTCCAAGTTCTAGGG + Intergenic
924565812 1:245197249-245197271 TTGTTCTCCTAGAAGGCCCATGG - Intronic
1067455094 10:46413469-46413491 CTTTTCTCAAATACGGTCTATGG - Intergenic
1067632110 10:47971165-47971187 CTTTTCTCAAATACGGTCTATGG + Intergenic
1070586963 10:77773798-77773820 CTGTCCTCCTAAAATGTCTCTGG + Intergenic
1071439362 10:85676797-85676819 CTGTTCTCCTCTAAGTCCTCAGG + Intronic
1071752891 10:88501576-88501598 CTGAGTTCCTCTAAGGTCTACGG + Intronic
1073704872 10:105971655-105971677 CTGTTCTCCCATGTGGTCCAAGG + Intergenic
1074191004 10:111137361-111137383 TTGTTCTCCTAAATGGTCAATGG - Intergenic
1081752678 11:45523219-45523241 TTGTTGGCCTAGAAGGTCTATGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090999056 11:131893058-131893080 CTGTTCTCCTATAAAGTTCTTGG - Intronic
1092130909 12:6112591-6112613 CTCTTCTCCTAGAAGGGATAGGG + Intronic
1098610302 12:72449083-72449105 CTCTTTTCCTCTAAGGTTTAAGG + Intronic
1099607370 12:84821466-84821488 CTGGTCTCCTAAAATGTCTCTGG - Intergenic
1107482430 13:40795729-40795751 CTGTTCTGCTGTGAGGCCTATGG + Intronic
1110654862 13:77985989-77986011 CTGCTGTCATATAAGCTCTAGGG + Intergenic
1111533217 13:89568247-89568269 CAGTGCTGCTATAATGTCTAAGG + Intergenic
1113974479 13:114216302-114216324 CTGTTATACTTTAAGTTCTAGGG + Intergenic
1119782222 14:77284162-77284184 CTGCTCTCCTATTAGGCATAAGG + Intronic
1120696011 14:87646328-87646350 CTCTTCTCATATAAAGACTAAGG + Intergenic
1124918637 15:34001463-34001485 CTGTTCTGCCAGAAGATCTAGGG - Intronic
1129016519 15:72474101-72474123 CTCTTCACATAAAAGGTCTACGG + Intergenic
1134389710 16:13808146-13808168 CTGTTCTCCTCAAAGGCCTATGG - Intergenic
1136644658 16:31601503-31601525 CTGTTTCCCTATAAACTCTATGG + Intergenic
1138075121 16:54034634-54034656 CTGTTCTCCTAGTAGTTTTAGGG + Intronic
1140019951 16:71229285-71229307 TTATTCTCCTTTAAGTTCTAGGG - Intronic
1156555568 18:38063855-38063877 CTGTTCTCCTTTATGTTGTATGG - Intergenic
1161598241 19:5163627-5163649 CAGATGTCCTATAGGGTCTAGGG - Intronic
1162373905 19:10294105-10294127 CTGTTTTCCTGTGAGGTCGATGG + Exonic
928447114 2:31342412-31342434 CTGTTCTCCAAAAAAGTCCATGG + Intronic
934634237 2:95968125-95968147 TTTTTTTCCTACAAGGTCTAAGG - Intronic
934799396 2:97137108-97137130 TTTTTTTCCTACAAGGTCTAAGG + Intronic
934834048 2:97566354-97566376 TTTTTTTCCTATAAGGTCTAAGG - Intronic
935364374 2:102273987-102274009 CTGTTCTCGTAATATGTCTAGGG + Intergenic
939757061 2:146127664-146127686 CTGCTTTCCTATAAGGAATATGG + Intergenic
946397229 2:219449118-219449140 CTGTTCTTCTCCAAGGTCTGGGG - Exonic
1169617033 20:7459513-7459535 CTTTTCTCCTTTAAGGCATATGG + Intergenic
1173337828 20:42127155-42127177 CTGTTCTCCCACTAGTTCTAAGG - Intronic
1173888017 20:46478931-46478953 CTGTCCTCCTACAAGGCCTCTGG + Intergenic
1174148884 20:48472168-48472190 CTGTTTTCGTTTAAGGTCTGTGG - Intergenic
1174148997 20:48472905-48472927 CTGTTCTAGTTTAAGGTCCATGG - Intergenic
1174149051 20:48473269-48473291 CTGTTCTAGTTTAAGGTCCATGG - Intergenic
1175580097 20:60091916-60091938 CTGTTCTCCTCCAAGCTCCAAGG + Intergenic
1176838541 21:13817842-13817864 ATGTTCTCCTATAACGTTAAAGG + Intergenic
1177646253 21:23903063-23903085 TAATTCTCCTTTAAGGTCTATGG - Intergenic
1179220269 21:39400580-39400602 CTGCTCTCTTATAAGGCCTGCGG + Intronic
1183321958 22:37170352-37170374 CTGCTCTCCTGTTAGGTCTTGGG - Intronic
955869292 3:63419484-63419506 CTCATGTCCTATCAGGTCTAAGG + Intronic
956853431 3:73253507-73253529 CTGAACTCCTATATGTTCTAAGG + Intergenic
956974575 3:74565246-74565268 CTCTTCTCCTGTAGGCTCTAAGG + Intergenic
959918056 3:111840538-111840560 CTGTTCTCCTAAAAGTGGTATGG - Intronic
960303172 3:116029190-116029212 GTATTCTACTACAAGGTCTAAGG - Intronic
960486124 3:118254809-118254831 CTGTTCTTCCATAAGAGCTAGGG + Intergenic
961065352 3:123870436-123870458 CTGATCTCCTGTCAGGTATATGG - Intronic
972653827 4:41047234-41047256 CTGTTCTCCTATAAGGTCTAAGG + Intronic
981470362 4:145127056-145127078 CTGTTCTCTTATTAGGATTAAGG - Intronic
981815987 4:148831054-148831076 GTGTTCTCCTATAAATTCTGTGG + Intergenic
983031080 4:162802671-162802693 ATGTTTTCCTATAATGTCCATGG + Intergenic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
989979684 5:50628691-50628713 CTGTTATGTTATAGGGTCTAGGG + Intergenic
998635185 5:143946231-143946253 CTGTTCATCTATCTGGTCTATGG + Intergenic
999696491 5:154191700-154191722 CTGGACTCCCATAAGGTCAAAGG - Intronic
1008599448 6:53076274-53076296 CTTTTCTTCTAAAAGGTTTATGG + Intronic
1012768492 6:103398835-103398857 CTGATCTCCTGTAAGGTCAAAGG - Intergenic
1014083624 6:117316458-117316480 GTGTTCTCATCTAAGGTATAAGG + Intronic
1014643006 6:123937104-123937126 CTGTTCTGCTATTAGGTTTTTGG + Intronic
1014680488 6:124423708-124423730 CTGTGCTCCTACAAGGTGGAAGG - Intronic
1015489224 6:133806453-133806475 CTGTGCTCCTCTAAGGTCACTGG - Intergenic
1015755051 6:136598423-136598445 TTTTTCTCCTATAAGGTCAATGG + Intronic
1021835875 7:24674179-24674201 CTGTACTCATGTAAGGTTTAAGG - Intronic
1030656836 7:112177866-112177888 CTGTTCTTCTTTATGCTCTATGG + Intronic
1031030250 7:116726707-116726729 CTTTTCTCCCTTAAGGTGTAAGG - Intronic
1032148447 7:129405830-129405852 CTGTTGTCCTTTTAAGTCTAGGG - Exonic
1037932404 8:22889430-22889452 CTGTTCTCCTTTCTGCTCTAAGG + Intronic
1041254489 8:55968148-55968170 CTGAACTCCTATAAGGTGTCTGG - Intronic
1041848838 8:62363385-62363407 CTGTTCTACTATAAGGGCTCAGG - Intronic
1047754382 8:127907460-127907482 CTGTTCTCCTGCAGGGTCTCCGG + Intergenic
1048475496 8:134738923-134738945 CTGGTTTCCTAAAAGGACTAGGG - Intergenic
1048499978 8:134966688-134966710 CTGGACTCCTTTAAGGTCTTAGG + Intergenic
1052251421 9:26402177-26402199 CTGGTCTCGTACAAGGTTTATGG + Intergenic
1055382608 9:75725254-75725276 CAGTTCTCATATCAGGTATAAGG + Intergenic
1055596010 9:77864815-77864837 CTGTTCTCCTTTCAGGCCTGGGG + Intronic
1056134175 9:83614915-83614937 ATACTCACCTATAAGGTCTAAGG + Intergenic
1056581770 9:87892347-87892369 CTCTTTTCCTAAAAGGTTTATGG + Intergenic
1058753028 9:108058054-108058076 TTCTTCTCCTATAAGGTTTGGGG + Intergenic
1188083298 X:25872517-25872539 CTGTGCTACTATGAGGGCTAAGG - Intergenic
1188261553 X:28030643-28030665 CTGGTCTCCGAAAAGGTCCATGG + Intergenic
1190452137 X:50593092-50593114 CTGTTCCCCTAAAAAGGCTATGG + Exonic
1191156402 X:57278402-57278424 TAGTTCTTCTATAAGGTGTAAGG - Intergenic
1197171030 X:123434616-123434638 GTCTTGACCTATAAGGTCTATGG - Intronic
1197503225 X:127267291-127267313 CTCTTCTACTATAATCTCTAGGG - Intergenic
1197570060 X:128138438-128138460 CTTTGCACCTATAAGGTCAAAGG - Intergenic
1198024431 X:132691411-132691433 CTTTGCTCCTATAATGCCTAGGG - Intronic
1201631211 Y:16073568-16073590 CAGATGTCCTATAGGGTCTAGGG + Intergenic
1202266243 Y:23021948-23021970 CTGTTCTCCTATATTCTCTTTGG - Intergenic
1202419236 Y:24655691-24655713 CTGTTCTCCTATATTCTCTTTGG - Intergenic
1202451550 Y:25014393-25014415 CTGTTCTCCTATATTCTCTTTGG + Intergenic
1202586269 Y:26431319-26431341 TTTTTTTCCTACAAGGTCTAAGG + Intergenic