ID: 972659982

View in Genome Browser
Species Human (GRCh38)
Location 4:41106843-41106865
Sequence CTGGAGAAATAGTTGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972659975_972659982 17 Left 972659975 4:41106803-41106825 CCCAAGTACCTAGATCTTGGTTT 0: 1
1: 2
2: 1
3: 22
4: 145
Right 972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG 0: 1
1: 0
2: 3
3: 20
4: 327
972659977_972659982 9 Left 972659977 4:41106811-41106833 CCTAGATCTTGGTTTCTAAATAC 0: 45
1: 145
2: 247
3: 449
4: 799
Right 972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG 0: 1
1: 0
2: 3
3: 20
4: 327
972659976_972659982 16 Left 972659976 4:41106804-41106826 CCAAGTACCTAGATCTTGGTTTC 0: 3
1: 18
2: 119
3: 258
4: 521
Right 972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG 0: 1
1: 0
2: 3
3: 20
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972659982 Original CRISPR CTGGAGAAATAGTTGGGTCT GGG Intronic
900642191 1:3693095-3693117 CTGGAGACATGGCTGGCTCTGGG - Intronic
902027371 1:13394190-13394212 TAGGAGAAATACTTGAGTCTAGG - Intergenic
905205955 1:36342941-36342963 CTGGAGAAAGTGTTGGGCCTAGG - Intronic
905233959 1:36532783-36532805 CTGCAGAAATGGTTGTGTGTGGG + Intergenic
905487231 1:38310696-38310718 TTTGAGAAATAGTTGATTCTAGG - Intergenic
905942122 1:41872389-41872411 CTGTAACAATAGCTGGGTCTTGG - Intronic
905972340 1:42151507-42151529 CTGGGGAAATGGTTGGTTTTAGG + Intergenic
907014109 1:50994514-50994536 TTGGAGAAATAGCTGATTCTAGG + Intergenic
907301796 1:53491519-53491541 CTGGAGAACCACTTGAGTCTAGG + Intergenic
907678573 1:56542009-56542031 AAGGAGAAATGCTTGGGTCTGGG - Intronic
907988886 1:59559630-59559652 TTGGAGAAATAGTTGATTTTAGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
909818003 1:80021070-80021092 CTGGAGAAATGGCTGATTCTAGG - Intergenic
910282325 1:85514863-85514885 CAGGAGAAATAGCTGATTCTAGG - Intronic
911175112 1:94810803-94810825 CAGGAGAAATAGTTGAACCTGGG + Intergenic
912257495 1:108075710-108075732 TTGGAGAAATGGTTGATTCTAGG - Intergenic
912852007 1:113134868-113134890 ATGAAGAAATACTTGGGACTGGG + Intergenic
912856756 1:113176029-113176051 CTGGAACAATAGCTGAGTCTTGG - Intergenic
914049032 1:144116046-144116068 CTGGAGAGATCTTTGGGTCACGG - Intergenic
914130152 1:144849399-144849421 CTGGAGAGATCTTTGGGTCACGG + Intergenic
914207763 1:145549029-145549051 CAGGAGAAATAGCTGATTCTAGG + Intergenic
914867890 1:151447969-151447991 TTGAAGAAATGGTTGGTTCTAGG - Intronic
918268715 1:182873818-182873840 CTGGAGAAATGGCTGCTTCTAGG + Intronic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
919472558 1:197997397-197997419 GTGGAAAAATAATTTGGTCTTGG - Intergenic
919852719 1:201684187-201684209 TTGGAGAAATAGCTGATTCTTGG - Intronic
920995805 1:210989921-210989943 CAGAAGAAATAGTAGGGACTAGG - Intronic
921273585 1:213494139-213494161 CTACAGAAATGGTTGGGACTAGG + Intergenic
922015121 1:221637496-221637518 CTGGAGAAATAGTAGGAAGTGGG - Intergenic
922107624 1:222526102-222526124 CTTGAGAGGTGGTTGGGTCTGGG - Intronic
922246026 1:223798434-223798456 CTGGAGAAAGGGTCTGGTCTTGG + Exonic
922916125 1:229259212-229259234 CTGTAGGAATTGTTGGGTATTGG - Intergenic
923291566 1:232551289-232551311 ATGGAGAAAGAGCTGGTTCTGGG - Intronic
1063386866 10:5621280-5621302 CTGGAGGGACAGTTGAGTCTGGG - Intergenic
1064291765 10:14040936-14040958 CTGGAGAAATAGATTTCTCTGGG - Intronic
1066300415 10:34091081-34091103 CTGGAAAAATTGTTGGGAATGGG + Intergenic
1066710100 10:38224171-38224193 TTGGAGAAATAGGTGGGCCCAGG - Intergenic
1066979911 10:42403283-42403305 GTGGAGAAATAGGTGGGCCCAGG + Intergenic
1067018736 10:42776642-42776664 TTGGAGAAATGGCTGAGTCTAGG - Intergenic
1067495978 10:46760380-46760402 CTGGAGAATTGCTTGAGTCTGGG + Intergenic
1067598678 10:47580009-47580031 CTGGAGAATTGCTTGAGTCTGGG - Intergenic
1067902271 10:50254447-50254469 TTGGAGAAACAGCTGGTTCTGGG + Intergenic
1068648530 10:59496176-59496198 CTGAAGATTTAGTTGGGACTAGG + Intergenic
1068893810 10:62177908-62177930 TTGGAGAAATGGCTGGTTCTAGG + Intergenic
1069027886 10:63563403-63563425 TTGGAGAAATAGCTGATTCTAGG + Intronic
1069389282 10:67915526-67915548 CTGAAGCAGTAGGTGGGTCTTGG + Intronic
1069940787 10:71953901-71953923 GTGGAGAGTTAGTTGGGCCTTGG + Intergenic
1070234987 10:74614744-74614766 TTGGAGAAATAGTTGATTATAGG - Intronic
1072324715 10:94286400-94286422 CAGGAGAAATGCTTGAGTCTAGG + Intronic
1072670253 10:97424199-97424221 GTGGAGAAAGAGTATGGTCTTGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073849170 10:107594484-107594506 CAGGAGAAATACTTGAGGCTAGG - Intergenic
1074261576 10:111858955-111858977 TTGGAGAAATAGATGACTCTAGG - Intergenic
1075189885 10:120297374-120297396 CTGGAGGAATTGTTGTGACTGGG - Intergenic
1077887536 11:6396608-6396630 CTTAAAAAATAATTGGGTCTTGG - Intronic
1077942741 11:6860700-6860722 CTGGAGAAATGGCTGATTCTAGG - Intergenic
1077948665 11:6930182-6930204 TTGGAGAAATGGTTGATTCTAGG - Intronic
1078556129 11:12327598-12327620 CAGGAGAAATATATGGGTATTGG + Intronic
1078556154 11:12327845-12327867 CAGGAGAAATATATGGGTATTGG + Intronic
1079496860 11:21053727-21053749 CTGGAGAAATTGTCAGGCCTGGG + Intronic
1080124645 11:28718813-28718835 CTGGAAAAATAGTTTGTTGTTGG - Intergenic
1080851696 11:36076012-36076034 TTGGAGAAATAGTTGATTCCAGG - Intronic
1081605796 11:44526485-44526507 CTGGAGAAGGGGGTGGGTCTGGG - Intergenic
1082003243 11:47405820-47405842 CTGGAGAATTACTTGAGCCTGGG + Intergenic
1082294170 11:50417854-50417876 CTGGAGAAATGGCTGCTTCTAGG + Intergenic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1085101680 11:73805944-73805966 CTGGAGAAAGAAATGGTTCTAGG - Intronic
1086754055 11:90535920-90535942 TTGGAGAAATAATTGATTCTGGG - Intergenic
1089698663 11:120231042-120231064 CTGGAGCAATGGCTGGGGCTTGG - Intergenic
1090621052 11:128561556-128561578 CTGAAGAAAGAGTTGGGCCATGG + Intronic
1091593539 12:1859510-1859532 CTGTAGAAATATTTGGCTCTAGG - Intronic
1091888626 12:4034705-4034727 GTGGATCAATAGTTGGGACTCGG + Intergenic
1091968137 12:4763058-4763080 CTGTAACAATAGCTGGGTCTTGG - Intronic
1092807235 12:12235838-12235860 TTGGAGAAATAGTTGATTCAAGG + Intronic
1093800756 12:23369436-23369458 TTGGAGAAAGAGTTGAGTCCGGG + Intergenic
1093929166 12:24937731-24937753 CTGGAGAACAAATTGTGTCTGGG + Intronic
1095659016 12:44707208-44707230 CTGAAGAAATTGTTGTGTCCAGG - Intronic
1096096592 12:48939588-48939610 CTGTGGAAATTGTTGGCTCTTGG - Intronic
1100206178 12:92352806-92352828 CTGGAGAATCAGTTGAATCTGGG - Intergenic
1101542343 12:105676626-105676648 CTGGGTAAAAAGTTGGGCCTTGG + Intergenic
1101813992 12:108131122-108131144 CTGGAGGAATTCTTGGGTTTTGG - Intronic
1103449794 12:121020637-121020659 CTGCAGGACTGGTTGGGTCTGGG - Exonic
1103603261 12:122067830-122067852 GTGAAGAAATAGATGGGTGTGGG - Intergenic
1104637058 12:130444476-130444498 CTGGACAAATAGCGTGGTCTTGG - Intronic
1106803233 13:33278435-33278457 CAGTAGAAATATTTGGGTGTGGG - Intronic
1108161255 13:47642235-47642257 CTGGGGAAAGAGTTGAGTCCGGG - Intergenic
1110438630 13:75503277-75503299 TTGGAGAAATGGTTGATTCTAGG - Intergenic
1113011340 13:105770568-105770590 CTGGTGAAATAGATGATTCTGGG - Intergenic
1113836689 13:113332727-113332749 CTGGAGAAACAGGCGGGTCCAGG + Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1115270436 14:31545561-31545583 CTAGAGAAATGGCTGGCTCTAGG - Intronic
1115333487 14:32222229-32222251 CTGGAGAATTAGATGGGCATGGG + Intergenic
1115994437 14:39181172-39181194 CTGGAGTACTGGTTGGGACTGGG - Exonic
1116664920 14:47762363-47762385 CTGGAGAAAAAGTTGACCCTAGG + Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117812140 14:59558513-59558535 CTGGAGTAAGAGTTGAGTCAGGG + Intronic
1117984259 14:61372168-61372190 CTGGAGAAATAACTGATTCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122031779 14:98917612-98917634 TTGGAGAAAAAGTTCAGTCTGGG + Intergenic
1125772390 15:42178251-42178273 CTGGAGAAGTTGTTGGATTTGGG + Exonic
1126010051 15:44294223-44294245 TTGGAGAAATGGTTGACTCTAGG - Intronic
1127301360 15:57656939-57656961 CTGGAGAGACACTTGGTTCTGGG - Intronic
1128294083 15:66502740-66502762 CTGGAAAAATAGATGTGTCGTGG - Exonic
1128935686 15:71744655-71744677 CTAGAGAAAGAATTGGGTTTGGG - Intronic
1128944307 15:71810874-71810896 CTGGAGGTAGGGTTGGGTCTGGG + Intronic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1133037842 16:3044594-3044616 CAGGAGAAATGGTTGAGCCTAGG + Intergenic
1133546118 16:6809028-6809050 CTGTAACAATAGTTGAGTCTTGG + Intronic
1135286098 16:21194542-21194564 CTAGAGCAAGAGTTGGGTTTGGG - Intergenic
1136175827 16:28515620-28515642 CTTCAGAAATGGTTGGATCTAGG - Intergenic
1137848839 16:51718369-51718391 CTGGAGAAATGGCTGATTCTGGG - Intergenic
1137979692 16:53059066-53059088 CAGGAGAAACACTTGAGTCTAGG - Intronic
1140619513 16:76711754-76711776 TTAGAGAAATAGTTGATTCTAGG - Intergenic
1140718591 16:77749707-77749729 CTGGAGAAGCCTTTGGGTCTGGG + Intergenic
1203138153 16_KI270728v1_random:1743128-1743150 CTGGAGAGATCTTTGGGTCATGG + Intergenic
1143361180 17:6372555-6372577 CTGGAGAAATAGTAAGTTCCAGG + Intergenic
1143721834 17:8817878-8817900 CTAGAGAGGTAGTTGGGTCATGG + Intronic
1144724066 17:17492679-17492701 CTGGAGTATTGTTTGGGTCTCGG + Exonic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1145908500 17:28529202-28529224 CTGTAGGAATAGATGGGTTTTGG - Exonic
1146377871 17:32306826-32306848 CTGGAGAATCAGTTGAGCCTGGG + Intronic
1146444844 17:32925492-32925514 CTGTAAAAATAGCTGAGTCTTGG + Intergenic
1146602730 17:34232826-34232848 CAGGAGCAATTGGTGGGTCTAGG - Intergenic
1146974614 17:37099810-37099832 CTGGAGAAATAGCTGATTCTAGG + Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1149974191 17:61249568-61249590 CTGAAGAAATAGTTTGTTTTAGG + Intronic
1150009817 17:61493239-61493261 CTGAAGCAAGAGCTGGGTCTGGG + Intergenic
1150287103 17:63960711-63960733 CTGGAGAAATAGGTGAGGGTTGG + Intronic
1151147337 17:72053479-72053501 CTGGAGAACTCCTGGGGTCTGGG + Intergenic
1151805692 17:76403757-76403779 TTGGAGAAATGGTTGATTCTGGG + Intronic
1153388736 18:4531186-4531208 GTGGAGAAATAGGTAGGGCTGGG - Intergenic
1157083827 18:44556478-44556500 CTGGAGAAATATCTGCTTCTAGG + Intergenic
1157459340 18:47872952-47872974 CTGGAGAACTACTTGAGGCTGGG - Intronic
1157635829 18:49153456-49153478 CTGGAGAAATGGTTGATTCCAGG + Intronic
1158032829 18:52987515-52987537 TTGGAAAAATACTTGGGTTTTGG + Intronic
1158887230 18:61839954-61839976 CTGGAGAAATGGCTGAATCTGGG - Intronic
1159522736 18:69547056-69547078 CAAGAGAGATAGTTGGGTCAGGG + Intronic
1160705775 19:529649-529671 CTGGAGTAAAAGGAGGGTCTCGG - Intergenic
1162409870 19:10499275-10499297 CTGGAGAAAAAGGAGGTTCTGGG - Intronic
1166412266 19:42563629-42563651 CTGGAGAAATAGCTGATTCCAGG + Intergenic
1168284844 19:55325880-55325902 CTCTAGAGATAGATGGGTCTCGG + Intronic
1202688483 1_KI270712v1_random:68940-68962 CTGGAGAGATCTTTGGGTCACGG - Intergenic
1202690854 1_KI270712v1_random:94979-95001 TTGGAGAACTATTTGAGTCTAGG - Intergenic
925290780 2:2747325-2747347 TTGGAGAAATGGTTGATTCTAGG - Intergenic
925962485 2:9030906-9030928 CTTGTGAAATATTTAGGTCTTGG - Intergenic
926033434 2:9613614-9613636 GTCGAGAAATATTTGGGTCATGG - Intronic
926936508 2:18091214-18091236 CTGGAGAAATATTTATCTCTTGG - Intronic
926956671 2:18309214-18309236 CTAGAGAAATACTTGAGACTGGG - Intronic
927289338 2:21389506-21389528 TTGGAGAAATAGCTGATTCTAGG + Intergenic
928599300 2:32887467-32887489 CTGGAGAAATGGCTGATTCTAGG + Intergenic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
930655239 2:54001266-54001288 TGGGAGGAATACTTGGGTCTGGG + Intronic
931050128 2:58404053-58404075 CTGGTAAAATGGTTGGTTCTAGG + Intergenic
931525581 2:63148729-63148751 ATGGAGAAATAGTAGATTCTAGG + Intronic
933957939 2:87386988-87387010 CTGGAGAGATCTTTGGGTCACGG + Intergenic
933982839 2:87567412-87567434 CTGGAGAAATGGCTGATTCTAGG + Intergenic
934242061 2:90278906-90278928 CTGGAGAGATCTTTGGGTCACGG + Intergenic
934271112 2:91537782-91537804 CTGGAGAGATCTTTGGGTCACGG - Intergenic
936311001 2:111383381-111383403 CTGGAGAAATGGCTGATTCTAGG - Intergenic
937277302 2:120693177-120693199 CTGGAGAAATAGGTGGTTCCAGG + Intergenic
937598696 2:123703004-123703026 TTGGAGAAATAGATGATTCTAGG + Intergenic
938231328 2:129662524-129662546 CTGGAAAAATGGCTGAGTCTAGG + Intergenic
938510208 2:131934663-131934685 TTGGAGAAATGGCTGGTTCTAGG + Intergenic
939007661 2:136807842-136807864 TTGGAGAAATGGCTGGTTCTAGG - Intronic
939143846 2:138389342-138389364 CTGGAGAAAGAGAGGGGTGTGGG - Intergenic
939145987 2:138415294-138415316 CTGGAGAAATGGCTGATTCTAGG + Intergenic
940139704 2:150480487-150480509 CTGGAGAAAGTATTGGTTCTTGG + Intronic
941411092 2:165157999-165158021 TTGGAGAAATGGTTGATTCTAGG - Intronic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
942311430 2:174660573-174660595 ATGGAGAATGTGTTGGGTCTCGG + Intronic
942794298 2:179798280-179798302 TTGGAGAAATGGTTGATTCTAGG - Intronic
943112571 2:183623955-183623977 CTGGAGAAATAGTTGGTTCCAGG + Intergenic
943201622 2:184834381-184834403 TTGGAGAAATAGCTGATTCTAGG - Intronic
943584765 2:189725421-189725443 TTGGAGAAATAGTTGATTCTGGG + Intronic
944008193 2:194937804-194937826 TTGGAGAAATAGATGATTCTAGG + Intergenic
946318938 2:218937126-218937148 TTAGAGAAATGGTTGGTTCTAGG + Intergenic
946354060 2:219173867-219173889 CTGGAGGATTACTTGGGTCCAGG - Intronic
946593348 2:221276707-221276729 CTGTTGAAATAGATAGGTCTGGG + Intergenic
946643809 2:221812568-221812590 CTGGAGAAATGGCTGGCTCTAGG - Intergenic
946734461 2:222740520-222740542 CTGGAGAACCAGGTGAGTCTTGG + Intergenic
948325191 2:237112716-237112738 TTGGAGAAATAGTTGGTTTCAGG + Intergenic
949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG + Intergenic
1169802588 20:9525867-9525889 ATGGAGAAAGAGCTGTGTCTGGG - Intronic
1170178184 20:13496514-13496536 TTGGAGAAATGGCTGGTTCTGGG + Intronic
1170514390 20:17113338-17113360 CTGGAGAAATAGCTGATTCTAGG - Intergenic
1170903119 20:20485394-20485416 CAACATAAATAGTTGGGTCTTGG + Intronic
1172553460 20:35820299-35820321 CTGGAGAAATAGTGGTGATTAGG + Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1174496603 20:50948628-50948650 CGAGAGAAAAAGTTGGGACTAGG - Exonic
1177981264 21:27917427-27917449 TTGGAGAAATGGCTGGTTCTAGG - Intergenic
1178387618 21:32166405-32166427 CTGGAGAAATGTTTGATTCTAGG + Intergenic
1178969016 21:37154549-37154571 CTGGAGAAATAGGTTTGCCTGGG + Intronic
1180018342 21:45102482-45102504 TTGGAGAAATAGCTGATTCTAGG + Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180970647 22:19813301-19813323 CTGGAGAAATGGCTGAGTCTAGG + Intronic
1181134547 22:20755386-20755408 ATGGAGAAATGGTTGATTCTAGG - Intronic
1181828571 22:25540115-25540137 TTGGAGAAATGGTTGATTCTAGG - Intergenic
1181955346 22:26584223-26584245 TTGGAGGAAGAGTTGGGACTTGG + Intronic
1182052878 22:27326439-27326461 CTAGAGAAATAATTGGTTCCAGG + Intergenic
1182298450 22:29324654-29324676 CAGGAGAATCACTTGGGTCTGGG + Intergenic
1183879110 22:40811520-40811542 CTGGAGAATCACTTGAGTCTGGG - Intronic
1184926939 22:47649030-47649052 TTGGAGAAATGGTTAGTTCTGGG + Intergenic
949658625 3:6251398-6251420 CTTGAGAAATATTTATGTCTAGG + Intergenic
950542036 3:13618556-13618578 CTGGGGAGATAGCTGGGTTTTGG - Intronic
950998081 3:17526308-17526330 CTGGAGGATTACTTGAGTCTAGG - Intronic
951855624 3:27193685-27193707 CTGGAAAAATAGTGGGATTTTGG - Intronic
952232744 3:31448392-31448414 CTGGAGAAATGCTTGGGTGAGGG - Intergenic
952345645 3:32482111-32482133 GAGGAGAAATAGCTGGGTTTTGG - Exonic
953407719 3:42667705-42667727 ATGGGCAAATAGGTGGGTCTTGG + Intergenic
954891963 3:53938894-53938916 CTAGAGAAATGGTTGCGTTTAGG + Intergenic
957987131 3:87586895-87586917 CTACAGAAATAGTTTGGGCTGGG - Intergenic
958159522 3:89799447-89799469 TTGGAGAAAGAGTTGATTCTAGG + Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961943793 3:130664320-130664342 CTGGAGACAGTGTTGGGTCACGG + Intronic
962428110 3:135292529-135292551 TTGGAGAAATAGCTGATTCTAGG + Intergenic
963189496 3:142453714-142453736 CAGGAGAAATAGTTGGGAAAAGG - Intronic
963740062 3:149069418-149069440 CTGGAGTAATGGTTCAGTCTTGG - Intronic
964077587 3:152710450-152710472 TTGGAGAAATGGCTGGTTCTTGG + Intergenic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
965353298 3:167642720-167642742 CTGGAGAAATGGCTGGTTCCAGG + Intronic
966504514 3:180684570-180684592 CTGGAAAAATAGTTGTCTCTGGG - Intronic
967340836 3:188395819-188395841 TGGGAGAAATACTTGAGTCTAGG + Intronic
971306315 4:25485163-25485185 CTGGAACAATAGCTGAGTCTTGG + Intergenic
971334549 4:25710671-25710693 GAGGGGAAATACTTGGGTCTGGG + Intergenic
971917622 4:32893392-32893414 CTGGAGAATTACTTGAATCTGGG + Intergenic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
973660707 4:53103689-53103711 CTGAAGAAATAGCTGATTCTAGG + Intronic
975283432 4:72589760-72589782 TTTGAGAAACAGTTGGATCTGGG + Intergenic
977590350 4:98819316-98819338 CTGGAGAAATGGCTGATTCTAGG + Intergenic
978225086 4:106322681-106322703 CTGGAGAAGAAGTAGAGTCTGGG + Intronic
978746441 4:112200012-112200034 CTGGAGAAATGGCTGATTCTAGG + Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
979943115 4:126788080-126788102 CTGGAGAAATGGCTGATTCTTGG + Intergenic
980268121 4:130546573-130546595 CTGGAAAAATAGTTAGGATTAGG - Intergenic
982509665 4:156265612-156265634 GTGAAGAAATAGTTGAGACTGGG - Intergenic
983030549 4:162796251-162796273 CGTGACAAATAGTTGAGTCTGGG - Intergenic
983410177 4:167386272-167386294 CTGGAGGATTACTTGAGTCTGGG - Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984289367 4:177774643-177774665 CTGGAGAAATGGCTGATTCTAGG + Intronic
986257742 5:6114680-6114702 TTGGAGAAATGATTGGATCTTGG + Intergenic
986774912 5:11005515-11005537 TGGGAGACATAGTTGGGTATGGG + Intronic
987230502 5:15889015-15889037 CTGTAGAAATATCTGGGCCTTGG + Intronic
987389543 5:17363125-17363147 GTGGGGAAATGGTTGGGCCTGGG - Intergenic
987424795 5:17760467-17760489 CTGGAGCAAGAGTAGGGACTGGG + Intergenic
988374381 5:30415427-30415449 TTGGAGAAATAGGTGATTCTAGG + Intergenic
988832941 5:35004848-35004870 TTGGGGAAAGAGTTGGATCTGGG - Intronic
989030863 5:37116939-37116961 CAGGTGAAATGGTTGGGTCTGGG + Intronic
989764272 5:45061461-45061483 TTGGAGAAATAGCTGATTCTAGG + Intergenic
990050809 5:51497490-51497512 CTGGAGAAATGACTGGTTCTAGG - Intergenic
990578475 5:57146628-57146650 CAGGAGAATCACTTGGGTCTGGG - Intergenic
991310860 5:65240195-65240217 CGGGAGAATCACTTGGGTCTAGG - Intronic
993099623 5:83521339-83521361 CTGGAGAAATAGTCGCTTCAAGG - Exonic
993605998 5:89991290-89991312 ATGGAGAAATTCATGGGTCTAGG - Intergenic
993911122 5:93686080-93686102 CTGGAAAAATATTTGTGTTTGGG - Intronic
993951341 5:94179628-94179650 CTGGAGAAATAGCTGATTCTAGG + Intronic
995894368 5:116995171-116995193 CTGGATAACTAGTTGTGTCTTGG + Intergenic
996042419 5:118830548-118830570 CTGGAGAAATAGCTAATTCTAGG - Intergenic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998951038 5:147393360-147393382 TGGAAGAAATGGTTGGGTCTTGG + Exonic
1001038133 5:168312899-168312921 CAGGAGAATTACTTGAGTCTGGG - Intronic
1001695514 5:173667164-173667186 CTGGTGAAATAAGTGGGTCAAGG - Intergenic
1002124869 5:177035370-177035392 CTGGAGAGATAGTTGGTAGTTGG + Intronic
1002152707 5:177248499-177248521 TTGGAGAAATAGTTTAGTGTTGG + Intronic
1002591962 5:180296658-180296680 CTGGAGAAATGGTTGATTCTAGG + Intergenic
1003289603 6:4768329-4768351 TTGGAGAAATGGTTGATTCTAGG + Intronic
1003840131 6:10111518-10111540 TTGGAGAAAATGATGGGTCTTGG + Intronic
1006012025 6:31050850-31050872 GTGGAGAAATAGTTGATTCCAGG + Intergenic
1006651725 6:35557254-35557276 CTGCAGAAATGGTTTAGTCTTGG - Intergenic
1006658236 6:35615364-35615386 TTGGAGAAATGGTTGGTTCCAGG + Intronic
1006690520 6:35879966-35879988 CAGGAGAAGTACTTGAGTCTGGG + Intronic
1006889079 6:37408880-37408902 CTTGAGGAGTAGTTGGCTCTGGG - Intergenic
1007183492 6:39947925-39947947 CTGGAGAAAGGGATGGGTGTAGG + Intergenic
1007444403 6:41894604-41894626 CTGGGGTAATAGTTGGGAGTAGG - Intronic
1010021716 6:71167924-71167946 CTGAAGAAATACTTGAGACTGGG - Intergenic
1010309771 6:74371316-74371338 CTGGAGAAAGAGCTAGGACTGGG + Intergenic
1010770140 6:79818486-79818508 CGGGAGAAAGATTTGGGTTTTGG - Intergenic
1012469456 6:99554749-99554771 TTGGAGAAATGGTTGATTCTAGG - Intronic
1013600476 6:111699538-111699560 CTGGAGAAGAAGCTGGGTCAGGG - Intronic
1014477539 6:121891954-121891976 CTGGAGAAAAAGGTGAGTATGGG + Intergenic
1014771255 6:125459833-125459855 CTAAAGAAATACTTGAGTCTGGG + Intergenic
1016110599 6:140218871-140218893 CTGGTGAAATACTTGGGTGAGGG + Intergenic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1016854109 6:148649407-148649429 CTGGAGCAATAGCTGAGTCTTGG - Intergenic
1017716165 6:157214966-157214988 CAGGAGAATTAGTTGTGCCTAGG + Intergenic
1020910904 7:14129843-14129865 ATGAAGAATTAGTTGGGTTTTGG - Intergenic
1022228473 7:28388592-28388614 CTGGAGAAATACTTGGAACTAGG - Intronic
1024171752 7:46795146-46795168 CTGGAGAAATGGGTGATTCTAGG - Intergenic
1026045227 7:66902286-66902308 CTGAAGCAAGAGCTGGGTCTGGG - Intergenic
1026596879 7:71740309-71740331 CTGTAACAATAGTTGAGTCTTGG + Intergenic
1028968269 7:96827409-96827431 CTTGAGAAACAGTTGGGTGAGGG - Intergenic
1029524986 7:101088777-101088799 CTGCAGTAAAAGATGGGTCTGGG - Exonic
1029978768 7:104858727-104858749 CAGGAGGAATAGTAGGCTCTGGG - Intronic
1030074924 7:105728701-105728723 CTGGAGAAATGGCTGATTCTGGG + Intronic
1031924193 7:127622434-127622456 TTGGAGAAATGGTTGATTCTAGG - Intergenic
1033828196 7:145218413-145218435 CAGGAGCCATAGCTGGGTCTAGG + Intergenic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1039122284 8:34160711-34160733 CTGTAAAAATAGTTCAGTCTCGG - Intergenic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1040573604 8:48630986-48631008 CTGGAGAAATGGCTGAGTCTAGG - Intergenic
1041014188 8:53574183-53574205 TTGAAGAAATAGCTGGTTCTTGG - Intergenic
1041487458 8:58394792-58394814 CTGGTGTAATAGTAGGGACTCGG + Intergenic
1041893936 8:62902422-62902444 CTGGAGTAAAAGTTGGGCTTGGG - Intronic
1042290512 8:67166191-67166213 TTGGAGAAATAGCTGATTCTAGG - Intronic
1042414025 8:68498869-68498891 CTGGAGAAATGGCTGAATCTGGG + Intronic
1044362104 8:91298264-91298286 GTGGAGAAAGAGTTGTGTGTAGG - Intronic
1044362188 8:91299964-91299986 GTGGAGAAAGAGTTGTGTGTGGG + Intronic
1044387138 8:91602420-91602442 CTGTAATAATAGTTGAGTCTTGG + Intergenic
1044627775 8:94251075-94251097 CAGGAGAAAGAGTTGAGTATGGG - Intronic
1045044169 8:98258622-98258644 CTGTAAAAATAGGTGAGTCTTGG + Intronic
1045478278 8:102571977-102571999 TTGGAGAAATGGTTGATTCTAGG + Intergenic
1046229776 8:111338632-111338654 CTGGAGGATTAATTTGGTCTGGG - Intergenic
1046860892 8:119090236-119090258 CTGGAGAAATGGTGGGGTACGGG + Intronic
1048315001 8:133355408-133355430 CTGCAGAGATAGTGGGGTCAGGG - Intergenic
1049989872 9:980860-980882 CTGGAGGAAAAGTTGGGGGTAGG - Intronic
1050514162 9:6425416-6425438 TTGGAGAAATGGTTGATTCTAGG - Intronic
1050990774 9:12149234-12149256 CTGGACAAAAACTTGGGTGTGGG - Intergenic
1052202947 9:25804485-25804507 CTAGAGAAAGAATAGGGTCTGGG - Intergenic
1052324863 9:27206647-27206669 CTGGATAAATTGTAGGATCTGGG - Exonic
1052497164 9:29241676-29241698 CTGTATAAATAGTTGTGTCTCGG - Intergenic
1054451404 9:65405284-65405306 CTGGAAAGATAATTGGGTCATGG - Intergenic
1055521762 9:77088537-77088559 CTGGGGAAATAGGTGGGAATGGG - Intergenic
1056039548 9:82648582-82648604 TTGGAGAGATAGTTGATTCTAGG - Intergenic
1056991036 9:91411219-91411241 ATGGAGAAATAGTTGGGTGTGGG + Intronic
1057236878 9:93367999-93368021 GTGAAGAAATACTTGAGTCTGGG - Intergenic
1057301541 9:93888473-93888495 CTGGAGAAATGGCTGATTCTAGG + Intergenic
1058287323 9:103194982-103195004 ATGGAGAAGTAGTTGGTTCCAGG + Intergenic
1185533114 X:837818-837840 CTGGAGAGATCTTTGGGTCACGG + Intergenic
1185573342 X:1151739-1151761 ACGGAGAAAGAGGTGGGTCTTGG - Intergenic
1185724140 X:2405702-2405724 CAGGAGAAACACTTGGGCCTGGG + Intronic
1187029816 X:15474316-15474338 CTGTAACAATAGCTGGGTCTTGG - Intronic
1187433547 X:19246772-19246794 GTGGAGAAAGAGCTGGGTCAGGG - Intergenic
1187535149 X:20134643-20134665 CTGGAGAAACACTTGAATCTGGG + Intronic
1187925839 X:24249475-24249497 TTGGAGAAATTGTTGATTCTAGG - Intergenic
1188812945 X:34674666-34674688 CCTGAGAAATAGTTGATTCTAGG - Intergenic
1190754237 X:53387642-53387664 CTGGAGAAATAGTGGATTCCAGG + Intronic
1192079634 X:68034020-68034042 ATAAAGAAATAGTTGGGTTTAGG - Intergenic
1192199417 X:69056030-69056052 TTGGAGAAATGGCTGGGTCAGGG + Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1192329272 X:70161427-70161449 TTGGAGAAATAGCTGATTCTAGG + Intronic
1192412947 X:70951042-70951064 CTGGAGAATCACTTGAGTCTGGG - Intergenic
1192656008 X:72995660-72995682 CTGGAAAAGTAGTGGGGTGTTGG + Intergenic
1194307387 X:92265160-92265182 TGGGAGAAATAGTTGAGCCTGGG - Intronic
1194423163 X:93702245-93702267 CTGTAGAAATAGCTGATTCTAGG + Intronic
1194472983 X:94320385-94320407 CTGGAAGAATAATTGGTTCTGGG - Intergenic
1196303423 X:114072240-114072262 CTGTAGCAATAGCTGAGTCTTGG - Intergenic
1197142994 X:123137317-123137339 CTGGAGAATCACTTGAGTCTGGG + Intergenic
1197375487 X:125677139-125677161 ATGGAGAAATACTTGAGACTGGG + Intergenic
1198495818 X:137191983-137192005 TTGGAGAAATAGCTGGTTCTAGG + Intergenic
1202194735 Y:22288401-22288423 CTGCAGAAATAGATTGGTTTTGG - Intergenic
1202200138 Y:22337972-22337994 CTGCAGAAATAGATTGGTTTTGG + Intronic