ID: 972661857

View in Genome Browser
Species Human (GRCh38)
Location 4:41123874-41123896
Sequence AAACGATTGCTTAAACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972661856_972661857 -9 Left 972661856 4:41123860-41123882 CCACAAGTAAATTTAAACGATTG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
972661855_972661857 19 Left 972661855 4:41123832-41123854 CCAAAAAACAAAACAAAACAAAA 0: 340
1: 623
2: 1025
3: 16772
4: 27627
Right 972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972661857 Original CRISPR AAACGATTGCTTAAACTAGC AGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905160240 1:36026739-36026761 AAAGGATTGCTTCAACTATAGGG - Intronic
915358423 1:155270703-155270725 AAACCATTGCCTTAAGTAGCTGG - Intronic
918243240 1:182638204-182638226 AAACAATTTTTTAAATTAGCTGG + Intergenic
918909806 1:190552653-190552675 CAATGATTGCTAAAATTAGCAGG - Intergenic
919061535 1:192640068-192640090 AAACTATTGCTAAAAATAGAGGG + Intronic
920278286 1:204824764-204824786 GAACGAATGCTAGAACTAGCCGG + Intergenic
1069336047 10:67352064-67352086 TAAAGATTGCACAAACTAGCAGG + Intronic
1074006412 10:109429348-109429370 AAAAGAGTGCTTAAAATGGCAGG + Intergenic
1079584333 11:22107155-22107177 AAATGTTTGCTTAAACTATTGGG + Intergenic
1080017844 11:27526204-27526226 AAACGATTGCATAGACTTGAGGG - Intergenic
1090056217 11:123427220-123427242 AAACAATTTCTCAAAGTAGCTGG - Intergenic
1093731956 12:22575140-22575162 AAAAGATTGCAAAAATTAGCTGG + Intergenic
1095812992 12:46391091-46391113 AAACCATTGTATAGACTAGCGGG - Intergenic
1100392091 12:94152368-94152390 AGAGCATTGCTTACACTAGCAGG - Intronic
1101274893 12:103188663-103188685 AATTGATTGCTTAAAGAAGCTGG + Intergenic
1102494381 12:113309328-113309350 AAAAGTTTACTTAAATTAGCTGG - Intronic
1109755244 13:66749756-66749778 AAAGGAGAGCTTAAACTAGAGGG - Intronic
1111401610 13:87744156-87744178 AAAGAATTGCTTAAACAATCTGG - Intergenic
1114886789 14:26862386-26862408 AAATGATAGCTTAAACTAGAAGG - Intergenic
1125133970 15:36319704-36319726 AAAAGACTACTTAATCTAGCCGG + Intergenic
1126850287 15:52792406-52792428 AAACAATGGGTTAAAGTAGCAGG + Intergenic
1127332324 15:57951332-57951354 AAACGAGAGCTTAGAGTAGCTGG - Intergenic
1134436751 16:14266444-14266466 AAACTAGTGCTTCAACAAGCAGG - Exonic
1135068787 16:19334290-19334312 TAACTTTTGCTTAAACTAGCTGG + Intergenic
1137333091 16:47519785-47519807 AAACTACTGCTAAAAATAGCAGG - Intronic
1140585265 16:76283315-76283337 GAACGATTTCTTAAACAACCTGG - Intronic
1142258381 16:89028327-89028349 AAAAGATTTTTTAAATTAGCTGG - Intergenic
1143211270 17:5189681-5189703 AAAAAATTATTTAAACTAGCTGG - Intronic
1144555983 17:16283304-16283326 AAACAATTGTTTTAATTAGCTGG + Intronic
1145735498 17:27228198-27228220 AAACAATTTTTTAAATTAGCTGG - Intergenic
1148917900 17:50998816-50998838 AAACTATTGCTTAGAATGGCGGG + Intronic
1149874493 17:60217896-60217918 AAAAAATTGTTTAAATTAGCTGG - Intronic
1150088279 17:62295147-62295169 AAAAAATTGTTTAAATTAGCTGG - Intergenic
1155658199 18:28215931-28215953 AGTAGATTACTTAAACTAGCAGG - Intergenic
1155726174 18:29086574-29086596 AAAAAATTGCTTAAAATAGATGG + Intergenic
1155894849 18:31312046-31312068 AAACGAATGCAAAAATTAGCTGG - Intergenic
1156103448 18:33627004-33627026 AACCGAATGCTTGAACTAGCAGG + Intronic
1157552608 18:48591907-48591929 AAAAGAATTTTTAAACTAGCTGG - Intronic
1164327328 19:24207638-24207660 AAACGAATGCTTAAACTCTGTGG + Intergenic
930853537 2:55987575-55987597 AAATGATTATTTCAACTAGCAGG + Intergenic
931149228 2:59554547-59554569 AAGCCATTATTTAAACTAGCTGG + Intergenic
933216244 2:79633694-79633716 AAACGCTTCCTTTGACTAGCTGG - Intronic
933544650 2:83695166-83695188 GAACGAATGCTGAAACCAGCCGG + Intergenic
939683347 2:145166969-145166991 AAATGGTTGCTTAAAGCAGCTGG + Intergenic
939703520 2:145422715-145422737 AAATTATTTCTTAAAATAGCAGG + Intergenic
940128219 2:150351808-150351830 AAACGAATGCAAAAATTAGCCGG - Intergenic
941792608 2:169569209-169569231 TAACTAGTGCTTCAACTAGCGGG + Exonic
947225275 2:227833802-227833824 AAACAACTGTTGAAACTAGCGGG - Intergenic
1177781433 21:25626281-25626303 AAAGAATTGCTTAATCCAGCCGG + Intergenic
952585066 3:34882455-34882477 AAACAATTGTTTAAACTAAATGG + Intergenic
954271766 3:49515474-49515496 AGAGGATTGCTTAAGCTAGGAGG - Intronic
955063209 3:55512214-55512236 TAACGATGGCTTGAAATAGCTGG - Intronic
956544392 3:70384173-70384195 AAAGGATTGATTAAATCAGCAGG - Intergenic
963326456 3:143868758-143868780 AAACACTTGCTTAAACAAACAGG + Intergenic
965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG + Intronic
965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG + Intergenic
967341613 3:188405035-188405057 AAAAGCTTGCTTAAACTAGGAGG - Intronic
971512223 4:27440920-27440942 AAACGGTTGCTTGAACTTACTGG + Intergenic
972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG + Intronic
975866899 4:78733149-78733171 ACACCATTGCTTAAACAAGGAGG - Intergenic
976601055 4:86937741-86937763 AAAAGATTTTTTAAATTAGCCGG - Intronic
980765760 4:137301660-137301682 AAACAATTGCTTACATTTGCTGG + Intergenic
983116741 4:163827420-163827442 AAATGATTTCTTTAAATAGCTGG + Intronic
983431266 4:167654676-167654698 ATACGATTGCTGATACTAGTAGG - Intergenic
983473064 4:168180696-168180718 AAATAATTACTTAAACTACCAGG + Intronic
990275066 5:54186913-54186935 AAAGGAGTTCTTAAACTACCAGG + Intronic
990365746 5:55068776-55068798 AAACAATTGCTAAAAAAAGCGGG - Intergenic
992169553 5:74088104-74088126 AAAAAATTTTTTAAACTAGCAGG + Intergenic
996315373 5:122155072-122155094 TAACGATGGCTGAAACTGGCTGG + Intronic
1003961113 6:11210386-11210408 AGACCATAGCTTAAACTACCAGG + Intronic
1008669490 6:53752883-53752905 AACCGACTTCTTAAACTATCCGG + Intergenic
1009860268 6:69321164-69321186 AAGAGATTGCTTAAAATAACAGG - Intronic
1009866835 6:69408483-69408505 AAACAATGGTTTAAACTAGCTGG - Intergenic
1011509542 6:88085242-88085264 ACACGATAGCTTAAATTTGCAGG - Intergenic
1013003817 6:106051603-106051625 AAAGGATTGCTTAGGATAGCTGG + Intergenic
1014082319 6:117302217-117302239 AAAAGATTGTTTAAAATAGTGGG - Intronic
1015764832 6:136705462-136705484 AAACAATTACTAAAATTAGCTGG - Intronic
1021837074 7:24688480-24688502 AAACCATTGTTTAAAGTAGTAGG - Exonic
1023441371 7:40188048-40188070 CATCAATTGCTAAAACTAGCTGG - Intronic
1024711825 7:52023586-52023608 CAACGGTTGCTAAAACTAGTGGG + Intergenic
1039533231 8:38283608-38283630 AAATGAATGGTTAAACTAGAAGG + Intronic
1039818475 8:41115535-41115557 AAAAAATTGTTTAAATTAGCTGG - Intergenic
1042839473 8:73109133-73109155 AAAAAATTTTTTAAACTAGCTGG - Intronic
1043853296 8:85238259-85238281 AAATAATTGATTAATCTAGCTGG - Intronic
1050795396 9:9534057-9534079 AAACCATAGCTTAAGCCAGCAGG + Intronic
1052509842 9:29401823-29401845 AAAGTATTTCCTAAACTAGCAGG + Intergenic
1058502379 9:105634039-105634061 AAAAGAAAGCTAAAACTAGCAGG - Intronic
1185932142 X:4215177-4215199 AAACAATTTTTTAAAATAGCTGG - Intergenic
1185966164 X:4606533-4606555 AAATGACTGCTTAAACTAAAGGG + Intergenic
1186159564 X:6762640-6762662 AAATGAATACTTAAAATAGCAGG + Intergenic
1198793738 X:140373879-140373901 AAAAAATTGTTTAAATTAGCTGG + Intergenic